microRNA information: hsa-miR-9-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-9-5p | miRbase |
Accession: | MIMAT0000441 | miRbase |
Precursor name: | hsa-mir-9-1 | miRbase |
Precursor accession: | MI0000466 | miRbase |
Symbol: | MIR9-1 | HGNC |
RefSeq ID: | NR_029691 | GenBank |
Sequence: | UCUUUGGUUAUCUAGCUGUAUGA |
Reported expression in cancers: hsa-miR-9-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-9-5p | acute myeloid leukemia | upregulation | "By multivariate analysis we identified that high e ......" | 25428263 | |
hsa-miR-9-5p | bladder cancer | upregulation | "The present study aims to identify the expression ......" | 26150338 | |
hsa-miR-9-5p | breast cancer | upregulation | "Some miRNAs especially the miR-200 family miR-9 an ......" | 25086633 | qPCR |
hsa-miR-9-5p | breast cancer | downregulation | "Aberrant expression of miR 9 in benign and maligna ......" | 27725294 | qPCR |
hsa-miR-9-5p | cervical and endocervical cancer | upregulation | "Molecular identification of miR 145 and miR 9 expr ......" | 27345415 | qPCR |
hsa-miR-9-5p | colon cancer | downregulation | "Among the miRNAs demonstrating the largest fold up ......" | 21694772 | |
hsa-miR-9-5p | colon cancer | downregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
hsa-miR-9-5p | colorectal cancer | deregulation | "Real time-polymerase chain reaction was used to an ......" | 26867319 | qPCR |
hsa-miR-9-5p | esophageal cancer | upregulation | "Deregulation of MicroRNA-9 miR-9 has been document ......" | 25375090 | |
hsa-miR-9-5p | gastric cancer | downregulation | "Down regulated miR 9 and miR 433 in human gastric ......" | 19531230 | qPCR |
hsa-miR-9-5p | gastric cancer | downregulation | "Aberrant hypermethylation of miR 9 genes in gastri ......" | 21931274 | |
hsa-miR-9-5p | gastric cancer | downregulation | "Compared with the expression levels in the normal ......" | 25013480 | |
hsa-miR-9-5p | gastric cancer | downregulation | "Real-time quantitative PCR RTQ-PCR was employed to ......" | 25270964 | qPCR |
hsa-miR-9-5p | liver cancer | upregulation | "Up regulation of miR 9 expression predicate advanc ......" | 25552204 | qPCR |
hsa-miR-9-5p | liver cancer | downregulation | "MicroRNA-9 miR-9 dysregulation is implicated in a ......" | 26547929 | Microarray; qPCR |
hsa-miR-9-5p | lung cancer | deregulation | "Therefore we conduct to systematically identify mi ......" | 26870998 | Microarray |
hsa-miR-9-5p | lung squamous cell cancer | upregulation | "Up regulation of miR 9 expression as a poor progno ......" | 24019037 | qPCR |
hsa-miR-9-5p | melanoma | downregulation | "Hsa-miR-9 has been shown to have opposite function ......" | 22131135 | |
hsa-miR-9-5p | ovarian cancer | downregulation | "Ovarian cancer tissues display significantly low e ......" | 19702828 | |
hsa-miR-9-5p | ovarian cancer | downregulation | "Methylation associated Has miR 9 deregulation in p ......" | 26152689 | |
hsa-miR-9-5p | prostate cancer | upregulation | "Significantly a subset of miRNAs miR-9 miR-25 miR- ......" | 24135225 |
Reported cancer pathway affected by hsa-miR-9-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-9-5p | acute myeloid leukemia | Apoptosis pathway | "Our results showed that the level of either Hes1 o ......" | 26678889 | |
hsa-miR-9-5p | bladder cancer | Apoptosis pathway; cell cycle pathway | "miR 9 promotes cell proliferation and inhibits apo ......" | 26150338 | Luciferase |
hsa-miR-9-5p | breast cancer | Epithelial mesenchymal transition pathway | "Global miRNA expression profiling was performed on ......" | 22294488 | |
hsa-miR-9-5p | breast cancer | Epithelial mesenchymal transition pathway | "Some miRNAs especially the miR-200 family miR-9 an ......" | 25086633 | |
hsa-miR-9-5p | breast cancer | Apoptosis pathway | "Based on the results obtained in the last decade s ......" | 26199650 | |
hsa-miR-9-5p | breast cancer | cell cycle pathway | "Performing qPCR we identified eight miRs different ......" | 27152840 | |
hsa-miR-9-5p | breast cancer | p53 signaling pathway | "Aberrant expression of miR 9 in benign and maligna ......" | 27725294 | |
hsa-miR-9-5p | colon cancer | Epithelial mesenchymal transition pathway | "Prospero homeobox 1 promotes epithelial mesenchyma ......" | 23045246 | |
hsa-miR-9-5p | colorectal cancer | Apoptosis pathway | "Here we showed that compared with corresponding no ......" | 25940709 | Luciferase |
hsa-miR-9-5p | esophageal cancer | Epithelial mesenchymal transition pathway | "Deregulation of MicroRNA-9 miR-9 has been document ......" | 25375090 | |
hsa-miR-9-5p | gastric cancer | Hippo signaling pathway | "Cullin 4A CUL4A a direct target of miR 9 and miR 1 ......" | 26840256 | |
hsa-miR-9-5p | liver cancer | Apoptosis pathway | "Long noncoding RNA ZNFX1 AS1 suppresses growth of ......" | 27574442 | MTT assay; Colony formation |
hsa-miR-9-5p | lung cancer | Epithelial mesenchymal transition pathway | "Specifically let-7 and miR-9 are deregulated in bo ......" | 23365639 | |
hsa-miR-9-5p | lung cancer | cell cycle pathway | "MIR 142 5p and miR 9 may be involved in squamous l ......" | 24338464 | |
hsa-miR-9-5p | lung squamous cell cancer | Apoptosis pathway | "Demethylation of miR 9 3 and miR 193a genes suppre ......" | 24356455 | Flow cytometry; Western blot |
hsa-miR-9-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "miR-9 family members miR-9s including miR-9-1 9-2 ......" | 24649145 | |
hsa-miR-9-5p | lymphoma | Apoptosis pathway | "Expression pattern of hsa miR 9 and its associatio ......" | 23688983 | Western blot; Flow cytometry |
hsa-miR-9-5p | melanoma | cell cycle pathway | "Quantitative RT-PCR analysis was used to determine ......" | 26104682 | Luciferase |
hsa-miR-9-5p | ovarian cancer | Apoptosis pathway | "SKOV3 ovarian cancer cells were treated with curcu ......" | 24870723 | Western blot |
hsa-miR-9-5p | sarcoma | Apoptosis pathway; Epithelial mesenchymal transition pathway | "17β estradiol regulates cell proliferation colony ......" | 25592968 | Colony formation |
hsa-miR-9-5p | sarcoma | Apoptosis pathway | "MiR 9 is overexpressed in spontaneous canine osteo ......" | 27724924 | Western blot |
Reported cancer prognosis affected by hsa-miR-9-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-9-5p | acute myeloid leukemia | poor survival | "Our results showed that the level of either Hes1 o ......" | 26678889 | |
hsa-miR-9-5p | bladder cancer | staging; poor survival; recurrence | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
hsa-miR-9-5p | bladder cancer | progression; drug resistance; malignant trasformation | "miR 9 promotes cell proliferation and inhibits apo ......" | 26150338 | Luciferase |
hsa-miR-9-5p | bladder cancer | drug resistance | "Focusing on the major obstacle regarding MIBC pati ......" | 27586262 | |
hsa-miR-9-5p | breast cancer | metastasis; staging; progression | "Global miRNA expression profiling was performed on ......" | 22294488 | |
hsa-miR-9-5p | breast cancer | metastasis | "The clinico pathologic role of microRNAs miR 9 and ......" | 22489664 | |
hsa-miR-9-5p | breast cancer | poor survival | "Eight candidate miRs that showed significant diffe ......" | 22723919 | |
hsa-miR-9-5p | breast cancer | metastasis | "The aim of this study was to investigate the relat ......" | 23617747 | |
hsa-miR-9-5p | breast cancer | metastasis | "In this study we explored whether FOXO1 3'UTR can ......" | 25017439 | |
hsa-miR-9-5p | breast cancer | poor survival; progression; worse prognosis | "Some miRNAs especially the miR-200 family miR-9 an ......" | 25086633 | |
hsa-miR-9-5p | breast cancer | drug resistance | "Besides several miRNAs e.g miR-375 were enriched i ......" | 25680412 | |
hsa-miR-9-5p | breast cancer | metastasis; worse prognosis; drug resistance | "Based on the results obtained in the last decade s ......" | 26199650 | |
hsa-miR-9-5p | breast cancer | differentiation | "miR 9 and miR 200 Regulate PDGFRβ Mediated Endoth ......" | 27402080 | |
hsa-miR-9-5p | breast cancer | malignant trasformation; progression | "Aberrant expression of miR 9 in benign and maligna ......" | 27725294 | |
hsa-miR-9-5p | cervical and endocervical cancer | poor survival | "Using an established PCR-based miRNA assay to anal ......" | 20124485 | |
hsa-miR-9-5p | cervical and endocervical cancer | cell migration; motility | "Activation of miR 9 by human papillomavirus in cer ......" | 25344913 | |
hsa-miR-9-5p | cervical and endocervical cancer | staging; metastasis; poor survival | "Molecular identification of miR 145 and miR 9 expr ......" | 27345415 | |
hsa-miR-9-5p | colon cancer | poor survival; tumorigenesis | "MiR 9 31 and 182 deregulation promote proliferatio ......" | 23019418 | |
hsa-miR-9-5p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
hsa-miR-9-5p | colorectal cancer | metastasis | "Treatment with a DNA methyltransferase inhibitor a ......" | 19521961 | |
hsa-miR-9-5p | colorectal cancer | metastasis; motility | "Human microRNA-9 miR-9 has been reported to be inv ......" | 21562850 | Cell migration assay; Western blot |
hsa-miR-9-5p | colorectal cancer | metastasis | "We analyzed 60 colon cancers and paired normal spe ......" | 26983891 | Luciferase |
hsa-miR-9-5p | endometrial cancer | malignant trasformation | "Expression profiling of normal and malignant endom ......" | 20028871 | |
hsa-miR-9-5p | esophageal cancer | metastasis; progression; poor survival; cell migration | "Deregulation of MicroRNA-9 miR-9 has been document ......" | 25375090 | |
hsa-miR-9-5p | gastric cancer | progression | "Aberrant hypermethylation of miR 9 genes in gastri ......" | 21931274 | |
hsa-miR-9-5p | gastric cancer | progression; metastasis | "Recent evidence shows that altered microRNA-9 miR- ......" | 23383271 | Luciferase |
hsa-miR-9-5p | gastric cancer | staging; worse prognosis | "Overexpression of activated leukocute cell adhesio ......" | 25395097 | |
hsa-miR-9-5p | glioblastoma | differentiation | "Foremost among these is miR-9 which suppresses mes ......" | 21385897 | |
hsa-miR-9-5p | glioblastoma | drug resistance | "Computational studies real-time PCR reporter gene ......" | 25595896 | Western blot |
hsa-miR-9-5p | glioblastoma | metastasis; worse prognosis | "hsa miR 9 controls the mobility behavior of gliobl ......" | 27036038 | |
hsa-miR-9-5p | glioblastoma | drug resistance | "High expression of miR 9 in CD133+ glioblastoma ce ......" | 27347493 | |
hsa-miR-9-5p | kidney renal cell cancer | recurrence; poor survival | "Hsa miR 9 methylation status is associated with ca ......" | 20676129 | |
hsa-miR-9-5p | liver cancer | metastasis | "Identification of metastasis related microRNAs of ......" | 19912688 | |
hsa-miR-9-5p | liver cancer | cell migration | "There was also a significantly higher expression o ......" | 23684102 | |
hsa-miR-9-5p | liver cancer | staging; worse prognosis; poor survival | "Up regulation of miR 9 expression predicate advanc ......" | 25552204 | |
hsa-miR-9-5p | liver cancer | poor survival | "Among the seven significant miRNAs six hsa-mir-326 ......" | 26046780 | |
hsa-miR-9-5p | liver cancer | tumor size; progression | "MicroRNA-9 miR-9 dysregulation is implicated in a ......" | 26547929 | Western blot; Luciferase |
hsa-miR-9-5p | liver cancer | progression; tumorigenesis; worse prognosis; malignant trasformation; poor survival | "MicroRNA-9 miR-9 is known to play an important rol ......" | 26770365 | Western blot |
hsa-miR-9-5p | liver cancer | progression | "Long noncoding RNA ZNFX1 AS1 suppresses growth of ......" | 27574442 | MTT assay; Colony formation |
hsa-miR-9-5p | lung cancer | metastasis | "Moreover expression levels of 84 tumor metastasis- ......" | 23296057 | |
hsa-miR-9-5p | lung squamous cell cancer | staging; malignant trasformation | "Genome wide miRNA expression profiling identifies ......" | 22282464 | |
hsa-miR-9-5p | lung squamous cell cancer | worse prognosis; staging; metastasis; tumor size; progression; poor survival | "Up regulation of miR 9 expression as a poor progno ......" | 24019037 | |
hsa-miR-9-5p | lung squamous cell cancer | poor survival | "miR-9 family members miR-9s including miR-9-1 9-2 ......" | 24649145 | |
hsa-miR-9-5p | lung squamous cell cancer | metastasis | "The differentially expressed microRNAs associated ......" | 25628919 | |
hsa-miR-9-5p | lung squamous cell cancer | metastasis | "Expression of miR-9 miR-10b miR-145 and miR-155 4 ......" | 26909466 | |
hsa-miR-9-5p | lung squamous cell cancer | drug resistance | "Associating drug response with micro-RNA expressio ......" | 27247353 | |
hsa-miR-9-5p | melanoma | metastasis; progression | "Hsa-miR-9 has been shown to have opposite function ......" | 22131135 | |
hsa-miR-9-5p | melanoma | metastasis; cell migration | "MicroRNAs miRNAs have been implicated in the regul ......" | 22825752 | |
hsa-miR-9-5p | melanoma | metastasis | "Six microRNAs miR-9 miR-145 miR-150 miR-155 miR-20 ......" | 23863473 | |
hsa-miR-9-5p | melanoma | progression | "Quantitative RT-PCR analysis was used to determine ......" | 26104682 | Luciferase |
hsa-miR-9-5p | ovarian cancer | poor survival | "Deregulated miRNAs identified by miRNA microarray ......" | 23627607 | Western blot; Luciferase |
hsa-miR-9-5p | ovarian cancer | metastasis; progression | "miR 9 functions as a tumor suppressor in ovarian s ......" | 23722670 | |
hsa-miR-9-5p | ovarian cancer | worse prognosis; progression; poor survival; drug resistance | "miR 9 regulation of BRCA1 and ovarian cancer sensi ......" | 24168967 | Luciferase |
hsa-miR-9-5p | ovarian cancer | tumorigenesis | "By performing real-time polymerase chain reaction ......" | 25846738 | |
hsa-miR-9-5p | ovarian cancer | staging; poor survival; drug resistance | "Methylation associated Has miR 9 deregulation in p ......" | 26152689 | Western blot; Luciferase; RNAi |
hsa-miR-9-5p | prostate cancer | metastasis; progression | "miR 9 Acts as an OncomiR in Prostate Cancer throug ......" | 27447934 | |
hsa-miR-9-5p | sarcoma | worse prognosis; staging; metastasis; tumor size; poor survival; progression | "The purpose of the present study was to examine th ......" | 24969351 | |
hsa-miR-9-5p | sarcoma | malignant trasformation | "MiR 9 is overexpressed in spontaneous canine osteo ......" | 27724924 | Western blot |
hsa-miR-9-5p | thyroid cancer | recurrence | "MiR 9 and miR 21 as prognostic biomarkers for recu ......" | 26007293 |
Reported gene related to hsa-miR-9-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-9-5p | breast cancer | CDH1 | "Expression of miR-9 was also higher in tumors show ......" | 25086633 |
hsa-miR-9-5p | breast cancer | CDH1 | "We investigated the expressions of miR-9 and miR-2 ......" | 23617747 |
hsa-miR-9-5p | colon cancer | CDH1 | "Prospero homeobox 1 promotes epithelial mesenchyma ......" | 23045246 |
hsa-miR-9-5p | esophageal cancer | CDH1 | "Taken together our study demonstrates that miR-9 p ......" | 25375090 |
hsa-miR-9-5p | lung squamous cell cancer | CDH1 | "miR-9 family members miR-9s including miR-9-1 9-2 ......" | 24649145 |
hsa-miR-9-5p | melanoma | CDH1 | "miR-9 overexpression induced significant down-regu ......" | 22131135 |
hsa-miR-9-5p | prostate cancer | CDH1 | "Analysis showed that miR-9 targets e-cadherin and ......" | 27447934 |
hsa-miR-9-5p | sarcoma | CDH1 | "Transient transfection of RMS cells with a miR-200 ......" | 23000453 |
hsa-miR-9-5p | lung cancer | DICER1 | "A modest decrease in Drosha and Dicer mRNA levels ......" | 23296057 |
hsa-miR-9-5p | lymphoma | DICER1 | "Inhibition of miR 9 de represses HuR and DICER1 an ......" | 22310293 |
hsa-miR-9-5p | breast cancer | FOXO1 | "In this study we explored whether FOXO1 3'UTR can ......" | 25017439 |
hsa-miR-9-5p | ovarian cancer | FOXO1 | "Phosphorylation of Akt and forkhead box protein O1 ......" | 24870723 |
hsa-miR-9-5p | gastric cancer | RAB34 | "GRB2 and RAB34 targets of miR-433 and miR-9 respec ......" | 19531230 |
hsa-miR-9-5p | ovarian cancer | RAB34 | "RAB34 was validated as a direct target of miR-9 ......" | 23627607 |
hsa-miR-9-5p | liver cancer | TLN1 | "Talin-1 which plays a significant role in regulati ......" | 26770365 |
hsa-miR-9-5p | ovarian cancer | TLN1 | "miR 9 functions as a tumor suppressor in ovarian s ......" | 23722670 |
hsa-miR-9-5p | glioblastoma | ABCG2 | "MiR-9 mediated increases in the drug efflux transp ......" | 25595896 |
hsa-miR-9-5p | bladder cancer | BCL2 | "LASS2 transfection downregulated Bcl-2 and survivi ......" | 26150338 |
hsa-miR-9-5p | lymphoma | BCL6 | "Expression pattern of hsa miR 9 and its associatio ......" | 23688983 |
hsa-miR-9-5p | ovarian cancer | BRCA1 | "miR 9 regulation of BRCA1 and ovarian cancer sensi ......" | 24168967 |
hsa-miR-9-5p | ovarian cancer | CASP3 | "In contrast overexpression of miR-9 significantly ......" | 24870723 |
hsa-miR-9-5p | lung cancer | CCL21 | "Besides MIR-142-5p and miR-9 may be utilized to tr ......" | 24338464 |
hsa-miR-9-5p | breast cancer | CCL27 | "Interestingly miR-9 levels were elevated in invasi ......" | 22489664 |
hsa-miR-9-5p | sarcoma | CCNDBP1 | "miR 9 Modulates Osteosarcoma Cell Growth by Target ......" | 26107195 |
hsa-miR-9-5p | ovarian cancer | CCNG1 | "CCNG1 validated as a direct target of miR-9 mediat ......" | 26152689 |
hsa-miR-9-5p | gastric cancer | CDX2 | "MiR 9 downregulates CDX2 expression in gastric can ......" | 21225631 |
hsa-miR-9-5p | bladder cancer | CERS2 | "miR 9 promotes cell proliferation and inhibits apo ......" | 26150338 |
hsa-miR-9-5p | B cell lymphoma | CHRDL1 | "To investigate the expression of miR-9 in B lympho ......" | 21569708 |
hsa-miR-9-5p | gastric cancer | CUL4A | "Interestingly CUL4A expression was inhibited by th ......" | 26840256 |
hsa-miR-9-5p | lung cancer | DROSHA | "A modest decrease in Drosha and Dicer mRNA levels ......" | 23296057 |
hsa-miR-9-5p | lung cancer | EGFR | "We elected to validate our model in vitro by testi ......" | 23365639 |
hsa-miR-9-5p | lymphoma | ELAVL1 | "Inhibition of miR 9 de represses HuR and DICER1 an ......" | 22310293 |
hsa-miR-9-5p | breast cancer | ESR1 | "Higher expression of miR-9 was significantly assoc ......" | 22723919 |
hsa-miR-9-5p | glioblastoma | FOXP1 | "Silencing of FOXP1 a miR-9 target inhibits ΔEGFR- ......" | 24436148 |
hsa-miR-9-5p | gastric cancer | GRB2 | "GRB2 and RAB34 targets of miR-433 and miR-9 respec ......" | 19531230 |
hsa-miR-9-5p | sarcoma | GSN | "Proteomic and transcriptional profiling of normal ......" | 27724924 |
hsa-miR-9-5p | acute myeloid leukemia | HES1 | "Our results showed that the level of either Hes1 o ......" | 26678889 |
hsa-miR-9-5p | lymphoma | HGS | "Our studies here demonstrate that PRDM1/blimp-1 is ......" | 18583325 |
hsa-miR-9-5p | lymphoma | HOXB7 | "This included NFκB1 and hsa-miR-9 hsa-miR-196a-1 ......" | 24145479 |
hsa-miR-9-5p | gastric cancer | IBSP | "Bisulfite genomic sequencing PCR BSP was performed ......" | 25270964 |
hsa-miR-9-5p | prostate cancer | ICA1 | "miR-9 was identified as an oncomiR through both mi ......" | 27447934 |
hsa-miR-9-5p | ovarian cancer | IGKV2D-40 | "Phosphorylation of Akt and forkhead box protein O1 ......" | 24870723 |
hsa-miR-9-5p | liver cancer | KLF17 | "In addition miR-9 downregulated KLF17 protein expr ......" | 23684102 |
hsa-miR-9-5p | ovarian cancer | LSS | "The downregulation of microRNA-9 miR-9 has been re ......" | 23722670 |
hsa-miR-9-5p | sarcoma | MALAT1 | "The observation of upregulation of miR-9 after a h ......" | 25592968 |
hsa-miR-9-5p | glioblastoma | MAPK14 | "hsa miR 9 controls the mobility behavior of gliobl ......" | 27036038 |
hsa-miR-9-5p | breast cancer | MTHFD2 | "Among these MTHFD2 was identified as a miR-9 targe ......" | 22761433 |
hsa-miR-9-5p | lung cancer | MYC | "We elected to validate our model in vitro by testi ......" | 23365639 |
hsa-miR-9-5p | lung cancer | NKIRAS1 | "Besides a statistically significant negative corre ......" | 23156677 |
