microRNA information: hsa-miR-628-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-628-3p | miRbase |
| Accession: | MIMAT0003297 | miRbase |
| Precursor name: | hsa-mir-628 | miRbase |
| Precursor accession: | MI0003642 | miRbase |
| Symbol: | MIR628 | HGNC |
| RefSeq ID: | NR_030358 | GenBank |
| Sequence: | UCUAGUAAGAGUGGCAGUCGA |
Reported expression in cancers: hsa-miR-628-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-628-3p | prostate cancer | downregulation | "Circulatory miR 628 5p is downregulated in prostat ......" | 24477576 | Microarray; qPCR |
Reported cancer pathway affected by hsa-miR-628-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-628-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-628-3p | lung cancer | staging | "Based on the results from the screening and valida ......" | 27036025 |
Reported gene related to hsa-miR-628-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|
Expression profile in cancer corhorts:
