microRNA information: hsa-miR-9-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-9-3p | miRbase |
Accession: | MIMAT0000442 | miRbase |
Precursor name: | hsa-mir-9-1 | miRbase |
Precursor accession: | MI0000466 | miRbase |
Symbol: | MIR9-1 | HGNC |
RefSeq ID: | NR_029691 | GenBank |
Sequence: | AUAAAGCUAGAUAACCGAAAGU |
Reported expression in cancers: hsa-miR-9-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-9-3p | bladder cancer | upregulation | "The present study aims to identify the expression ......" | 26150338 | |
hsa-miR-9-3p | breast cancer | upregulation | "Some miRNAs especially the miR-200 family miR-9 an ......" | 25086633 | qPCR |
hsa-miR-9-3p | breast cancer | downregulation | "Aberrant expression of miR 9 in benign and maligna ......" | 27725294 | qPCR |
hsa-miR-9-3p | cervical and endocervical cancer | upregulation | "Molecular identification of miR 145 and miR 9 expr ......" | 27345415 | qPCR |
hsa-miR-9-3p | colon cancer | downregulation | "Among the miRNAs demonstrating the largest fold up ......" | 21694772 | |
hsa-miR-9-3p | colon cancer | downregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
hsa-miR-9-3p | colorectal cancer | deregulation | "Real time-polymerase chain reaction was used to an ......" | 26867319 | qPCR |
hsa-miR-9-3p | esophageal cancer | upregulation | "Deregulation of MicroRNA-9 miR-9 has been document ......" | 25375090 | |
hsa-miR-9-3p | gastric cancer | downregulation | "Down regulated miR 9 and miR 433 in human gastric ......" | 19531230 | qPCR |
hsa-miR-9-3p | gastric cancer | downregulation | "Aberrant hypermethylation of miR 9 genes in gastri ......" | 21931274 | |
hsa-miR-9-3p | gastric cancer | downregulation | "Compared with the expression levels in the normal ......" | 25013480 | |
hsa-miR-9-3p | gastric cancer | downregulation | "Real-time quantitative PCR RTQ-PCR was employed to ......" | 25270964 | qPCR |
hsa-miR-9-3p | liver cancer | upregulation | "Up regulation of miR 9 expression predicate advanc ......" | 25552204 | qPCR |
hsa-miR-9-3p | liver cancer | downregulation | "MicroRNA-9 miR-9 dysregulation is implicated in a ......" | 26547929 | Microarray; qPCR |
hsa-miR-9-3p | lung cancer | deregulation | "Therefore we conduct to systematically identify mi ......" | 26870998 | Microarray |
hsa-miR-9-3p | lung squamous cell cancer | upregulation | "Up regulation of miR 9 expression as a poor progno ......" | 24019037 | qPCR |
hsa-miR-9-3p | melanoma | downregulation | "Hsa-miR-9 has been shown to have opposite function ......" | 22131135 | |
hsa-miR-9-3p | ovarian cancer | downregulation | "Ovarian cancer tissues display significantly low e ......" | 19702828 | |
hsa-miR-9-3p | ovarian cancer | downregulation | "Methylation associated Has miR 9 deregulation in p ......" | 26152689 | |
hsa-miR-9-3p | prostate cancer | upregulation | "Significantly a subset of miRNAs miR-9 miR-25 miR- ......" | 24135225 |
Reported cancer pathway affected by hsa-miR-9-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-9-3p | acute myeloid leukemia | Apoptosis pathway | "Our results showed that the level of either Hes1 o ......" | 26678889 | |
hsa-miR-9-3p | bladder cancer | Apoptosis pathway; cell cycle pathway | "miR 9 promotes cell proliferation and inhibits apo ......" | 26150338 | Luciferase |
hsa-miR-9-3p | breast cancer | Epithelial mesenchymal transition pathway | "Global miRNA expression profiling was performed on ......" | 22294488 | |
hsa-miR-9-3p | breast cancer | Epithelial mesenchymal transition pathway | "Some miRNAs especially the miR-200 family miR-9 an ......" | 25086633 | |
hsa-miR-9-3p | breast cancer | Apoptosis pathway | "Based on the results obtained in the last decade s ......" | 26199650 | |
hsa-miR-9-3p | breast cancer | cell cycle pathway | "Performing qPCR we identified eight miRs different ......" | 27152840 | |
hsa-miR-9-3p | breast cancer | p53 signaling pathway | "Aberrant expression of miR 9 in benign and maligna ......" | 27725294 | |
hsa-miR-9-3p | colon cancer | Epithelial mesenchymal transition pathway | "Prospero homeobox 1 promotes epithelial mesenchyma ......" | 23045246 | |
hsa-miR-9-3p | colorectal cancer | Apoptosis pathway | "Here we showed that compared with corresponding no ......" | 25940709 | Luciferase |
hsa-miR-9-3p | esophageal cancer | Epithelial mesenchymal transition pathway | "Deregulation of MicroRNA-9 miR-9 has been document ......" | 25375090 | |
hsa-miR-9-3p | gastric cancer | Hippo signaling pathway | "Cullin 4A CUL4A a direct target of miR 9 and miR 1 ......" | 26840256 | |
hsa-miR-9-3p | liver cancer | Apoptosis pathway | "Long noncoding RNA ZNFX1 AS1 suppresses growth of ......" | 27574442 | MTT assay; Colony formation |
hsa-miR-9-3p | lung cancer | Epithelial mesenchymal transition pathway | "Specifically let-7 and miR-9 are deregulated in bo ......" | 23365639 | |
hsa-miR-9-3p | lung cancer | cell cycle pathway | "MIR 142 5p and miR 9 may be involved in squamous l ......" | 24338464 | |
hsa-miR-9-3p | lung squamous cell cancer | Apoptosis pathway | "Demethylation of miR 9 3 and miR 193a genes suppre ......" | 24356455 | Flow cytometry; Western blot |
hsa-miR-9-3p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "miR-9 family members miR-9s including miR-9-1 9-2 ......" | 24649145 | |
hsa-miR-9-3p | lymphoma | Apoptosis pathway | "Expression pattern of hsa miR 9 and its associatio ......" | 23688983 | Western blot; Flow cytometry |
hsa-miR-9-3p | melanoma | cell cycle pathway | "Quantitative RT-PCR analysis was used to determine ......" | 26104682 | Luciferase |
hsa-miR-9-3p | ovarian cancer | Apoptosis pathway | "SKOV3 ovarian cancer cells were treated with curcu ......" | 24870723 | Western blot |
hsa-miR-9-3p | sarcoma | Apoptosis pathway; Epithelial mesenchymal transition pathway | "17β estradiol regulates cell proliferation colony ......" | 25592968 | Colony formation |
hsa-miR-9-3p | sarcoma | Apoptosis pathway | "MiR 9 is overexpressed in spontaneous canine osteo ......" | 27724924 | Western blot |
Reported cancer prognosis affected by hsa-miR-9-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-9-3p | acute myeloid leukemia | poor survival | "Our results showed that the level of either Hes1 o ......" | 26678889 | |
hsa-miR-9-3p | bladder cancer | staging; poor survival; recurrence | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
hsa-miR-9-3p | bladder cancer | progression; drug resistance; malignant trasformation | "miR 9 promotes cell proliferation and inhibits apo ......" | 26150338 | Luciferase |
hsa-miR-9-3p | bladder cancer | drug resistance | "Focusing on the major obstacle regarding MIBC pati ......" | 27586262 | |
hsa-miR-9-3p | breast cancer | metastasis; staging; progression | "Global miRNA expression profiling was performed on ......" | 22294488 | |
hsa-miR-9-3p | breast cancer | metastasis | "The clinico pathologic role of microRNAs miR 9 and ......" | 22489664 | |
hsa-miR-9-3p | breast cancer | poor survival | "Eight candidate miRs that showed significant diffe ......" | 22723919 | |
hsa-miR-9-3p | breast cancer | metastasis | "The aim of this study was to investigate the relat ......" | 23617747 | |
hsa-miR-9-3p | breast cancer | metastasis | "In this study we explored whether FOXO1 3'UTR can ......" | 25017439 | |
hsa-miR-9-3p | breast cancer | poor survival; progression; worse prognosis | "Some miRNAs especially the miR-200 family miR-9 an ......" | 25086633 | |
hsa-miR-9-3p | breast cancer | drug resistance | "Besides several miRNAs e.g miR-375 were enriched i ......" | 25680412 | |
hsa-miR-9-3p | breast cancer | metastasis; worse prognosis; drug resistance | "Based on the results obtained in the last decade s ......" | 26199650 | |
hsa-miR-9-3p | breast cancer | differentiation | "miR 9 and miR 200 Regulate PDGFRβ Mediated Endoth ......" | 27402080 | |
hsa-miR-9-3p | breast cancer | malignant trasformation; progression | "Aberrant expression of miR 9 in benign and maligna ......" | 27725294 | |
hsa-miR-9-3p | cervical and endocervical cancer | poor survival | "Using an established PCR-based miRNA assay to anal ......" | 20124485 | |
hsa-miR-9-3p | cervical and endocervical cancer | cell migration; motility | "Activation of miR 9 by human papillomavirus in cer ......" | 25344913 | |
hsa-miR-9-3p | cervical and endocervical cancer | staging; metastasis; poor survival | "Molecular identification of miR 145 and miR 9 expr ......" | 27345415 | |
hsa-miR-9-3p | colon cancer | poor survival; tumorigenesis | "MiR 9 31 and 182 deregulation promote proliferatio ......" | 23019418 | |
hsa-miR-9-3p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
hsa-miR-9-3p | colorectal cancer | metastasis | "Treatment with a DNA methyltransferase inhibitor a ......" | 19521961 | |
hsa-miR-9-3p | colorectal cancer | metastasis; motility | "Human microRNA-9 miR-9 has been reported to be inv ......" | 21562850 | Cell migration assay; Western blot |
hsa-miR-9-3p | colorectal cancer | metastasis | "We analyzed 60 colon cancers and paired normal spe ......" | 26983891 | Luciferase |
hsa-miR-9-3p | endometrial cancer | malignant trasformation | "Expression profiling of normal and malignant endom ......" | 20028871 | |
hsa-miR-9-3p | esophageal cancer | metastasis; progression; poor survival; cell migration | "Deregulation of MicroRNA-9 miR-9 has been document ......" | 25375090 | |
hsa-miR-9-3p | gastric cancer | progression | "Aberrant hypermethylation of miR 9 genes in gastri ......" | 21931274 | |
hsa-miR-9-3p | gastric cancer | progression; metastasis | "Recent evidence shows that altered microRNA-9 miR- ......" | 23383271 | Luciferase |
hsa-miR-9-3p | gastric cancer | staging; worse prognosis | "Overexpression of activated leukocute cell adhesio ......" | 25395097 | |
hsa-miR-9-3p | glioblastoma | differentiation | "Foremost among these is miR-9 which suppresses mes ......" | 21385897 | |
hsa-miR-9-3p | glioblastoma | drug resistance | "Computational studies real-time PCR reporter gene ......" | 25595896 | Western blot |
hsa-miR-9-3p | glioblastoma | metastasis; worse prognosis | "hsa miR 9 controls the mobility behavior of gliobl ......" | 27036038 | |
hsa-miR-9-3p | glioblastoma | drug resistance | "High expression of miR 9 in CD133+ glioblastoma ce ......" | 27347493 | |
hsa-miR-9-3p | kidney renal cell cancer | recurrence; poor survival | "Hsa miR 9 methylation status is associated with ca ......" | 20676129 | |
hsa-miR-9-3p | liver cancer | metastasis | "Identification of metastasis related microRNAs of ......" | 19912688 | |
hsa-miR-9-3p | liver cancer | cell migration | "There was also a significantly higher expression o ......" | 23684102 | |
hsa-miR-9-3p | liver cancer | staging; worse prognosis; poor survival | "Up regulation of miR 9 expression predicate advanc ......" | 25552204 | |
hsa-miR-9-3p | liver cancer | poor survival | "Among the seven significant miRNAs six hsa-mir-326 ......" | 26046780 | |
hsa-miR-9-3p | liver cancer | tumor size; progression | "MicroRNA-9 miR-9 dysregulation is implicated in a ......" | 26547929 | Western blot; Luciferase |
hsa-miR-9-3p | liver cancer | progression; tumorigenesis; worse prognosis; malignant trasformation; poor survival | "MicroRNA-9 miR-9 is known to play an important rol ......" | 26770365 | Western blot |
hsa-miR-9-3p | liver cancer | progression | "Long noncoding RNA ZNFX1 AS1 suppresses growth of ......" | 27574442 | MTT assay; Colony formation |
hsa-miR-9-3p | lung cancer | metastasis | "Moreover expression levels of 84 tumor metastasis- ......" | 23296057 | |
hsa-miR-9-3p | lung squamous cell cancer | staging; malignant trasformation | "Genome wide miRNA expression profiling identifies ......" | 22282464 | |
hsa-miR-9-3p | lung squamous cell cancer | worse prognosis; staging; metastasis; tumor size; progression; poor survival | "Up regulation of miR 9 expression as a poor progno ......" | 24019037 | |
hsa-miR-9-3p | lung squamous cell cancer | poor survival | "miR-9 family members miR-9s including miR-9-1 9-2 ......" | 24649145 | |
hsa-miR-9-3p | lung squamous cell cancer | metastasis | "The differentially expressed microRNAs associated ......" | 25628919 | |
hsa-miR-9-3p | lung squamous cell cancer | metastasis | "Expression of miR-9 miR-10b miR-145 and miR-155 4 ......" | 26909466 | |
hsa-miR-9-3p | lymphoma | malignant trasformation | "A common trend of miRNA expression with the except ......" | 20930934 | |
hsa-miR-9-3p | melanoma | metastasis; progression | "Hsa-miR-9 has been shown to have opposite function ......" | 22131135 | |
hsa-miR-9-3p | melanoma | metastasis; cell migration | "MicroRNAs miRNAs have been implicated in the regul ......" | 22825752 | |
hsa-miR-9-3p | melanoma | metastasis | "Six microRNAs miR-9 miR-145 miR-150 miR-155 miR-20 ......" | 23863473 | |
hsa-miR-9-3p | melanoma | progression | "Quantitative RT-PCR analysis was used to determine ......" | 26104682 | Luciferase |
hsa-miR-9-3p | ovarian cancer | poor survival | "Deregulated miRNAs identified by miRNA microarray ......" | 23627607 | Western blot; Luciferase |
hsa-miR-9-3p | ovarian cancer | metastasis; progression | "miR 9 functions as a tumor suppressor in ovarian s ......" | 23722670 | |
hsa-miR-9-3p | ovarian cancer | worse prognosis; progression; poor survival; drug resistance | "miR 9 regulation of BRCA1 and ovarian cancer sensi ......" | 24168967 | Luciferase |
hsa-miR-9-3p | ovarian cancer | tumorigenesis | "By performing real-time polymerase chain reaction ......" | 25846738 | |
hsa-miR-9-3p | ovarian cancer | staging; poor survival; drug resistance | "Methylation associated Has miR 9 deregulation in p ......" | 26152689 | Western blot; Luciferase; RNAi |
hsa-miR-9-3p | prostate cancer | metastasis; progression | "miR 9 Acts as an OncomiR in Prostate Cancer throug ......" | 27447934 | |
hsa-miR-9-3p | sarcoma | worse prognosis; staging; metastasis; tumor size; poor survival; progression | "The purpose of the present study was to examine th ......" | 24969351 | |
hsa-miR-9-3p | sarcoma | malignant trasformation | "MiR 9 is overexpressed in spontaneous canine osteo ......" | 27724924 | Western blot |
hsa-miR-9-3p | thyroid cancer | recurrence | "MiR 9 and miR 21 as prognostic biomarkers for recu ......" | 26007293 |
Reported gene related to hsa-miR-9-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-9-3p | breast cancer | CDH1 | "Expression of miR-9 was also higher in tumors show ......" | 25086633 |
hsa-miR-9-3p | breast cancer | CDH1 | "We investigated the expressions of miR-9 and miR-2 ......" | 23617747 |
hsa-miR-9-3p | colon cancer | CDH1 | "Prospero homeobox 1 promotes epithelial mesenchyma ......" | 23045246 |
hsa-miR-9-3p | esophageal cancer | CDH1 | "Taken together our study demonstrates that miR-9 p ......" | 25375090 |
hsa-miR-9-3p | lung squamous cell cancer | CDH1 | "miR-9 family members miR-9s including miR-9-1 9-2 ......" | 24649145 |
hsa-miR-9-3p | melanoma | CDH1 | "miR-9 overexpression induced significant down-regu ......" | 22131135 |
hsa-miR-9-3p | prostate cancer | CDH1 | "Analysis showed that miR-9 targets e-cadherin and ......" | 27447934 |
hsa-miR-9-3p | sarcoma | CDH1 | "Transient transfection of RMS cells with a miR-200 ......" | 23000453 |
hsa-miR-9-3p | breast cancer | MYC | "Consistent with miR-9-3p having synthetic enhancer ......" | 23530058 |
hsa-miR-9-3p | lung cancer | MYC | "We elected to validate our model in vitro by testi ......" | 23365639 |
hsa-miR-9-3p | lymphoma | MYC | "Finally we showed that hsa-miR-9* is able to modul ......" | 20930934 |
hsa-miR-9-3p | lung cancer | DICER1 | "A modest decrease in Drosha and Dicer mRNA levels ......" | 23296057 |
hsa-miR-9-3p | lymphoma | DICER1 | "Inhibition of miR 9 de represses HuR and DICER1 an ......" | 22310293 |
hsa-miR-9-3p | breast cancer | FOXO1 | "In this study we explored whether FOXO1 3'UTR can ......" | 25017439 |
hsa-miR-9-3p | ovarian cancer | FOXO1 | "Phosphorylation of Akt and forkhead box protein O1 ......" | 24870723 |
hsa-miR-9-3p | gastric cancer | RAB34 | "GRB2 and RAB34 targets of miR-433 and miR-9 respec ......" | 19531230 |
hsa-miR-9-3p | ovarian cancer | RAB34 | "RAB34 was validated as a direct target of miR-9 ......" | 23627607 |
hsa-miR-9-3p | liver cancer | TLN1 | "Talin-1 which plays a significant role in regulati ......" | 26770365 |
hsa-miR-9-3p | ovarian cancer | TLN1 | "miR 9 functions as a tumor suppressor in ovarian s ......" | 23722670 |
hsa-miR-9-3p | glioblastoma | ABCG2 | "MiR-9 mediated increases in the drug efflux transp ......" | 25595896 |
hsa-miR-9-3p | bladder cancer | BCL2 | "LASS2 transfection downregulated Bcl-2 and survivi ......" | 26150338 |
hsa-miR-9-3p | lymphoma | BCL6 | "Expression pattern of hsa miR 9 and its associatio ......" | 23688983 |
hsa-miR-9-3p | ovarian cancer | BRCA1 | "miR 9 regulation of BRCA1 and ovarian cancer sensi ......" | 24168967 |
hsa-miR-9-3p | ovarian cancer | CASP3 | "In contrast overexpression of miR-9 significantly ......" | 24870723 |
hsa-miR-9-3p | lung cancer | CCL21 | "Besides MIR-142-5p and miR-9 may be utilized to tr ......" | 24338464 |
hsa-miR-9-3p | breast cancer | CCL27 | "Interestingly miR-9 levels were elevated in invasi ......" | 22489664 |
hsa-miR-9-3p | sarcoma | CCNDBP1 | "miR 9 Modulates Osteosarcoma Cell Growth by Target ......" | 26107195 |
hsa-miR-9-3p | ovarian cancer | CCNG1 | "CCNG1 validated as a direct target of miR-9 mediat ......" | 26152689 |
hsa-miR-9-3p | gastric cancer | CDX2 | "MiR 9 downregulates CDX2 expression in gastric can ......" | 21225631 |
hsa-miR-9-3p | bladder cancer | CERS2 | "miR 9 promotes cell proliferation and inhibits apo ......" | 26150338 |
hsa-miR-9-3p | B cell lymphoma | CHRDL1 | "To investigate the expression of miR-9 in B lympho ......" | 21569708 |
hsa-miR-9-3p | liver cancer | CLIC4 | "Inversely treatment of miR-9-3p inhibitor accelera ......" | 26125451 |
hsa-miR-9-3p | gastric cancer | CUL4A | "Interestingly CUL4A expression was inhibited by th ......" | 26840256 |
hsa-miR-9-3p | lung cancer | DROSHA | "A modest decrease in Drosha and Dicer mRNA levels ......" | 23296057 |
hsa-miR-9-3p | lymphoma | E2F1 | "Finally we showed that hsa-miR-9* is able to modul ......" | 20930934 |
hsa-miR-9-3p | lung cancer | EGFR | "We elected to validate our model in vitro by testi ......" | 23365639 |
hsa-miR-9-3p | lymphoma | ELAVL1 | "Inhibition of miR 9 de represses HuR and DICER1 an ......" | 22310293 |
