microRNA information: hsa-miR-623
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-623 | miRbase |
| Accession: | MIMAT0003292 | miRbase |
| Precursor name: | hsa-mir-623 | miRbase |
| Precursor accession: | MI0003637 | miRbase |
| Symbol: | MIR623 | HGNC |
| RefSeq ID: | NR_030353 | GenBank |
| Sequence: | AUCCCUUGCAGGGGCUGUUGGGU |
Reported expression in cancers: hsa-miR-623
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-623 | lung cancer | downregulation | "Hsa miR 623 suppresses tumor progression in human ......" | 27685632 |
Reported cancer pathway affected by hsa-miR-623
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-623
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-623 | lung cancer | progression; metastasis | "Hsa miR 623 suppresses tumor progression in human ......" | 27685632 |
Reported gene related to hsa-miR-623
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-623 | lung cancer | MAPK8 | "Inhibition of hsa-miR-623 or overexpression of Ku8 ......" | 27685632 |
| hsa-miR-623 | lung cancer | XRCC5 | "Our previous study revealed that Ku80 was overexpr ......" | 27685632 |