microRNA information: hsa-miR-636
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-636 | miRbase |
| Accession: | MIMAT0003306 | miRbase |
| Precursor name: | hsa-mir-636 | miRbase |
| Precursor accession: | MI0003651 | miRbase |
| Symbol: | MIR636 | HGNC |
| RefSeq ID: | NR_030366 | GenBank |
| Sequence: | UGUGCUUGCUCGUCCCGCCCGCA |
Reported expression in cancers: hsa-miR-636
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-636 | liver cancer | downregulation | "Notably miR-636 was markedly downregulated in HCC ......" | 23306701 |
Reported cancer pathway affected by hsa-miR-636
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-636
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-636 | colorectal cancer | poor survival | "A total of 1893 carcinoma samples were run on the ......" | 27198570 | |
| hsa-miR-636 | liver cancer | tumorigenesis | "ANT2 suppression by shRNA restores miR 636 express ......" | 23306701 | Colony formation |
Reported gene related to hsa-miR-636
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-636 | liver cancer | SLC25A5 | "We previously reported that suppression of adenine ......" | 27012708 |
| hsa-miR-636 | liver cancer | SLC25A5 | "ANT2 suppression by shRNA restores miR 636 express ......" | 23306701 |