microRNA information: hsa-miR-627-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-627-5p | miRbase |
| Accession: | MIMAT0003296 | miRbase |
| Precursor name: | hsa-mir-627 | miRbase |
| Precursor accession: | MI0003641 | miRbase |
| Symbol: | MIR627 | HGNC |
| RefSeq ID: | NR_030357 | GenBank |
| Sequence: | GUGAGUCUCUAAGAAAAGAGGA |
Reported expression in cancers: hsa-miR-627-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-627-5p | colorectal cancer | upregulation | "MicroRNA 627 mediates the epigenetic mechanisms of ......" | 23619147 | qPCR |
| hsa-miR-627-5p | gastric cancer | upregulation | "Plasma samples from 3 independent groups comprise ......" | 26607322 | Microarray |
Reported cancer pathway affected by hsa-miR-627-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-627-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-627-5p | colorectal cancer | differentiation | "MicroRNA 627 mediates the epigenetic mechanisms of ......" | 23619147 |
Reported gene related to hsa-miR-627-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-627-5p | colorectal cancer | KDM3A | "By down-regulating JMJD1A miR-627 increased methyl ......" | 23619147 |
| hsa-miR-627-5p | colorectal cancer | MBD2 | "The messenger RNA that encodes the histone demethy ......" | 23619147 |
Expression profile in cancer corhorts:
