microRNA information: hsa-miR-7-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-7-5p | miRbase |
| Accession: | MIMAT0000252 | miRbase |
| Precursor name: | hsa-mir-7-1 | miRbase |
| Precursor accession: | MI0000263 | miRbase |
| Symbol: | MIR7-1 | HGNC |
| RefSeq ID: | NR_029605 | GenBank |
| Sequence: | UGGAAGACUAGUGAUUUUGUUGU |
Reported expression in cancers: hsa-miR-7-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-7-5p | breast cancer | upregulation | "An induction of microRNA miR 7 through estrogen tr ......" | 23227519 | |
| hsa-miR-7-5p | breast cancer | upregulation | "To compare the carcinogenic process in tumors with ......" | 24810926 | qPCR |
| hsa-miR-7-5p | cervical and endocervical cancer | downregulation | "miR-7 has been demonstrated to function as both an ......" | 25785020 | |
| hsa-miR-7-5p | cervical and endocervical cancer | downregulation | "In the current study the expressions of miR-203 an ......" | 26490989 | qPCR |
| hsa-miR-7-5p | colon cancer | upregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
| hsa-miR-7-5p | colorectal cancer | deregulation | "The expression levels of miR-7 and -21 were signif ......" | 25584614 | |
| hsa-miR-7-5p | esophageal cancer | deregulation | "Among these miRNAs that displayed unique miRNA exp ......" | 23516093 | |
| hsa-miR-7-5p | gastric cancer | downregulation | "Among these miRNAs the expression of miR-7 a possi ......" | 22139078 | |
| hsa-miR-7-5p | gastric cancer | downregulation | "In this study we found that miR-7 is significantly ......" | 22614005 | |
| hsa-miR-7-5p | gastric cancer | downregulation | "The present study profiled differentially expresse ......" | 24573489 | Reverse transcription PCR; qPCR |
| hsa-miR-7-5p | glioblastoma | downregulation | "We show that microRNA-7 miR-7 is a potential tumor ......" | 18483236 | |
| hsa-miR-7-5p | glioblastoma | downregulation | "We used high-throughput sequencing to comprehensiv ......" | 21912681 | RNA-Seq |
| hsa-miR-7-5p | glioblastoma | downregulation | "miRNA microarray reveals specific expression in th ......" | 24858071 | Microarray |
| hsa-miR-7-5p | head and neck cancer | deregulation | "2012;488:686-91 including 7 consistently up-regula ......" | 24422025 | |
| hsa-miR-7-5p | kidney renal cell cancer | upregulation | "Identification of miR 7 as an oncogene in renal ce ......" | 23793934 | qPCR; RNA-Seq |
| hsa-miR-7-5p | liver cancer | upregulation | "Recently microRNA-7 miR-7 has been proven to play ......" | 22234835 | |
| hsa-miR-7-5p | liver cancer | downregulation | "In this study we demonstrate that miR-7 was downre ......" | 24339204 | |
| hsa-miR-7-5p | lung cancer | downregulation | "Quantitative polymerase chain reaction qPCR was us ......" | 25339453 | qPCR; Microarray |
| hsa-miR-7-5p | lung cancer | downregulation | "Recent evidence demonstrated that miRNA-7 miR-7 a ......" | 26807243 | RNA-Seq |
| hsa-miR-7-5p | lung squamous cell cancer | downregulation | "MicroRNA-7 miR-7 has been reported to be a tumour ......" | 24281003 | Microarray |
| hsa-miR-7-5p | ovarian cancer | upregulation | "Overexpression of miR-7 markedly suppressed the ca ......" | 24816687 | |
| hsa-miR-7-5p | thyroid cancer | downregulation | "MicroRNA deep sequencing reveals master regulators ......" | 25720323 | RNA-Seq |
Reported cancer pathway affected by hsa-miR-7-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-7-5p | breast cancer | cell cycle pathway; VEGF signaling pathway | "Supervised analysis in the initial subset and subs ......" | 18755890 | |
| hsa-miR-7-5p | breast cancer | cell cycle pathway | "miR 7 and miR 218 epigenetically control tumor sup ......" | 22705304 | |
| hsa-miR-7-5p | breast cancer | Apoptosis pathway | "miR 7 5p suppresses cell proliferation and induces ......" | 25511742 | |
| hsa-miR-7-5p | breast cancer | cell cycle pathway | "Using a gene array strategy comparing microRNA exp ......" | 25532106 | Colony formation |
| hsa-miR-7-5p | cervical and endocervical cancer | Apoptosis pathway | "Our study demonstrated the functions of microRNA-7 ......" | 23742934 | |
| hsa-miR-7-5p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "Using microRNA miRNA expression array we identifie ......" | 23208495 | Western blot; Luciferase |
| hsa-miR-7-5p | colorectal cancer | cell cycle pathway | "We aimed to explore the roles and molecular mechan ......" | 24185687 | Western blot; Luciferase; Colony formation |
| hsa-miR-7-5p | colorectal cancer | Apoptosis pathway | "miR 7 inhibits colorectal cancer cell proliferatio ......" | 24570594 | Luciferase; Flow cytometry; Colony formation; MTT assay; Western blot |
| hsa-miR-7-5p | gastric cancer | Epithelial mesenchymal transition pathway | "In this study we found that miR-7 is significantly ......" | 22614005 | |
| hsa-miR-7-5p | glioblastoma | cell cycle pathway | "miR 7 inhibits glioblastoma growth by simultaneous ......" | 24603851 | |
| hsa-miR-7-5p | glioblastoma | Apoptosis pathway | "Anti tumor activities of luteolin and silibinin in ......" | 26573275 | |
| hsa-miR-7-5p | head and neck cancer | PI3K/Akt signaling pathway | "Regulation of epidermal growth factor receptor sig ......" | 23115635 | |
| hsa-miR-7-5p | kidney renal cell cancer | Apoptosis pathway | "Identification of miR 7 as an oncogene in renal ce ......" | 23793934 | Flow cytometry |
| hsa-miR-7-5p | liver cancer | mTOR signaling pathway | "Recently microRNA-7 miR-7 has been proven to play ......" | 22234835 | |
| hsa-miR-7-5p | liver cancer | cell cycle pathway | "Downregulation of miR 7 upregulates Cullin 5 CUL5 ......" | 24339204 | Colony formation |
| hsa-miR-7-5p | liver cancer | cell cycle pathway | "MiR-7 is considered as a tumor suppressor miRNA in ......" | 24370822 | Western blot |
| hsa-miR-7-5p | lung cancer | Apoptosis pathway | "Restoration of miR 7 expression suppresses the gro ......" | 25334070 | Western blot |
| hsa-miR-7-5p | lung squamous cell cancer | Apoptosis pathway | "In the present study we observed a reduction of mi ......" | 21750649 | Luciferase |
| hsa-miR-7-5p | lung squamous cell cancer | cell cycle pathway | "MicroRNA-7 miR-7 has been reported to be a tumour ......" | 24281003 | Western blot; Luciferase; Colony formation |
| hsa-miR-7-5p | lung squamous cell cancer | Apoptosis pathway | "Previously it was reported that microRNA-7 miR-7 a ......" | 25289099 | Western blot |
| hsa-miR-7-5p | lung squamous cell cancer | MAPK signaling pathway | "MicroRNA miR-7 has been reported to act as a suppr ......" | 26135959 | |
| hsa-miR-7-5p | lung squamous cell cancer | Apoptosis pathway | "CCK8 Annexin and V-FITC assays were carried out to ......" | 26464649 | RNAi; Western blot |
| hsa-miR-7-5p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "The ability of miR-7 to enhance gefitinib-induced ......" | 26557760 | |
| hsa-miR-7-5p | lung squamous cell cancer | MAPK signaling pathway | "To investigate the effects of microRNA-7 miR-7 on ......" | 27764812 | Western blot; MTT assay; Transwell assay |
| hsa-miR-7-5p | melanoma | PI3K/Akt signaling pathway | "We have investigated the functional role of miR-7- ......" | 23206698 | RNAi |
| hsa-miR-7-5p | melanoma | cell cycle pathway | "microRNA-7-5p miR-7-5p is a tumor suppressor in mu ......" | 27203220 | Colony formation |
| hsa-miR-7-5p | ovarian cancer | Epithelial mesenchymal transition pathway | "In an initial effort to systematically address thi ......" | 22853714 | |
| hsa-miR-7-5p | ovarian cancer | Apoptosis pathway | "Diagnostic and prognostic potential of serum miR 7 ......" | 26393886 | |
| hsa-miR-7-5p | pancreatic cancer | Apoptosis pathway | "Curcumin inhibits cell growth and invasion through ......" | 25256401 | |
| hsa-miR-7-5p | prostate cancer | cell cycle pathway; Apoptosis pathway | "In this study we demonstrated that microRNA-7 miR- ......" | 26172296 |
Reported cancer prognosis affected by hsa-miR-7-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-7-5p | breast cancer | progression | "Supervised analysis in the initial subset and subs ......" | 18755890 | |
| hsa-miR-7-5p | breast cancer | drug resistance | "Furthermore we demonstrated that miR-345 and miR-7 ......" | 20099276 | |
| hsa-miR-7-5p | breast cancer | drug resistance | "MiRNA microarray analysis identified 299 and 226 m ......" | 21399894 | |
| hsa-miR-7-5p | breast cancer | metastasis; malignant trasformation; progression; differentiation | "Herein we identify miR-7 as a direct regulator of ......" | 22876288 | |
| hsa-miR-7-5p | breast cancer | drug resistance | "An induction of microRNA miR 7 through estrogen tr ......" | 23227519 | |
| hsa-miR-7-5p | breast cancer | metastasis; poor survival | "miR 7 suppresses brain metastasis of breast cancer ......" | 23384942 | |
| hsa-miR-7-5p | breast cancer | metastasis | "MiR 7 inhibited indirectly by lincRNA HOTAIR direc ......" | 25070049 | |
| hsa-miR-7-5p | breast cancer | cell migration | "Using a gene array strategy comparing microRNA exp ......" | 25532106 | Colony formation |
| hsa-miR-7-5p | breast cancer | poor survival | "In this multicenter study a 10-miRNA classifier in ......" | 27566954 | |
| hsa-miR-7-5p | cervical and endocervical cancer | malignant trasformation | "Our study demonstrated the functions of microRNA-7 ......" | 23742934 | |
| hsa-miR-7-5p | cervical and endocervical cancer | metastasis | "miR-7 has been demonstrated to function as both an ......" | 25785020 | |
| hsa-miR-7-5p | cervical and endocervical cancer | staging; metastasis; poor survival; progression | "In the current study the expressions of miR-203 an ......" | 26490989 | |
| hsa-miR-7-5p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
| hsa-miR-7-5p | colon cancer | staging; metastasis | "miRNA-7 miR-7 inhibits the translation of FAK prot ......" | 26648422 | Western blot |
| hsa-miR-7-5p | colorectal cancer | progression | "We aimed to explore the roles and molecular mechan ......" | 24185687 | Western blot; Luciferase; Colony formation |
| hsa-miR-7-5p | colorectal cancer | poor survival | "MicroRNA-7 miR-7 has been reported to be a tumor s ......" | 25503932 | |
| hsa-miR-7-5p | colorectal cancer | poor survival | "In this study ten candidates were identified using ......" | 27126129 | |
| hsa-miR-7-5p | esophageal cancer | metastasis; differentiation | "Among these miRNAs that displayed unique miRNA exp ......" | 23516093 | |
| hsa-miR-7-5p | esophageal cancer | drug resistance; metastasis | "Real‑time polymerase chain reaction was carried ......" | 26708917 | |
| hsa-miR-7-5p | gastric cancer | drug resistance; differentiation; tumorigenesis | "Inflammation induced repression of tumor suppresso ......" | 22139078 | Colony formation |
| hsa-miR-7-5p | gastric cancer | cell migration; metastasis | "In this study we found that miR-7 is significantly ......" | 22614005 | |
| hsa-miR-7-5p | gastric cancer | metastasis; progression | "miR 7 inhibits the invasion and metastasis of gast ......" | 24573489 | Western blot; Luciferase |
| hsa-miR-7-5p | gastric cancer | progression | "Gastric cancer is the most common cancer in the wo ......" | 27044823 | |
| hsa-miR-7-5p | glioblastoma | differentiation | "Interestingly we observed that several identified ......" | 24465609 | |
| hsa-miR-7-5p | glioblastoma | malignant trasformation | "miR 7 inhibits glioblastoma growth by simultaneous ......" | 24603851 | |
| hsa-miR-7-5p | kidney renal cell cancer | cell migration | "Identification of miR 7 as an oncogene in renal ce ......" | 23793934 | Flow cytometry |
| hsa-miR-7-5p | kidney renal cell cancer | progression; poor survival | "Combined Influence of EGF+61G>A and TGFB+869T>C Fu ......" | 25909813 | |
| hsa-miR-7-5p | liver cancer | metastasis; tumorigenesis | "Recently microRNA-7 miR-7 has been proven to play ......" | 22234835 | |
| hsa-miR-7-5p | liver cancer | tumorigenesis | "MiR-7 is considered as a tumor suppressor miRNA in ......" | 24370822 | Western blot |
| hsa-miR-7-5p | lung cancer | tumorigenesis | "EGFR promotes lung tumorigenesis by activating miR ......" | 20978205 | |
| hsa-miR-7-5p | lung cancer | drug resistance | "To overcome the resistance we focused on EGFR supp ......" | 21712475 | Luciferase; Western blot |
| hsa-miR-7-5p | lung cancer | drug resistance | "The expression profiles of the parent and resistan ......" | 25339453 | Western blot |
| hsa-miR-7-5p | lung cancer | tumorigenesis; worse prognosis | "Recent evidence demonstrated that miRNA-7 miR-7 a ......" | 26807243 | |
| hsa-miR-7-5p | lung squamous cell cancer | staging; recurrence | "In an exploratory study we determined whether expr ......" | 20975375 | |
| hsa-miR-7-5p | lung squamous cell cancer | cell migration | "In the present study we observed a reduction of mi ......" | 21750649 | Luciferase |
| hsa-miR-7-5p | lung squamous cell cancer | progression; staging | "MicroRNA-7 miR-7 has been reported to be a tumour ......" | 24281003 | Western blot; Luciferase; Colony formation |
| hsa-miR-7-5p | lung squamous cell cancer | drug resistance | "Upregulation of the inwardly rectifying potassium ......" | 25880778 | |
| hsa-miR-7-5p | lung squamous cell cancer | drug resistance; staging; poor survival | "miR 7 modulates chemoresistance of small cell lung ......" | 26108539 | Luciferase |
| hsa-miR-7-5p | melanoma | cell migration | "We have investigated the functional role of miR-7- ......" | 23206698 | RNAi |
| hsa-miR-7-5p | melanoma | metastasis | "microRNA-7-5p miR-7-5p is a tumor suppressor in mu ......" | 27203220 | Colony formation |
| hsa-miR-7-5p | ovarian cancer | metastasis | "In an initial effort to systematically address thi ......" | 22853714 | |
| hsa-miR-7-5p | ovarian cancer | metastasis | "In recent years mounting evidence indicates that E ......" | 24816687 | |
| hsa-miR-7-5p | ovarian cancer | staging; metastasis; cell migration | "Diagnostic and prognostic potential of serum miR 7 ......" | 26393886 | |
| hsa-miR-7-5p | prostate cancer | poor survival | "We firstly observed a miRNA expression profile dif ......" | 24760272 | |
| hsa-miR-7-5p | prostate cancer | tumorigenesis; progression | "In this study we demonstrated that microRNA-7 miR- ......" | 26172296 | |
| hsa-miR-7-5p | thyroid cancer | malignant trasformation | "By means of uniform statistical analysis 6 further ......" | 24446156 | |
| hsa-miR-7-5p | thyroid cancer | metastasis | "We performed small RNA deep-sequencing of 3 PTC th ......" | 26487287 | |
| hsa-miR-7-5p | thyroid cancer | cell migration | "The expression and function of microRNA-7 miR-7 ha ......" | 27430434 | Western blot; MTT assay; Luciferase |
Reported gene related to hsa-miR-7-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-7-5p | breast cancer | EGFR | "MiR-7 inhibited MCF-7/HER2Δ16 cell migration thro ......" | 25532106 |
| hsa-miR-7-5p | breast cancer | EGFR | "We identified miR-7 as the important miRNA associa ......" | 23227519 |
| hsa-miR-7-5p | colorectal cancer | EGFR | "The potential for miR-7 to act as a tumor suppress ......" | 25503932 |
| hsa-miR-7-5p | esophageal cancer | EGFR | "In addition the experimental data also suggest tha ......" | 26708917 |
| hsa-miR-7-5p | gastric cancer | EGFR | "Further study will investigate miR-7 in the regula ......" | 24573489 |
| hsa-miR-7-5p | glioblastoma | EGFR | "We show that microRNA-7 miR-7 is a common regulato ......" | 24603851 |
| hsa-miR-7-5p | head and neck cancer | EGFR | "Several studies have demonstrated that microRNA-7 ......" | 23115635 |
| hsa-miR-7-5p | lung cancer | EGFR | "To overcome the resistance we focused on EGFR supp ......" | 21712475 |
| hsa-miR-7-5p | lung cancer | EGFR | "Furthermore inhibition of EGFR showed similar effe ......" | 25334070 |
| hsa-miR-7-5p | lung cancer | EGFR | "In this study we report the discovery and mechanis ......" | 20978205 |
| hsa-miR-7-5p | lung squamous cell cancer | EGFR | "Pretreatment of miR-7 mimics enhanced the PTX-medi ......" | 25289099 |
| hsa-miR-7-5p | melanoma | EGFR | "microRNA-7-5p miR-7-5p is a tumor suppressor in mu ......" | 27203220 |
| hsa-miR-7-5p | ovarian cancer | EGFR | "miR-7 overexpression correlated with diminished BC ......" | 25862909 |
| hsa-miR-7-5p | ovarian cancer | EGFR | "In recent years mounting evidence indicates that E ......" | 24816687 |
| hsa-miR-7-5p | breast cancer | EGF | "miR-7 was reported to suppress epidermal growth fa ......" | 23227519 |
| hsa-miR-7-5p | colorectal cancer | EGF | "The potential for miR-7 to act as a tumor suppress ......" | 25503932 |
| hsa-miR-7-5p | gastric cancer | EGF | "miR 7 inhibits the invasion and metastasis of gast ......" | 24573489 |
| hsa-miR-7-5p | glioblastoma | EGF | "miR-7 potently suppressed epidermal growth factor ......" | 18483236 |
| hsa-miR-7-5p | head and neck cancer | EGF | "Regulation of epidermal growth factor receptor sig ......" | 23115635 |
| hsa-miR-7-5p | lung cancer | EGF | "Restoration of miR 7 expression suppresses the gro ......" | 25334070 |
| hsa-miR-7-5p | lung squamous cell cancer | EGF | "Pretreatment of miR-7 mimics enhanced the PTX-medi ......" | 25289099 |
| hsa-miR-7-5p | melanoma | EGF | "microRNA-7-5p miR-7-5p is a tumor suppressor in mu ......" | 27203220 |
| hsa-miR-7-5p | breast cancer | PTK2 | "Herein we identify miR-7 as a direct regulator of ......" | 22876288 |
| hsa-miR-7-5p | cervical and endocervical cancer | PTK2 | "Upregulated miR-7 significantly suppressed focal a ......" | 25785020 |
| hsa-miR-7-5p | colon cancer | PTK2 | "miRNA-7 miR-7 inhibits the translation of FAK prot ......" | 26648422 |
| hsa-miR-7-5p | glioblastoma | PTK2 | "Luciferase reporter assay was used to determine fo ......" | 22040413 |
| hsa-miR-7-5p | lung squamous cell cancer | PTK2 | "To investigate the effects of microRNA-7 miR-7 on ......" | 27764812 |
| hsa-miR-7-5p | colorectal cancer | RAF1 | "In vitro assays showed that EGFR and RAF-1 are dir ......" | 25503932 |
| hsa-miR-7-5p | glioblastoma | RAF1 | "MiR 7 5p is frequently downregulated in glioblasto ......" | 25027403 |
| hsa-miR-7-5p | glioblastoma | RAF1 | "We show that microRNA-7 miR-7 is a common regulato ......" | 24603851 |
| hsa-miR-7-5p | lung cancer | RAF1 | "Taken together these findings revealed that miR-7 ......" | 25334070 |
| hsa-miR-7-5p | lung squamous cell cancer | BCL2 | "Western blotting was used to evaluate the effect o ......" | 26464649 |
| hsa-miR-7-5p | lung squamous cell cancer | BCL2 | "Bioinformatics predictions revealed a potential bi ......" | 21750649 |
| hsa-miR-7-5p | ovarian cancer | BCL2 | "miR-7 overexpression correlated with diminished BC ......" | 25862909 |
| hsa-miR-7-5p | breast cancer | KLF4 | "miR 7 suppresses brain metastasis of breast cancer ......" | 23384942 |
| hsa-miR-7-5p | prostate cancer | KLF4 | "In this study we demonstrated that microRNA-7 miR- ......" | 26172296 |
| hsa-miR-7-5p | colorectal cancer | PAX6 | "We aimed to explore the roles and molecular mechan ......" | 24185687 |
| hsa-miR-7-5p | lung squamous cell cancer | PAX6 | "However the exact role of miR-7 and the associatio ......" | 26135959 |
| hsa-miR-7-5p | lung cancer | TLR9 | "In this paper we first report that TLR9 signaling ......" | 23135998 |
| hsa-miR-7-5p | lung cancer | TLR9 | "TLR9 signaling repressed tumor suppressor miR 7 ex ......" | 24004462 |
| hsa-miR-7-5p | breast cancer | VIM | "The levels of miR-7 expression was positively corr ......" | 22876288 |
| hsa-miR-7-5p | ovarian cancer | VIM | "The pharmacological inhibition of PI3K-AKT and ERK ......" | 24816687 |
| hsa-miR-7-5p | breast cancer | ABCC3 | "Furthermore we demonstrated that miR-345 and miR-7 ......" | 20099276 |
| hsa-miR-7-5p | lung squamous cell cancer | AR | "Downregulation of MRP1/ABCC1 level was revealed af ......" | 26108539 |
| hsa-miR-7-5p | liver cancer | CCNE1 | "By combinational use of bioinformatic prediction r ......" | 24370822 |
| hsa-miR-7-5p | breast cancer | CDH1 | "The levels of miR-7 expression was positively corr ......" | 22876288 |
| hsa-miR-7-5p | lung cancer | CGGBP1 | "Over-expression of miR-7 could significantly inhib ......" | 24491049 |
| hsa-miR-7-5p | breast cancer | CLDN6 | "Stable overexpression of miR-7 and miR-218 was acc ......" | 22705304 |
| hsa-miR-7-5p | liver cancer | CUL5 | "A tumor suppressor gene CUL5 was identified as a d ......" | 24339204 |
| hsa-miR-7-5p | liver cancer | DLL1 | "We first screened and identified a novel miR-7 tar ......" | 22234835 |
| hsa-miR-7-5p | lung cancer | ELAVL1 | "TLR9 signaling repressed tumor suppressor miR 7 ex ......" | 24004462 |
| hsa-miR-7-5p | lung cancer | ERF | "Quantitative proteomic analysis revealed that miR- ......" | 20978205 |
| hsa-miR-7-5p | lung cancer | ETS2 | "Quantitative proteomic analysis revealed that miR- ......" | 20978205 |
| hsa-miR-7-5p | colorectal cancer | FANCG | "Analysis using publicly available algorithms predi ......" | 24570594 |
| hsa-miR-7-5p | lung cancer | FGF2 | "LINC00115 might interact with miR-7 to regulate FG ......" | 27338053 |
| hsa-miR-7-5p | gastric cancer | GAN | "Furthermore the miR-7 expression level significant ......" | 22139078 |
| hsa-miR-7-5p | breast cancer | HOTAIR | "In addition the downregulation of miR-7 in BCSCs m ......" | 25070049 |
| hsa-miR-7-5p | breast cancer | HOXB3 | "In this study we found that the expression levels ......" | 22705304 |
| hsa-miR-7-5p | breast cancer | HOXD10 | "In addition the downregulation of miR-7 in BCSCs m ......" | 25070049 |
| hsa-miR-7-5p | gastric cancer | IGF1R | "Moreover the insulin-like growth factor-1 receptor ......" | 22614005 |
| hsa-miR-7-5p | lung squamous cell cancer | INA | "Ina ddition the overexpression of miR-7 significan ......" | 26135959 |
| hsa-miR-7-5p | melanoma | IRS2 | "Thus miR-7-5p may represent a novel tumor suppress ......" | 23206698 |
| hsa-miR-7-5p | lung squamous cell cancer | KCNJ2 | "Upregulation of the inwardly rectifying potassium ......" | 25880778 |
| hsa-miR-7-5p | ovarian cancer | KRT18 | "The pharmacological inhibition of PI3K-AKT and ERK ......" | 24816687 |
| hsa-miR-7-5p | lung cancer | LINC00115 | "LINC00115 might interact with miR-7 to regulate FG ......" | 27338053 |
| hsa-miR-7-5p | glioblastoma | MMP2 | "In addition miR-7 repressed p-ERK1/2 and p-AKT lev ......" | 22040413 |
| hsa-miR-7-5p | head and neck cancer | MMP8 | "Together these data support the coordinate regulat ......" | 23115635 |
| hsa-miR-7-5p | glioblastoma | MMP9 | "In addition miR-7 repressed p-ERK1/2 and p-AKT lev ......" | 22040413 |
| hsa-miR-7-5p | liver cancer | MTOR | "We also identified two novel putative miR-7 target ......" | 22234835 |
| hsa-miR-7-5p | lung cancer | MYC | "In support of this likelihood c-Myc bound to the m ......" | 20978205 |
| hsa-miR-7-5p | breast cancer | NGFRAP1 | "The results of our microRNA miRNA profile analysis ......" | 23384942 |
| hsa-miR-7-5p | glioblastoma | OGT | "Transcriptome analysis of miR-7 transfected EC in ......" | 25149532 |
| hsa-miR-7-5p | thyroid cancer | PAK1 | "Dual-luciferase reporter assays demonstrated that ......" | 27430434 |
| hsa-miR-7-5p | liver cancer | PIK3CD | "We first screened and identified a novel miR-7 tar ......" | 22234835 |
| hsa-miR-7-5p | lung cancer | PIK3R1 | "Notably we identify phosphoinositide-3-kinase regu ......" | 23135998 |
| hsa-miR-7-5p | lung cancer | PIK3R3 | "Notably we identify phosphoinositide-3-kinase regu ......" | 23135998 |
| hsa-miR-7-5p | lung squamous cell cancer | PSME3 | "In advance through bioinformatic analysis lucifera ......" | 24281003 |
| hsa-miR-7-5p | breast cancer | RASSF1 | "Stable overexpression of miR-7 and miR-218 was acc ......" | 22705304 |
| hsa-miR-7-5p | melanoma | RELA | "Importantly the effects of miR-7-5p on melanoma ce ......" | 27203220 |
| hsa-miR-7-5p | lung squamous cell cancer | SCLC1 | "The aim of this study was to investigate the funct ......" | 26108539 |
| hsa-miR-7-5p | pancreatic cancer | SETD8 | "We observed that curcumin suppressed cell growth m ......" | 25256401 |
| hsa-miR-7-5p | breast cancer | SETDB1 | "Here we show that miR-7 which was downregulated in ......" | 25070049 |
| hsa-miR-7-5p | breast cancer | SRC | "In contrast miR-7 inhibition of MCF-7/HER2Δ16 cel ......" | 25532106 |
| hsa-miR-7-5p | lung cancer | TLR4 | "Our recent evidence showed that Toll like receptor ......" | 24004462 |
| hsa-miR-7-5p | ovarian cancer | TP53 | "In high-grade OC with TP53 mutations the level of ......" | 25862909 |
| hsa-miR-7-5p | breast cancer | WISP2 | "We found that silencing WISP2 signaling in human b ......" | 24931170 |
| hsa-miR-7-5p | breast cancer | WNT1 | "Targeting WNT1 inducible signaling pathway protein ......" | 24931170 |
| hsa-miR-7-5p | cervical and endocervical cancer | XIAP | "Furthermore an oncogene X-linked inhibitor of apop ......" | 23742934 |
| hsa-miR-7-5p | colorectal cancer | XRCC2 | "miR 7 inhibits colorectal cancer cell proliferatio ......" | 24570594 |
| hsa-miR-7-5p | colorectal cancer | YY1 | "Intriguingly knock-down of YY1 in three colon canc ......" | 23208495 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-7-5p | ALDH1A3 | 10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.135; TCGA COAD -0.319; TCGA ESCA -0.107; TCGA HNSC -0.113; TCGA LUAD -0.1; TCGA LUSC -0.18; TCGA PAAD -0.209; TCGA THCA -0.396; TCGA STAD -0.318; TCGA UCEC -0.267 |
hsa-miR-7-5p | BTG2 | 9 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.353; TCGA CESC -0.151; TCGA COAD -0.079; TCGA HNSC -0.148; TCGA LGG -0.07; TCGA LUAD -0.09; TCGA LUSC -0.255; TCGA STAD -0.277; TCGA UCEC -0.168 |
hsa-miR-7-5p | COLEC12 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.237; TCGA CESC -0.168; TCGA COAD -0.391; TCGA ESCA -0.446; TCGA HNSC -0.239; TCGA LUAD -0.264; TCGA LUSC -0.53; TCGA PAAD -0.245; TCGA THCA -0.138; TCGA STAD -0.468; TCGA UCEC -0.408 |
hsa-miR-7-5p | CRTAP | 9 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.124; TCGA COAD -0.052; TCGA ESCA -0.1; TCGA LGG -0.078; TCGA LUAD -0.087; TCGA LUSC -0.093; TCGA PAAD -0.064; TCGA STAD -0.221; TCGA UCEC -0.133 |
hsa-miR-7-5p | FLNA | 10 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.113; TCGA COAD -0.249; TCGA ESCA -0.341; TCGA LGG -0.135; TCGA LUAD -0.118; TCGA LUSC -0.156; TCGA PAAD -0.181; TCGA THCA -0.191; TCGA STAD -0.618; TCGA UCEC -0.229 |
hsa-miR-7-5p | GFRA1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.515; TCGA CESC -0.409; TCGA COAD -0.577; TCGA ESCA -0.214; TCGA HNSC -0.44; TCGA LUAD -0.415; TCGA LUSC -0.584; TCGA STAD -0.773; TCGA UCEC -0.407 |
hsa-miR-7-5p | GLT8D2 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.121; TCGA CESC -0.116; TCGA COAD -0.349; TCGA ESCA -0.131; TCGA HNSC -0.094; TCGA LUAD -0.154; TCGA LUSC -0.254; TCGA PAAD -0.077; TCGA STAD -0.32; TCGA UCEC -0.327 |
hsa-miR-7-5p | IGFBP4 | 9 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.208; TCGA COAD -0.115; TCGA ESCA -0.088; TCGA HNSC -0.118; TCGA LGG -0.117; TCGA LUAD -0.172; TCGA LUSC -0.143; TCGA STAD -0.382; TCGA UCEC -0.253 |
hsa-miR-7-5p | MGLL | 10 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.16; TCGA CESC -0.112; TCGA COAD -0.116; TCGA HNSC -0.146; TCGA LUAD -0.184; TCGA LUSC -0.344; TCGA PAAD -0.124; TCGA THCA -0.106; TCGA STAD -0.228; TCGA UCEC -0.152 |
