microRNA information: hsa-miR-892a
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-892a | miRbase |
| Accession: | MIMAT0004907 | miRbase |
| Precursor name: | hsa-mir-892a | miRbase |
| Precursor accession: | MI0005528 | miRbase |
| Symbol: | MIR892A | HGNC |
| RefSeq ID: | NR_030584 | GenBank |
| Sequence: | CACUGUGUCCUUUCUGCGUAG |
Reported expression in cancers: hsa-miR-892a
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-892a | colorectal cancer | upregulation | "We found that miR-892a was frequently upregulated ......" | 26054685 |
Reported cancer pathway affected by hsa-miR-892a
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-892a
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|
Reported gene related to hsa-miR-892a
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-892a | colorectal cancer | PPP2R2A | "miR 892a regulated PPP2R2A expression and promoted ......" | 26054685 |