hsa-miR-9-3p | breast cancer | ESR1 | "Higher expression of miR-9 was significantly assoc ......" | 22723919 |
hsa-miR-9-3p | glioblastoma | FOXP1 | "Silencing of FOXP1 a miR-9 target inhibits ΔEGFR- ......" | 24436148 |
hsa-miR-9-3p | gastric cancer | GRB2 | "GRB2 and RAB34 targets of miR-433 and miR-9 respec ......" | 19531230 |
hsa-miR-9-3p | sarcoma | GSN | "Proteomic and transcriptional profiling of normal ......" | 27724924 |
hsa-miR-9-3p | acute myeloid leukemia | HES1 | "Our results showed that the level of either Hes1 o ......" | 26678889 |
hsa-miR-9-3p | lymphoma | HGS | "Our studies here demonstrate that PRDM1/blimp-1 is ......" | 18583325 |
hsa-miR-9-3p | liver cancer | HLF | "Treatment of miR-9-3p mimic inhibited cell prolife ......" | 26125451 |
hsa-miR-9-3p | lymphoma | HOXB7 | "This included NFκB1 and hsa-miR-9 hsa-miR-196a-1 ......" | 24145479 |
hsa-miR-9-3p | gastric cancer | IBSP | "Bisulfite genomic sequencing PCR BSP was performed ......" | 25270964 |
hsa-miR-9-3p | prostate cancer | ICA1 | "miR-9 was identified as an oncomiR through both mi ......" | 27447934 |
hsa-miR-9-3p | ovarian cancer | IGKV2D-40 | "Phosphorylation of Akt and forkhead box protein O1 ......" | 24870723 |
hsa-miR-9-3p | liver cancer | KLF17 | "In addition miR-9 downregulated KLF17 protein expr ......" | 23684102 |
hsa-miR-9-3p | ovarian cancer | LSS | "The downregulation of microRNA-9 miR-9 has been re ......" | 23722670 |
hsa-miR-9-3p | sarcoma | MALAT1 | "The observation of upregulation of miR-9 after a h ......" | 25592968 |
hsa-miR-9-3p | glioblastoma | MAPK14 | "hsa miR 9 controls the mobility behavior of gliobl ......" | 27036038 |
hsa-miR-9-3p | breast cancer | MTHFD2 | "Among these MTHFD2 was identified as a miR-9 targe ......" | 22761433 |
hsa-miR-9-3p | lung cancer | NKIRAS1 | "Besides a statistically significant negative corre ......" | 23156677 |
hsa-miR-9-3p | ovarian cancer | PARP1 | "In contrast overexpression of miR-9 significantly ......" | 24870723 |
hsa-miR-9-3p | colon cancer | PROX1 | "Prospero homeobox 1 promotes epithelial mesenchyma ......" | 23045246 |
hsa-miR-9-3p | glioblastoma | PTCH1 | "Computational studies real-time PCR reporter gene ......" | 25595896 |
hsa-miR-9-3p | melanoma | RYBP | "Finally the post-transcriptional regulation of miR ......" | 26104682 |
hsa-miR-9-3p | glioblastoma | SHH | "Computational studies real-time PCR reporter gene ......" | 25595896 |
hsa-miR-9-3p | melanoma | SNAI1 | "miR-9 overexpression induced significant down-regu ......" | 22131135 |
hsa-miR-9-3p | prostate cancer | SOCS5 | "Analysis showed that miR-9 targets e-cadherin and ......" | 27447934 |
hsa-miR-9-3p | glioblastoma | STAT3 | "Foremost among these is miR-9 which suppresses mes ......" | 21385897 |
hsa-miR-9-3p | liver cancer | TAZ | "miR 9 3p plays a tumour suppressor role by targeti ......" | 26125451 |
hsa-miR-9-3p | colorectal cancer | TM4SF1 | "We analyzed 60 colon cancers and paired normal spe ......" | 26983891 |
hsa-miR-9-3p | breast cancer | TP53 | "Furthermore pathways in cancer p53 signaling pathw ......" | 27725294 |
hsa-miR-9-3p | colorectal cancer | UHRF1 | "Here we showed that compared with corresponding no ......" | 25940709 |
hsa-miR-9-3p | breast cancer | VIM | "Expression of miR-9 was also higher in tumors show ......" | 25086633 |
hsa-miR-9-3p | liver cancer | WWTR1 | "miR 9 3p plays a tumour suppressor role by targeti ......" | 26125451 |
hsa-miR-9-3p | melanoma | YY1 | "Quantitative RT-PCR analysis was used to determine ......" | 26104682 |
hsa-miR-9-3p | liver cancer | ZFAS1 | "Finally the relationship between ZNFX1-AS1 and miR ......" | 27574442 |
Expression profile in cancer corhorts: