microRNA information: hsa-miR-655-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-655-3p | miRbase |
| Accession: | MIMAT0003331 | miRbase |
| Precursor name: | hsa-mir-655 | miRbase |
| Precursor accession: | MI0003677 | miRbase |
| Symbol: | MIR655 | HGNC |
| RefSeq ID: | NR_030391 | GenBank |
| Sequence: | AUAAUACAUGGUUAACCUCUUU |
Reported expression in cancers: hsa-miR-655-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-655-3p | breast cancer | downregulation | "In this study we found that miR-655 was down-regul ......" | 26820102 | |
| hsa-miR-655-3p | liver cancer | downregulation | "Aberrant miR-655-3p expression has been associated ......" | 27259866 | qPCR |
Reported cancer pathway affected by hsa-miR-655-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-655-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-655-3p | breast cancer | metastasis; progression; cell migration | "miR 655 suppresses epithelial to mesenchymal trans ......" | 26820102 | Luciferase |
| hsa-miR-655-3p | esophageal cancer | metastasis | "Mir 655 up regulation suppresses cell invasion by ......" | 24314023 | Transwell assay; Western blot; Luciferase |
| hsa-miR-655-3p | liver cancer | cell migration; staging; metastasis; tumor size; progression | "MicroRNA 655 3p functions as a tumor suppressor by ......" | 27259866 | Colony formation; Transwell assay; Western blot; Luciferase |
Reported gene related to hsa-miR-655-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-655-3p | liver cancer | ADAM10 | "MicroRNA 655 3p functions as a tumor suppressor by ......" | 27259866 |
| hsa-miR-655-3p | breast cancer | PRRX1 | "miR 655 suppresses epithelial to mesenchymal trans ......" | 26820102 |
| hsa-miR-655-3p | esophageal cancer | PTTG1 | "Luciferase reporter and western blot assays were u ......" | 24314023 |
| hsa-miR-655-3p | breast cancer | VIM | "Ectopic expression of miR-655 not only induced the ......" | 26820102 |
Expression profile in cancer corhorts:
