microRNA information: hsa-miR-642a-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-642a-5p | miRbase |
Accession: | MIMAT0003312 | miRbase |
Precursor name: | hsa-mir-642a | miRbase |
Precursor accession: | MI0003657 | miRbase |
Symbol: | NA | HGNC |
RefSeq ID: | NA | GenBank |
Sequence: | GUCCCUCUCCAAAUGUGUCUUG |
Reported expression in cancers: hsa-miR-642a-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|
Reported cancer pathway affected by hsa-miR-642a-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-642a-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-642a-5p | bladder cancer | drug resistance | "By changing the cellular level of the response-ide ......" | 22954303 |
Reported gene related to hsa-miR-642a-5p
miRNA | cancer | gene | reporting | PUBMED |
---|
Expression profile in cancer corhorts: