microRNA information: hsa-miR-885-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-885-5p | miRbase |
| Accession: | MIMAT0004947 | miRbase |
| Precursor name: | hsa-mir-885 | miRbase |
| Precursor accession: | MI0005560 | miRbase |
| Symbol: | MIR885 | HGNC |
| RefSeq ID: | NR_030614 | GenBank |
| Sequence: | UCCAUUACACUACCCUGCCUCU |
Reported expression in cancers: hsa-miR-885-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-885-5p | colorectal cancer | downregulation | "Secondly validation of the results was carried out ......" | 27365381 | qPCR |
| hsa-miR-885-5p | thyroid cancer | upregulation | "Thirty-eight follicular thyroid carcinomas 21 cFTC ......" | 23150679 | Microarray |
Reported cancer pathway affected by hsa-miR-885-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-885-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-885-5p | colorectal cancer | metastasis; worse prognosis | "Four miRNAs downregulated in LM let-7i miR-10b miR ......" | 25663689 | |
| hsa-miR-885-5p | colorectal cancer | metastasis | "Secondly validation of the results was carried out ......" | 27365381 | |
| hsa-miR-885-5p | pancreatic cancer | staging | "Blood-based circulating microRNAs were profiled by ......" | 24578785 | |
| hsa-miR-885-5p | pancreatic cancer | staging | "Plasma miR 22 3p miR 642b 3p and miR 885 5p as dia ......" | 27631726 |
Reported gene related to hsa-miR-885-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-885-5p | colon cancer | BMPR1A | "MicroRNA 885 3p inhibits the growth of HT 29 colon ......" | 24882581 |
| hsa-miR-885-5p | head and neck cancer | CASP3 | "A functional variant at the miR 885 5p binding sit ......" | 23271051 |
| hsa-miR-885-5p | thyroid cancer | FLNA | "In addition the oPD thyroid carcinomas demonstrate ......" | 24443580 |
| hsa-miR-885-5p | colon cancer | HT | "MicroRNA 885 3p inhibits the growth of HT 29 colon ......" | 24882581 |
| hsa-miR-885-5p | glioblastoma | MMP9 | "Among them two miRNAs: miR-885-5p and miR-491-5p w ......" | 21831363 |