microRNA information: hsa-miR-654-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-654-5p | miRbase |
Accession: | MIMAT0003330 | miRbase |
Precursor name: | hsa-mir-654 | miRbase |
Precursor accession: | MI0003676 | miRbase |
Symbol: | MIR654 | HGNC |
RefSeq ID: | NR_030390 | GenBank |
Sequence: | UGGUGGGCCGCAGAACAUGUGC |
Reported expression in cancers: hsa-miR-654-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-654-5p | breast cancer | downregulation | "However clinical relevance and biological role of ......" | 27186421 |
Reported cancer pathway affected by hsa-miR-654-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-654-5p | breast cancer | Apoptosis pathway | "MiR 654 5p attenuates breast cancer progression by ......" | 27186421 | |
hsa-miR-654-5p | prostate cancer | Apoptosis pathway | "MicroRNAs miR 154 miR 299 5p miR 376a miR 376c miR ......" | 24166498 |
Reported cancer prognosis affected by hsa-miR-654-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-654-5p | breast cancer | progression; staging; metastasis; poor survival | "MiR 654 5p attenuates breast cancer progression by ......" | 27186421 |
Reported gene related to hsa-miR-654-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-654-5p | breast cancer | EPSTI1 | "MiR 654 5p attenuates breast cancer progression by ......" | 27186421 |
Expression profile in cancer corhorts: