microRNA information: hsa-miR-874-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-874-3p | miRbase |
| Accession: | MIMAT0004911 | miRbase |
| Precursor name: | hsa-mir-874 | miRbase |
| Precursor accession: | MI0005532 | miRbase |
| Symbol: | MIR874 | HGNC |
| RefSeq ID: | NR_030588 | GenBank |
| Sequence: | CUGCCCUGGCCCGAGGGACCGA |
Reported expression in cancers: hsa-miR-874-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-874-3p | breast cancer | downregulation | "It has been demonstrated that miR-874 plays import ......" | 25281924 | |
| hsa-miR-874-3p | colorectal cancer | downregulation | "MicroRNA-874 miR-874 has previously been identifie ......" | 26875895 | qPCR |
| hsa-miR-874-3p | colorectal cancer | downregulation | "Decreased expression of miR 874 and its tumor supp ......" | 27173188 | Reverse transcription PCR |
| hsa-miR-874-3p | colorectal cancer | downregulation | "MicroRNA 874 inhibits growth induces apoptosis and ......" | 27221209 | qPCR |
| hsa-miR-874-3p | head and neck cancer | downregulation | "Our recent studies of microRNA miRNA expression si ......" | 23558898 |
Reported cancer pathway affected by hsa-miR-874-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-874-3p | breast cancer | Apoptosis pathway; cell cycle pathway | "MicroRNA 874 inhibits cell proliferation and induc ......" | 25281924 | |
| hsa-miR-874-3p | colorectal cancer | Apoptosis pathway | "MiR 874 inhibits cell growth and induces apoptosis ......" | 26875895 | Western blot; Luciferase |
| hsa-miR-874-3p | colorectal cancer | Apoptosis pathway | "Decreased expression of miR 874 and its tumor supp ......" | 27173188 | |
| hsa-miR-874-3p | colorectal cancer | Apoptosis pathway | "MicroRNA 874 inhibits growth induces apoptosis and ......" | 27221209 | Flow cytometry; Colony formation; Luciferase; Western blot |
| hsa-miR-874-3p | gastric cancer | Apoptosis pathway | "miR 874 Inhibits cell proliferation migration and ......" | 23800944 | Western blot; Luciferase |
| hsa-miR-874-3p | head and neck cancer | cell cycle pathway; Apoptosis pathway | "Tumour suppressive microRNA 874 contributes to cel ......" | 23558898 | Luciferase |
| hsa-miR-874-3p | sarcoma | Apoptosis pathway | "Decreased expression of tumor suppressive miR 874 ......" | 26782479 | Cell migration assay |
Reported cancer prognosis affected by hsa-miR-874-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-874-3p | breast cancer | poor survival | "We performed survival analysis on a cohort of 466 ......" | 23589849 | |
| hsa-miR-874-3p | breast cancer | motility | "Forced expression of Module-1 miRs miR-29a-3p; miR ......" | 25961594 | |
| hsa-miR-874-3p | colorectal cancer | tumorigenesis; worse prognosis; staging; tumor size; poor survival | "Decreased expression of miR 874 and its tumor supp ......" | 27173188 | |
| hsa-miR-874-3p | colorectal cancer | drug resistance; staging; metastasis | "MicroRNA 874 inhibits growth induces apoptosis and ......" | 27221209 | Flow cytometry; Colony formation; Luciferase; Western blot |
| hsa-miR-874-3p | gastric cancer | cell migration; progression | "miR 874 Inhibits cell proliferation migration and ......" | 23800944 | Western blot; Luciferase |
| hsa-miR-874-3p | gastric cancer | progression | "miR 874 functions as a tumor suppressor by inhibit ......" | 25596740 | Western blot |
| hsa-miR-874-3p | lung squamous cell cancer | progression; differentiation | "Suppression of tumor cell invasiveness and in vivo ......" | 23583374 | |
| hsa-miR-874-3p | lung squamous cell cancer | staging | "Here we used qRT-PCR to re-analyze our previous mi ......" | 27761023 | |
| hsa-miR-874-3p | sarcoma | progression; tumorigenesis; staging; metastasis; poor survival; tumor size | "Decreased expression of tumor suppressive miR 874 ......" | 26782479 | Cell migration assay |
Reported gene related to hsa-miR-874-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-874-3p | colorectal cancer | STAT3 | "MiR 874 inhibits cell growth and induces apoptosis ......" | 26875895 |
| hsa-miR-874-3p | gastric cancer | STAT3 | "Through reporter gene and western blot assays STAT ......" | 25596740 |
| hsa-miR-874-3p | gastric cancer | AQP3 | "miR 874 Inhibits cell proliferation migration and ......" | 23800944 |
| hsa-miR-874-3p | breast cancer | CDK9 | "MicroRNA 874 inhibits cell proliferation and induc ......" | 25281924 |
| hsa-miR-874-3p | head and neck cancer | HDAC1 | "Tumour suppressive microRNA 874 contributes to cel ......" | 23558898 |
| hsa-miR-874-3p | lung squamous cell cancer | MMP2 | "In silico target prediction analysis revealed nume ......" | 23583374 |
| hsa-miR-874-3p | lung squamous cell cancer | PLAU | "In silico target prediction analysis revealed nume ......" | 23583374 |
| hsa-miR-874-3p | colorectal cancer | XIAP | "Through luciferase activity assay RT-qPCR and west ......" | 27221209 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-874-3p | ST5 | 9 cancers: BLCA; CESC; LGG; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.196; TCGA CESC -0.168; TCGA LGG -0.104; TCGA OV -0.127; TCGA PAAD -0.116; TCGA SARC -0.231; TCGA THCA -0.069; TCGA STAD -0.146; TCGA UCEC -0.061 |
hsa-miR-874-3p | MAP3K14 | 11 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.174; TCGA BRCA -0.132; TCGA KIRC -0.489; TCGA KIRP -0.132; TCGA LGG -0.161; TCGA LIHC -0.123; TCGA PAAD -0.099; TCGA SARC -0.166; TCGA THCA -0.236; TCGA STAD -0.1; TCGA UCEC -0.106 |
hsa-miR-874-3p | MTAP | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; PAAD; SARC; THCA | MirTarget | TCGA BLCA -0.411; TCGA CESC -0.118; TCGA COAD -0.099; TCGA ESCA -0.31; TCGA HNSC -0.247; TCGA KIRP -0.079; TCGA LGG -0.053; TCGA LIHC -0.059; TCGA PAAD -0.36; TCGA SARC -0.186; TCGA THCA -0.075 |
hsa-miR-874-3p | CORO1C | 9 cancers: BLCA; KIRC; KIRP; LGG; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.297; TCGA KIRC -0.241; TCGA KIRP -0.157; TCGA LGG -0.166; TCGA PAAD -0.167; TCGA SARC -0.211; TCGA THCA -0.157; TCGA STAD -0.145; TCGA UCEC -0.121 |
hsa-miR-874-3p | AGTRAP | 10 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD | MirTarget | TCGA BRCA -0.195; TCGA CESC -0.094; TCGA COAD -0.101; TCGA HNSC -0.128; TCGA KIRC -0.208; TCGA KIRP -0.119; TCGA LGG -0.108; TCGA LIHC -0.119; TCGA LUSC -0.247; TCGA PAAD -0.239 |
hsa-miR-874-3p | DERL1 | 9 cancers: CESC; COAD; KIRC; KIRP; LIHC; LUAD; OV; THCA; UCEC | MirTarget | TCGA CESC -0.059; TCGA COAD -0.087; TCGA KIRC -0.145; TCGA KIRP -0.102; TCGA LIHC -0.066; TCGA LUAD -0.067; TCGA OV -0.143; TCGA THCA -0.122; TCGA UCEC -0.102 |
Enriched cancer pathways of putative targets