microRNA information: hsa-miR-630
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-630 | miRbase |
Accession: | MIMAT0003299 | miRbase |
Precursor name: | hsa-mir-630 | miRbase |
Precursor accession: | MI0003644 | miRbase |
Symbol: | MIR630 | HGNC |
RefSeq ID: | NR_030359 | GenBank |
Sequence: | AGUAUUCUGUACCAGGGAAGGU |
Reported expression in cancers: hsa-miR-630
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-630 | bladder cancer | upregulation | "The aims of this study were to explore the express ......" | 27752905 | qPCR |
hsa-miR-630 | gastric cancer | upregulation | "Increased microRNA 630 expression in gastric cance ......" | 24621930 | qPCR |
hsa-miR-630 | kidney renal cell cancer | upregulation | "Up regulation of miR 630 in clear cell renal cell ......" | 25031755 | qPCR |
hsa-miR-630 | kidney renal cell cancer | downregulation | "miR 630 functions as a tumor oncogene in renal cel ......" | 27279836 | |
hsa-miR-630 | lung cancer | downregulation | "In the present study we aimed to investigate the f ......" | 26328011 |
Reported cancer pathway affected by hsa-miR-630
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-630 | colorectal cancer | Apoptosis pathway | "Novel Epigenetic CREB miR 630 Signaling Axis Regul ......" | 26263387 | Western blot; Luciferase |
hsa-miR-630 | kidney renal cell cancer | Apoptosis pathway | "miR 630 functions as a tumor oncogene in renal cel ......" | 27279836 | Cell migration assay |
hsa-miR-630 | lung cancer | Apoptosis pathway; cell cycle pathway | "MiR 630 inhibits proliferation by targeting CDC7 k ......" | 25255219 | |
hsa-miR-630 | ovarian cancer | Apoptosis pathway | "Downregulation of microRNA 630 inhibits cell proli ......" | 26345808 | Transwell assay; Western blot |
hsa-miR-630 | pancreatic cancer | Apoptosis pathway | "Upregulation of miR 150* and miR 630 induces apopt ......" | 23675407 |
Reported cancer prognosis affected by hsa-miR-630
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-630 | bladder cancer | worse prognosis; poor survival | "The aims of this study were to explore the express ......" | 27752905 | |
hsa-miR-630 | breast cancer | progression; drug resistance; motility | "miR 630 targets IGF1R to regulate response to HER ......" | 24655723 | |
hsa-miR-630 | breast cancer | progression; motility; metastasis; cell migration | "MiR 630 suppresses breast cancer progression by ta ......" | 26595523 | Colony formation |
hsa-miR-630 | cervical and endocervical cancer | drug resistance | "The miRNA profiles of radioresistant cells and the ......" | 24283459 | |
hsa-miR-630 | colorectal cancer | poor survival; staging; metastasis; progression | "MicroRNA 630 is a prognostic marker for patients w ......" | 24981248 | |
hsa-miR-630 | colorectal cancer | drug resistance | "Novel Epigenetic CREB miR 630 Signaling Axis Regul ......" | 26263387 | Western blot; Luciferase |
hsa-miR-630 | gastric cancer | poor survival; staging; metastasis; progression | "Increased microRNA 630 expression in gastric cance ......" | 24621930 | |
hsa-miR-630 | kidney renal cell cancer | poor survival; tumorigenesis; metastasis; worse prognosis | "Up regulation of miR 630 in clear cell renal cell ......" | 25031755 | |
hsa-miR-630 | kidney renal cell cancer | worse prognosis | "We found that elevated expression of miR-21 miR-12 ......" | 26416448 | |
hsa-miR-630 | kidney renal cell cancer | progression | "miR 630 functions as a tumor oncogene in renal cel ......" | 27279836 | Cell migration assay |
hsa-miR-630 | liver cancer | staging; progression; worse prognosis | "miR 630 overexpression in hepatocellular carcinoma ......" | 25731670 | |
hsa-miR-630 | lung cancer | drug resistance | "MiR 630 inhibits proliferation by targeting CDC7 k ......" | 25255219 | |
hsa-miR-630 | lung cancer | metastasis | "miR 630 targets LMO3 to regulate cell growth and m ......" | 26328011 |
Reported gene related to hsa-miR-630
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-630 | liver cancer | AFP | "miR 630 overexpression in hepatocellular carcinoma ......" | 25731670 |
hsa-miR-630 | colorectal cancer | BCL2L2 | "BCL2L2 and TP53RK were identified as the target ge ......" | 26263387 |
hsa-miR-630 | prostate cancer | CCNG1 | "Gefitinib and luteolin cause growth arrest of huma ......" | 24971999 |
hsa-miR-630 | lung cancer | CDC7 | "MiR 630 inhibits proliferation by targeting CDC7 k ......" | 25255219 |
hsa-miR-630 | colorectal cancer | CREB1 | "Novel Epigenetic CREB miR 630 Signaling Axis Regul ......" | 26263387 |
hsa-miR-630 | breast cancer | ERBB2 | "miR 630 targets IGF1R to regulate response to HER ......" | 24655723 |
hsa-miR-630 | breast cancer | IGF1R | "miR 630 targets IGF1R to regulate response to HER ......" | 24655723 |
hsa-miR-630 | colorectal cancer | INSR | "Overexpression and loss-of-function analyses of mi ......" | 26263387 |
hsa-miR-630 | kidney renal cell cancer | LARP6 | "Expression of miR-630 was evaluated by quantitativ ......" | 27279836 |
hsa-miR-630 | lung cancer | LMO3 | "miR 630 targets LMO3 to regulate cell growth and m ......" | 26328011 |
hsa-miR-630 | breast cancer | MTDH | "MiR 630 suppresses breast cancer progression by ta ......" | 26595523 |
hsa-miR-630 | prostate cancer | PCNA | "Gefitinib and luteolin cause growth arrest of huma ......" | 24971999 |
hsa-miR-630 | ovarian cancer | PTEN | "Furthermore PTEN expression was increased in A2780 ......" | 26345808 |
hsa-miR-630 | colorectal cancer | TP53RK | "BCL2L2 and TP53RK were identified as the target ge ......" | 26263387 |