microRNA information: hsa-miR-661
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-661 | miRbase |
Accession: | MIMAT0003324 | miRbase |
Precursor name: | hsa-mir-661 | miRbase |
Precursor accession: | MI0003669 | miRbase |
Symbol: | MIR661 | HGNC |
RefSeq ID: | NR_030383 | GenBank |
Sequence: | UGCCUGGGUCUCUGGCCUGCGCGU |
Reported expression in cancers: hsa-miR-661
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-661 | ovarian cancer | upregulation | "We hypothesized that miR-661 played an important r ......" | 26282217 |
Reported cancer pathway affected by hsa-miR-661
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-661
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|
Reported gene related to hsa-miR-661
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-661 | ovarian cancer | INPP5J | "MiR 661 contributed to cell proliferation of human ......" | 26282217 |
hsa-miR-661 | breast cancer | PVRL1 | "MiR-661 was found required for efficient invasion ......" | 20543867 |
hsa-miR-661 | breast cancer | STARD10 | "MiR-661 was found required for efficient invasion ......" | 20543867 |