microRNA information: hsa-miR-671-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-671-3p | miRbase |
| Accession: | MIMAT0004819 | miRbase |
| Precursor name: | hsa-mir-671 | miRbase |
| Precursor accession: | MI0003760 | miRbase |
| Symbol: | MIR671 | HGNC |
| RefSeq ID: | NR_030407 | GenBank |
| Sequence: | UCCGGUUCUCAGGGCUCCACC |
Reported expression in cancers: hsa-miR-671-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-671-3p | NA | NA | "NA ......" | NA | NA |
| hsa-miR-671-3p | " ......" |
Reported cancer pathway affected by hsa-miR-671-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-671-3p | NA | NA | "NA ......" | NA | NA |
| hsa-miR-671-3p | " ......" |
Reported cancer prognosis affected by hsa-miR-671-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-671-3p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 |
Reported gene related to hsa-miR-671-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-671-3p | breast cancer | FOXM1 | "miR 671 5p inhibits epithelial to mesenchymal tran ......" | 26588055 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-671-3p | MAP3K12 | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; LUAD; PRAD; SARC; THCA; STAD; UCEC | PITA | TCGA BLCA -0.161; TCGA BRCA -0.213; TCGA COAD -0.21; TCGA ESCA -0.202; TCGA KIRC -0.124; TCGA LIHC -0.114; TCGA LUAD -0.068; TCGA PRAD -0.155; TCGA SARC -0.197; TCGA THCA -0.199; TCGA STAD -0.141; TCGA UCEC -0.122 |
hsa-miR-671-3p | CACNA1C | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.49; TCGA BRCA -0.077; TCGA CESC -0.224; TCGA COAD -0.328; TCGA ESCA -0.517; TCGA KIRC -0.272; TCGA KIRP -0.421; TCGA LUSC -0.147; TCGA PRAD -0.212; TCGA SARC -0.655; TCGA STAD -0.62; TCGA UCEC -0.597 |
hsa-miR-671-3p | CAPN3 | 11 cancers: BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD | PITA | TCGA BRCA -0.286; TCGA CESC -0.202; TCGA ESCA -0.212; TCGA HNSC -0.481; TCGA LIHC -0.14; TCGA LUAD -0.253; TCGA LUSC -0.42; TCGA OV -0.267; TCGA SARC -0.342; TCGA THCA -0.248; TCGA STAD -0.231 |
Enriched cancer pathways of putative targets