microRNA information: hsa-miR-634
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-634 | miRbase |
Accession: | MIMAT0003304 | miRbase |
Precursor name: | hsa-mir-634 | miRbase |
Precursor accession: | MI0003649 | miRbase |
Symbol: | MIR634 | HGNC |
RefSeq ID: | NR_030364 | GenBank |
Sequence: | AACCAGCACCCCAACUUUGGAC |
Reported expression in cancers: hsa-miR-634
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-634 | liver cancer | upregulation | "Here we showed that miR-634 expression was frequen ......" | 27693040 | |
hsa-miR-634 | ovarian cancer | downregulation | "Luciferase reporter constructs were used to establ ......" | 26576679 |
Reported cancer pathway affected by hsa-miR-634
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-634 | cervical and endocervical cancer | Apoptosis pathway; mTOR signaling pathway | "MiR 634 decreases cell proliferation and induces a ......" | 26367112 | |
hsa-miR-634 | glioblastoma | mTOR signaling pathway | "Here we utilized the LN229 glioblastoma cell line ......" | 24705102 | |
hsa-miR-634 | liver cancer | Apoptosis pathway | "miR 634 exhibits anti tumor activities toward hepa ......" | 27693040 | Colony formation |
hsa-miR-634 | ovarian cancer | cell cycle pathway; Apoptosis pathway | "miR 634 restores drug sensitivity in resistant ova ......" | 26576679 | Luciferase |
Reported cancer prognosis affected by hsa-miR-634
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-634 | cervical and endocervical cancer | tumorigenesis; malignant trasformation | "MiR 634 decreases cell proliferation and induces a ......" | 26367112 | |
hsa-miR-634 | liver cancer | staging; poor survival; differentiation; tumor size; metastasis | "miR 634 exhibits anti tumor activities toward hepa ......" | 27693040 | Colony formation |
hsa-miR-634 | ovarian cancer | drug resistance; progression | "miR 634 restores drug sensitivity in resistant ova ......" | 26576679 | Luciferase |
Reported gene related to hsa-miR-634
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-634 | cervical and endocervical cancer | MTOR | "MiR 634 decreases cell proliferation and induces a ......" | 26367112 |
hsa-miR-634 | glioblastoma | MTOR | "Investigation of the molecular mechanisms affected ......" | 24705102 |
hsa-miR-634 | liver cancer | DHX33 | "miR 634 exhibits anti tumor activities toward hepa ......" | 27693040 |
hsa-miR-634 | liver cancer | RAB1A | "miR 634 exhibits anti tumor activities toward hepa ......" | 27693040 |
hsa-miR-634 | glioblastoma | TSC2 | "Additionally in miR-634 overexpressing cells TSC2 ......" | 24705102 |