microRNA information: hsa-miR-637
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-637 | miRbase |
| Accession: | MIMAT0003307 | miRbase |
| Precursor name: | hsa-mir-637 | miRbase |
| Precursor accession: | MI0003652 | miRbase |
| Symbol: | MIR637 | HGNC |
| RefSeq ID: | NR_030367 | GenBank |
| Sequence: | ACUGGGGGCUUUCGGGCUCUGCGU |
Reported expression in cancers: hsa-miR-637
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-637
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-637 | liver cancer | Apoptosis pathway | "Primate specific microRNA 637 inhibits tumorigenes ......" | 21809363 |
Reported cancer prognosis affected by hsa-miR-637
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-637 | liver cancer | tumorigenesis | "Primate specific microRNA 637 inhibits tumorigenes ......" | 21809363 |
Reported gene related to hsa-miR-637
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-637 | liver cancer | LIF | "Furthermore we found that LIF was highly expressed ......" | 21809363 |
| hsa-miR-637 | liver cancer | STAT3 | "Our study showed that Stat3 tyrosine 705 phosphory ......" | 21809363 |