microRNA information: hsa-miR-651-5p

SectionIDlink
Mature name: hsa-miR-651-5pmiRbase
Accession: MIMAT0003321miRbase
Precursor name: hsa-mir-651 miRbase
Precursor accession: MI0003666miRbase
Symbol: MIR651HGNC
RefSeq ID: NR_030380GenBank
Sequence: UUUAGGAUAAGCUUGACUUUUG



Reported expression in cancers: hsa-miR-651-5p

miRNAcancerregulationreportingPUBMEDmethod



Reported cancer pathway affected by hsa-miR-651-5p

miRNAcancerpathwayreportingPUBMEDfunctional study



Reported cancer prognosis affected by hsa-miR-651-5p

miRNAcancerprognosisreportingPUBMEDfunctional study



Reported gene related to hsa-miR-651-5p

miRNAcancergenereportingPUBMED
hsa-miR-651-5p

lung squamous cell cancerFAS"Luciferase assays showed that the FAS SNP created ......"23378343



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-651-5p
AFF4
11 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.085; TCGA CESC -0.092; TCGA COAD -0.07; TCGA HNSC -0.128; TCGA KIRP -0.103; TCGA LUAD -0.087; TCGA LUSC -0.056; TCGA PRAD -0.112; TCGA SARC -0.076; TCGA STAD -0.061; TCGA UCEC -0.071
hsa-miR-651-5p
MYO1E
9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.155; TCGA CESC -0.143; TCGA HNSC -0.083; TCGA KIRC -0.07; TCGA KIRP -0.1; TCGA LUAD -0.072; TCGA SARC -0.105; TCGA THCA -0.183; TCGA UCEC -0.119
hsa-miR-651-5p
OMD
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -1.057; TCGA CESC -0.471; TCGA COAD -0.532; TCGA ESCA -0.37; TCGA HNSC -0.613; TCGA KIRC -0.597; TCGA KIRP -0.869; TCGA LUAD -0.317; TCGA LUSC -0.533; TCGA PAAD -0.424; TCGA PRAD -0.215; TCGA THCA -0.356; TCGA STAD -0.573; TCGA UCEC -0.663
hsa-miR-651-5p
WWTR1
10 cancers: BLCA; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.32; TCGA COAD -0.409; TCGA HNSC -0.178; TCGA KIRC -0.147; TCGA KIRP -0.273; TCGA PAAD -0.242; TCGA PRAD -0.269; TCGA SARC -0.119; TCGA STAD -0.383; TCGA UCEC -0.139
hsa-miR-651-5p
SAMD4A
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.441; TCGA CESC -0.164; TCGA COAD -0.254; TCGA ESCA -0.211; TCGA HNSC -0.134; TCGA LUSC -0.258; TCGA PRAD -0.222; TCGA SARC -0.09; TCGA THCA -0.418; TCGA STAD -0.345; TCGA UCEC -0.295
hsa-miR-651-5p
CPEB4
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.22; TCGA CESC -0.253; TCGA COAD -0.118; TCGA ESCA -0.124; TCGA HNSC -0.224; TCGA KIRC -0.117; TCGA KIRP -0.184; TCGA LUAD -0.123; TCGA LUSC -0.189; TCGA PRAD -0.18; TCGA SARC -0.211; TCGA STAD -0.082; TCGA UCEC -0.164
hsa-miR-651-5p
BHLHE40
10 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PRAD; THCA; UCEC
MirTarget
TCGA BLCA -0.21; TCGA CESC -0.126; TCGA COAD -0.106; TCGA HNSC -0.088; TCGA KIRP -0.204; TCGA LUAD -0.075; TCGA LUSC -0.112; TCGA PRAD -0.279; TCGA THCA -0.331; TCGA UCEC -0.093
hsa-miR-651-5p
BMPR2
