microRNA information: hsa-miR-889-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-889-3p | miRbase |
| Accession: | MIMAT0004921 | miRbase |
| Precursor name: | hsa-mir-889 | miRbase |
| Precursor accession: | MI0005540 | miRbase |
| Symbol: | MIR889 | HGNC |
| RefSeq ID: | NR_030595 | GenBank |
| Sequence: | UUAAUAUCGGACAACCAUUGU |
Reported expression in cancers: hsa-miR-889-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-889-3p | NA | NA | "NA ......" | NA | NA |
| hsa-miR-889-3p | " ......" |
Reported cancer pathway affected by hsa-miR-889-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-889-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-889-3p | colorectal cancer | drug resistance; progression; poor survival | "We identified a miRNA profile that was analysed by ......" | 25197016 |
Reported gene related to hsa-miR-889-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-889-3p | esophageal cancer | DAB2IP | "miR 889 promotes proliferation of esophageal squam ......" | 25841337 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-889-3p | MAL2 | 9 cancers: BRCA; CESC; COAD; HNSC; KIRP; LUAD; PAAD; PRAD; UCEC | MirTarget | TCGA BRCA -0.221; TCGA CESC -0.158; TCGA COAD -0.17; TCGA HNSC -0.377; TCGA KIRP -0.134; TCGA LUAD -0.13; TCGA PAAD -0.175; TCGA PRAD -0.179; TCGA UCEC -0.15 |
Enriched cancer pathways of putative targets