microRNA information: hsa-miR-877-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-877-3p | miRbase |
| Accession: | MIMAT0004950 | miRbase |
| Precursor name: | hsa-mir-877 | miRbase |
| Precursor accession: | MI0005561 | miRbase |
| Symbol: | MIR877 | HGNC |
| RefSeq ID: | NR_030615 | GenBank |
| Sequence: | UCCUCUUCUCCCUCCUCCCAG |
Reported expression in cancers: hsa-miR-877-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-877-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-877-3p | bladder cancer | cell cycle pathway | "Up regulation of p16 by miR 877 3p inhibits prolif ......" | 27429046 |
Reported cancer prognosis affected by hsa-miR-877-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-877-3p | liver cancer | drug resistance | "Up regulation of miR 877 induced by paclitaxel inh ......" | 25973036 | Colony formation |
Reported gene related to hsa-miR-877-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-877-3p | bladder cancer | CDKN2A | "Up regulation of p16 by miR 877 3p inhibits prolif ......" | 27429046 |
| hsa-miR-877-3p | liver cancer | FOXM1 | "Up regulation of miR 877 induced by paclitaxel inh ......" | 25973036 |