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.143; TCGA CESC -0.071; TCGA COAD -0.151; TCGA ESCA -0.096; TCGA HNSC -0.165; TCGA KIRC -0.184; TCGA KIRP -0.188; TCGA LUAD -0.166; TCGA LUSC -0.118; TCGA PAAD -0.118; TCGA PRAD -0.132; TCGA THCA -0.12; TCGA STAD -0.104; TCGA UCEC -0.137
hsa-miR-651-5p
EFHD1
10 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.318; TCGA COAD -0.299; TCGA HNSC -0.18; TCGA KIRC -0.367; TCGA KIRP -0.604; TCGA LUSC -0.155; TCGA PRAD -0.309; TCGA THCA -0.164; TCGA STAD -0.358; TCGA UCEC -0.273
hsa-miR-651-5p
APLNR
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.333; TCGA CESC -0.225; TCGA COAD -0.249; TCGA ESCA -0.21; TCGA HNSC -0.263; TCGA KIRC -0.251; TCGA KIRP -0.755; TCGA LUAD -0.159; TCGA LUSC -0.41; TCGA THCA -0.226; TCGA STAD -0.129; TCGA UCEC -0.215
hsa-miR-651-5p
PMP22
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.387; TCGA CESC -0.204; TCGA COAD -0.347; TCGA ESCA -0.288; TCGA HNSC -0.301; TCGA KIRP -0.141; TCGA LIHC -0.164; TCGA LUAD -0.199; TCGA LUSC -0.337; TCGA PRAD -0.254; TCGA THCA -0.145; TCGA STAD -0.314; TCGA UCEC -0.332
hsa-miR-651-5p
BIRC3
10 cancers: BLCA; COAD; ESCA; KIRP; LIHC; LUSC; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.407; TCGA COAD -0.163; TCGA ESCA -0.25; TCGA KIRP -0.236; TCGA LIHC -0.277; TCGA LUSC -0.162; TCGA PRAD -0.185; TCGA SARC -0.236; TCGA THCA -0.387; TCGA UCEC -0.167
hsa-miR-651-5p
FMN1
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; SARC
MirTarget
TCGA BLCA -0.238; TCGA CESC -0.327; TCGA ESCA -0.309; TCGA HNSC -0.315; TCGA KIRC -0.228; TCGA KIRP -0.552; TCGA LUSC -0.187; TCGA PRAD -0.428; TCGA SARC -0.249
hsa-miR-651-5p
NEK7
12 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.171; TCGA CESC -0.142; TCGA COAD -0.142; TCGA HNSC -0.09; TCGA KIRC -0.09; TCGA KIRP -0.151; TCGA LUAD -0.126; TCGA LUSC -0.152; TCGA PRAD -0.138; TCGA SARC -0.103; TCGA STAD -0.086; TCGA UCEC -0.09
hsa-miR-651-5p
HGF
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.876; TCGA CESC -0.268; TCGA COAD -0.453; TCGA ESCA -0.29; TCGA HNSC -0.322; TCGA KIRC -0.333; TCGA KIRP -0.559; TCGA LUAD -0.278; TCGA LUSC -0.325; TCGA PAAD -0.29; TCGA PRAD -0.356; TCGA THCA -0.166; TCGA STAD -0.193; TCGA UCEC -0.299
hsa-miR-651-5p
MPHOSPH8
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; UCEC
MirTarget
TCGA BLCA -0.091; TCGA CESC -0.122; TCGA HNSC -0.073; TCGA KIRC -0.084; TCGA KIRP -0.146; TCGA LUAD -0.116; TCGA LUSC -0.07; TCGA PRAD -0.129; TCGA SARC -0.064; TCGA UCEC -0.095
hsa-miR-651-5p
ABCG2
10 cancers: CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA CESC -0.226; TCGA COAD -0.255; TCGA ESCA -0.24; TCGA KIRC -0.196; TCGA KIRP -0.176; TCGA LUAD -0.203; TCGA LUSC -0.19; TCGA PRAD -0.294; TCGA STAD -0.257; TCGA UCEC -0.422





Enriched cancer pathways of putative targets