microRNA information: hsa-miR-631
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-631 | miRbase |
| Accession: | MIMAT0003300 | miRbase |
| Precursor name: | hsa-mir-631 | miRbase |
| Precursor accession: | MI0003645 | miRbase |
| Symbol: | MIR631 | HGNC |
| RefSeq ID: | NR_030360 | GenBank |
| Sequence: | AGACCUGGCCCAGACCUCAGC |
Reported expression in cancers: hsa-miR-631
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-631
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-631
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-631 | prostate cancer | cell migration | "Using transwell migration and invasion assays we f ......" | 26620225 |
Reported gene related to hsa-miR-631
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-631 | prostate cancer | ZAP70 | "Bioinformatic algorithms indicated the 3'-untransl ......" | 26620225 |