hsa-miR-7-5p | NBL1 | 9 cancers: BLCA; COAD; ESCA; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.091; TCGA COAD -0.063; TCGA ESCA -0.089; TCGA LUAD -0.139; TCGA LUSC -0.191; TCGA PAAD -0.127; TCGA THCA -0.186; TCGA STAD -0.082; TCGA UCEC -0.202 |
hsa-miR-7-5p | TAGLN | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.335; TCGA CESC -0.224; TCGA COAD -0.359; TCGA ESCA -0.302; TCGA HNSC -0.138; TCGA LUAD -0.165; TCGA LUSC -0.335; TCGA PAAD -0.191; TCGA STAD -0.738; TCGA UCEC -0.378 |
hsa-miR-7-5p | ZYX | 9 cancers: BLCA; ESCA; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.077; TCGA ESCA -0.102; TCGA LGG -0.065; TCGA LUAD -0.062; TCGA LUSC -0.134; TCGA PAAD -0.128; TCGA THCA -0.146; TCGA STAD -0.183; TCGA UCEC -0.115 |
hsa-miR-7-5p | WBSCR17 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.364; TCGA CESC -0.361; TCGA COAD -0.408; TCGA ESCA -0.229; TCGA HNSC -0.292; TCGA LUAD -0.322; TCGA LUSC -0.457; TCGA PAAD -0.1; TCGA STAD -0.4; TCGA UCEC -0.382 |
hsa-miR-7-5p | FBXL7 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.24; TCGA CESC -0.209; TCGA COAD -0.257; TCGA ESCA -0.157; TCGA HNSC -0.262; TCGA LUAD -0.118; TCGA LUSC -0.323; TCGA STAD -0.427; TCGA UCEC -0.405 |
hsa-miR-7-5p | CTSK | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.123; TCGA CESC -0.21; TCGA COAD -0.251; TCGA ESCA -0.101; TCGA HNSC -0.117; TCGA LUAD -0.115; TCGA LUSC -0.207; TCGA PAAD -0.204; TCGA THCA -0.157; TCGA STAD -0.157; TCGA UCEC -0.234 |
hsa-miR-7-5p | POU6F1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.106; TCGA CESC -0.161; TCGA COAD -0.196; TCGA ESCA -0.139; TCGA HNSC -0.216; TCGA LUAD -0.087; TCGA LUSC -0.132; TCGA STAD -0.416; TCGA UCEC -0.162 |
hsa-miR-7-5p | DSEL | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.102; TCGA CESC -0.241; TCGA COAD -0.265; TCGA ESCA -0.232; TCGA HNSC -0.113; TCGA LUAD -0.093; TCGA LUSC -0.292; TCGA STAD -0.445; TCGA UCEC -0.256 |
hsa-miR-7-5p | ZMAT3 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.086; TCGA CESC -0.095; TCGA COAD -0.233; TCGA ESCA -0.088; TCGA HNSC -0.073; TCGA LUSC -0.075; TCGA THCA -0.128; TCGA STAD -0.136; TCGA UCEC -0.096 |
hsa-miR-7-5p | TSPAN2 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.169; TCGA CESC -0.211; TCGA COAD -0.294; TCGA ESCA -0.181; TCGA HNSC -0.142; TCGA LUAD -0.118; TCGA LUSC -0.328; TCGA STAD -0.54; TCGA UCEC -0.48 |
hsa-miR-7-5p | BOC | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.321; TCGA CESC -0.375; TCGA COAD -0.414; TCGA ESCA -0.407; TCGA HNSC -0.332; TCGA LGG -0.066; TCGA LUAD -0.183; TCGA LUSC -0.185; TCGA STAD -0.655; TCGA UCEC -0.272 |
hsa-miR-7-5p | NFIX | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BLCA -0.103; TCGA CESC -0.137; TCGA COAD -0.06; TCGA ESCA -0.132; TCGA HNSC -0.181; TCGA LGG -0.07; TCGA LUAD -0.273; TCGA LUSC -0.238; TCGA PAAD -0.075; TCGA STAD -0.246; TCGA UCEC -0.208 |
hsa-miR-7-5p | CELF2 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.174; TCGA COAD -0.176; TCGA ESCA -0.198; TCGA HNSC -0.19; TCGA LUAD -0.181; TCGA LUSC -0.388; TCGA THCA -0.083; TCGA STAD -0.404; TCGA UCEC -0.226 |
hsa-miR-7-5p | TNS1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.418; TCGA CESC -0.195; TCGA COAD -0.389; TCGA ESCA -0.234; TCGA HNSC -0.213; TCGA LUAD -0.219; TCGA LUSC -0.386; TCGA STAD -0.674; TCGA UCEC -0.316 |
hsa-miR-7-5p | ESR1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.142; TCGA CESC -0.451; TCGA COAD -0.373; TCGA ESCA -0.264; TCGA HNSC -0.108; TCGA LUAD -0.167; TCGA LUSC -0.28; TCGA THCA -0.114; TCGA STAD -0.361; TCGA UCEC -0.176 |
hsa-miR-7-5p | FAM189A1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.226; TCGA CESC -0.291; TCGA COAD -0.478; TCGA ESCA -0.288; TCGA HNSC -0.442; TCGA LUAD -0.138; TCGA LUSC -0.321; TCGA STAD -0.63; TCGA UCEC -0.274 |
hsa-miR-7-5p | SH3PXD2A | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.131; TCGA CESC -0.08; TCGA COAD -0.202; TCGA ESCA -0.157; TCGA HNSC -0.053; TCGA LUAD -0.053; TCGA LUSC -0.134; TCGA PAAD -0.073; TCGA THCA -0.066; TCGA STAD -0.174; TCGA UCEC -0.154 |
hsa-miR-7-5p | KIAA0513 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.203; TCGA CESC -0.082; TCGA COAD -0.206; TCGA ESCA -0.083; TCGA HNSC -0.07; TCGA LUAD -0.091; TCGA LUSC -0.275; TCGA STAD -0.201; TCGA UCEC -0.087 |
hsa-miR-7-5p | WTIP | 9 cancers: BLCA; COAD; ESCA; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.093; TCGA COAD -0.216; TCGA ESCA -0.19; TCGA LUAD -0.2; TCGA LUSC -0.154; TCGA PAAD -0.097; TCGA THCA -0.243; TCGA STAD -0.307; TCGA UCEC -0.08 |
hsa-miR-7-5p | AKAP13 | 10 cancers: BLCA; CESC; COAD; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.116; TCGA CESC -0.126; TCGA COAD -0.172; TCGA LGG -0.08; TCGA LUAD -0.079; TCGA LUSC -0.219; TCGA PAAD -0.095; TCGA THCA -0.066; TCGA STAD -0.067; TCGA UCEC -0.141 |
hsa-miR-7-5p | EGR3 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.159; TCGA CESC -0.181; TCGA COAD -0.18; TCGA ESCA -0.122; TCGA HNSC -0.22; TCGA LUAD -0.128; TCGA LUSC -0.341; TCGA STAD -0.25; TCGA UCEC -0.151 |
hsa-miR-7-5p | PRELP | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.544; TCGA CESC -0.417; TCGA COAD -0.591; TCGA ESCA -0.423; TCGA HNSC -0.475; TCGA LUAD -0.265; TCGA LUSC -0.539; TCGA STAD -0.849; TCGA UCEC -0.458 |
hsa-miR-7-5p | ATXN1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.12; TCGA CESC -0.098; TCGA COAD -0.115; TCGA ESCA -0.11; TCGA HNSC -0.057; TCGA LUSC -0.126; TCGA PAAD -0.086; TCGA STAD -0.235; TCGA UCEC -0.166 |
hsa-miR-7-5p | FOXN3 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | miRNATAP | TCGA BLCA -0.134; TCGA CESC -0.124; TCGA COAD -0.149; TCGA ESCA -0.129; TCGA HNSC -0.085; TCGA LUAD -0.06; TCGA LUSC -0.148; TCGA STAD -0.275; TCGA UCEC -0.151 |
hsa-miR-7-5p | SCN2B | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.171; TCGA CESC -0.276; TCGA COAD -0.611; TCGA ESCA -0.44; TCGA HNSC -0.257; TCGA LUAD -0.343; TCGA LUSC -0.544; TCGA THCA -0.057; TCGA STAD -0.853; TCGA UCEC -0.441 |
hsa-miR-7-5p | TCF4 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.097; TCGA CESC -0.139; TCGA COAD -0.275; TCGA ESCA -0.132; TCGA HNSC -0.128; TCGA LUAD -0.077; TCGA LUSC -0.198; TCGA PAAD -0.066; TCGA STAD -0.252; TCGA UCEC -0.228 |
hsa-miR-7-5p | MFRP | 9 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PAAD; UCEC | miRNATAP | TCGA BLCA -0.172; TCGA CESC -0.175; TCGA COAD -0.195; TCGA HNSC -0.146; TCGA LGG -0.144; TCGA LUAD -0.17; TCGA LUSC -0.279; TCGA PAAD -0.103; TCGA UCEC -0.124 |
hsa-miR-7-5p | PRKG1 | 9 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.206; TCGA CESC -0.333; TCGA COAD -0.373; TCGA HNSC -0.125; TCGA LUAD -0.169; TCGA LUSC -0.445; TCGA PAAD -0.148; TCGA STAD -0.414; TCGA UCEC -0.471 |
hsa-miR-7-5p | REM1 | 9 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; STAD; UCEC | miRNATAP | TCGA BLCA -0.181; TCGA CESC -0.268; TCGA COAD -0.205; TCGA HNSC -0.164; TCGA LGG -0.121; TCGA LUAD -0.238; TCGA LUSC -0.372; TCGA STAD -0.313; TCGA UCEC -0.3 |
hsa-miR-7-5p | CNN3 | 10 cancers: CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA CESC -0.072; TCGA ESCA -0.074; TCGA HNSC -0.131; TCGA LGG -0.093; TCGA LUAD -0.069; TCGA LUSC -0.208; TCGA PAAD -0.063; TCGA THCA -0.113; TCGA STAD -0.183; TCGA UCEC -0.129 |
hsa-miR-7-5p | FGF1 | 9 cancers: CESC; COAD; ESCA; HNSC; LUAD; LUSC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.228; TCGA COAD -0.34; TCGA ESCA -0.335; TCGA HNSC -0.1; TCGA LUAD -0.168; TCGA LUSC -0.27; TCGA THCA -0.094; TCGA STAD -0.344; TCGA UCEC -0.149 |
hsa-miR-7-5p | PDGFC | 10 cancers: CESC; COAD; ESCA; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.19; TCGA COAD -0.355; TCGA ESCA -0.125; TCGA LGG -0.133; TCGA LUAD -0.103; TCGA LUSC -0.177; TCGA PAAD -0.245; TCGA THCA -0.071; TCGA STAD -0.273; TCGA UCEC -0.172 |
hsa-miR-7-5p | KCNJ5 | 9 cancers: CESC; COAD; ESCA; LGG; LUAD; LUSC; THCA; STAD; UCEC | mirMAP | TCGA CESC -0.136; TCGA COAD -0.363; TCGA ESCA -0.152; TCGA LGG -0.12; TCGA LUAD -0.116; TCGA LUSC -0.474; TCGA THCA -0.224; TCGA STAD -0.25; TCGA UCEC -0.09 |
hsa-miR-7-5p | COL1A2 | 9 cancers: CESC; COAD; ESCA; LGG; LUSC; PAAD; THCA; STAD; UCEC | miRNATAP | TCGA CESC -0.203; TCGA COAD -0.266; TCGA ESCA -0.12; TCGA LGG -0.075; TCGA LUSC -0.185; TCGA PAAD -0.251; TCGA THCA -0.184; TCGA STAD -0.108; TCGA UCEC -0.172 |
hsa-miR-7-5p | CAPN2 | 9 cancers: COAD; ESCA; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA COAD -0.118; TCGA ESCA -0.063; TCGA LGG -0.072; TCGA LUAD -0.082; TCGA LUSC -0.182; TCGA PAAD -0.098; TCGA THCA -0.08; TCGA STAD -0.069; TCGA UCEC -0.107 |
hsa-miR-7-5p | EGFR | 9 cancers: COAD; ESCA; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRTarBase; MirTarget | TCGA COAD -0.099; TCGA ESCA -0.268; TCGA LGG -0.084; TCGA LUAD -0.092; TCGA LUSC -0.124; TCGA PAAD -0.186; TCGA THCA -0.11; TCGA STAD -0.155; TCGA UCEC -0.166 |
hsa-miR-7-5p | TMEM43 | 9 cancers: COAD; ESCA; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget | TCGA COAD -0.058; TCGA ESCA -0.143; TCGA LGG -0.082; TCGA LUAD -0.072; TCGA LUSC -0.077; TCGA PAAD -0.082; TCGA THCA -0.157; TCGA STAD -0.211; TCGA UCEC -0.139 |
Enriched cancer pathways of putative targets