hsa-miR-9-5p | ovarian cancer | PARP1 | "In contrast overexpression of miR-9 significantly ......" | 24870723 |
hsa-miR-9-5p | colon cancer | PROX1 | "Prospero homeobox 1 promotes epithelial mesenchyma ......" | 23045246 |
hsa-miR-9-5p | glioblastoma | PTCH1 | "Computational studies real-time PCR reporter gene ......" | 25595896 |
hsa-miR-9-5p | melanoma | RYBP | "Finally the post-transcriptional regulation of miR ......" | 26104682 |
hsa-miR-9-5p | glioblastoma | SHH | "Computational studies real-time PCR reporter gene ......" | 25595896 |
hsa-miR-9-5p | melanoma | SNAI1 | "miR-9 overexpression induced significant down-regu ......" | 22131135 |
hsa-miR-9-5p | prostate cancer | SOCS5 | "Analysis showed that miR-9 targets e-cadherin and ......" | 27447934 |
hsa-miR-9-5p | glioblastoma | STAT3 | "Foremost among these is miR-9 which suppresses mes ......" | 21385897 |
hsa-miR-9-5p | liver cancer | TAZ | "miR 9 3p plays a tumour suppressor role by targeti ......" | 26125451 |
hsa-miR-9-5p | lung squamous cell cancer | TGFBR2 | "Follow-up experiments showed two miRNAs miR-9-5p a ......" | 25024357 |
hsa-miR-9-5p | colorectal cancer | TM4SF1 | "We analyzed 60 colon cancers and paired normal spe ......" | 26983891 |
hsa-miR-9-5p | breast cancer | TP53 | "Furthermore pathways in cancer p53 signaling pathw ......" | 27725294 |
hsa-miR-9-5p | colorectal cancer | UHRF1 | "Here we showed that compared with corresponding no ......" | 25940709 |
hsa-miR-9-5p | breast cancer | VIM | "Expression of miR-9 was also higher in tumors show ......" | 25086633 |
hsa-miR-9-5p | liver cancer | WWTR1 | "miR 9 3p plays a tumour suppressor role by targeti ......" | 26125451 |
hsa-miR-9-5p | melanoma | YY1 | "Quantitative RT-PCR analysis was used to determine ......" | 26104682 |
hsa-miR-9-5p | liver cancer | ZFAS1 | "Finally the relationship between ZNFX1-AS1 and miR ......" | 27574442 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-9-5p | CD34 | 11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; PRAD; SARC; UCEC | miRNAWalker2 validate | TCGA BLCA -0.092; TCGA BRCA -0.112; TCGA CESC -0.06; TCGA ESCA -0.106; TCGA KIRC -0.068; TCGA LGG -0.328; TCGA LUAD -0.136; TCGA LUSC -0.265; TCGA PRAD -0.056; TCGA SARC -0.093; TCGA UCEC -0.061 |
hsa-miR-9-5p | CXXC5 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LUSC; OV; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.104; TCGA BRCA -0.144; TCGA ESCA -0.136; TCGA HNSC -0.121; TCGA KIRP -0.054; TCGA LGG -0.138; TCGA LUSC -0.128; TCGA OV -0.106; TCGA THCA -0.124; TCGA UCEC -0.161 |
hsa-miR-9-5p | ETS1 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PRAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.102; TCGA CESC -0.109; TCGA ESCA -0.159; TCGA HNSC -0.142; TCGA KIRC -0.094; TCGA LUAD -0.097; TCGA LUSC -0.293; TCGA OV -0.099; TCGA PRAD -0.093; TCGA UCEC -0.078 |
hsa-miR-9-5p | FLNB | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; OV; PAAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.082; TCGA BRCA -0.063; TCGA CESC -0.063; TCGA ESCA -0.158; TCGA HNSC -0.119; TCGA LGG -0.224; TCGA OV -0.069; TCGA PAAD -0.189; TCGA STAD -0.125 |
hsa-miR-9-5p | FOXO1 | 10 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.082; TCGA BRCA -0.099; TCGA HNSC -0.109; TCGA LGG -0.239; TCGA LIHC -0.16; TCGA LUAD -0.121; TCGA LUSC -0.102; TCGA OV -0.076; TCGA PRAD -0.058; TCGA UCEC -0.091 |
hsa-miR-9-5p | FSTL3 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; OV; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.109; TCGA BRCA -0.167; TCGA CESC -0.089; TCGA HNSC -0.224; TCGA KIRC -0.078; TCGA LGG -0.277; TCGA LUAD -0.086; TCGA LUSC -0.26; TCGA OV -0.139; TCGA THCA -0.148; TCGA UCEC -0.169 |
hsa-miR-9-5p | HLA-A | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; SARC | miRNAWalker2 validate | TCGA BLCA -0.06; TCGA CESC -0.114; TCGA ESCA -0.135; TCGA HNSC -0.1; TCGA KIRC -0.135; TCGA KIRP -0.082; TCGA LGG -0.353; TCGA LUSC -0.128; TCGA SARC -0.158 |
hsa-miR-9-5p | KCNJ15 | 9 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA | miRNAWalker2 validate | TCGA BLCA -0.141; TCGA HNSC -0.317; TCGA KIRC -0.137; TCGA KIRP -0.071; TCGA LUAD -0.216; TCGA LUSC -0.275; TCGA PRAD -0.182; TCGA SARC -0.189; TCGA THCA -0.085 |
hsa-miR-9-5p | KLRK1 | 9 cancers: BLCA; BRCA; CESC; KIRC; LUAD; LUSC; OV; SARC; UCEC | miRNAWalker2 validate | TCGA BLCA -0.126; TCGA BRCA -0.052; TCGA CESC -0.173; TCGA KIRC -0.12; TCGA LUAD -0.056; TCGA LUSC -0.237; TCGA OV -0.212; TCGA SARC -0.249; TCGA UCEC -0.168 |
hsa-miR-9-5p | LPXN | 9 cancers: BLCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; OV; SARC | miRNAWalker2 validate | TCGA BLCA -0.107; TCGA CESC -0.084; TCGA ESCA -0.086; TCGA KIRC -0.053; TCGA LGG -0.197; TCGA LUAD -0.1; TCGA LUSC -0.276; TCGA OV -0.086; TCGA SARC -0.151 |
hsa-miR-9-5p | MYLK | 9 cancers: BLCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.171; TCGA HNSC -0.067; TCGA LGG -0.718; TCGA LIHC -0.104; TCGA LUAD -0.1; TCGA LUSC -0.193; TCGA OV -0.096; TCGA PRAD -0.143; TCGA UCEC -0.12 |
hsa-miR-9-5p | OPTN | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; SARC; UCEC | miRNAWalker2 validate; MirTarget | TCGA BLCA -0.067; TCGA CESC -0.09; TCGA ESCA -0.087; TCGA HNSC -0.114; TCGA KIRC -0.059; TCGA KIRP -0.068; TCGA LGG -0.229; TCGA LUSC -0.078; TCGA SARC -0.12; TCGA UCEC -0.141 |
hsa-miR-9-5p | POU2F2 | 9 cancers: BLCA; CESC; ESCA; KIRC; LGG; LUSC; PRAD; SARC; UCEC | miRNAWalker2 validate; mirMAP; miRNATAP | TCGA BLCA -0.092; TCGA CESC -0.084; TCGA ESCA -0.087; TCGA KIRC -0.088; TCGA LGG -0.249; TCGA LUSC -0.154; TCGA PRAD -0.114; TCGA SARC -0.115; TCGA UCEC -0.08 |
hsa-miR-9-5p | PQLC3 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUSC; OV; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.076; TCGA BRCA -0.083; TCGA CESC -0.065; TCGA ESCA -0.08; TCGA HNSC -0.06; TCGA LGG -0.674; TCGA LUSC -0.084; TCGA OV -0.065; TCGA SARC -0.059; TCGA STAD -0.084; TCGA UCEC -0.075 |
hsa-miR-9-5p | SLC22A3 | 9 cancers: BLCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; OV; UCEC | miRNAWalker2 validate | TCGA BLCA -0.188; TCGA CESC -0.212; TCGA ESCA -0.264; TCGA HNSC -0.445; TCGA LIHC -0.171; TCGA LUAD -0.286; TCGA LUSC -0.48; TCGA OV -0.12; TCGA UCEC -0.235 |
hsa-miR-9-5p | SPI1 | 10 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; SARC; UCEC | miRNAWalker2 validate | TCGA BLCA -0.132; TCGA HNSC -0.062; TCGA KIRC -0.138; TCGA KIRP -0.074; TCGA LGG -0.401; TCGA LUAD -0.105; TCGA LUSC -0.308; TCGA OV -0.143; TCGA SARC -0.239; TCGA UCEC -0.06 |
hsa-miR-9-5p | SYNE1 | 9 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; OV; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.148; TCGA BRCA -0.087; TCGA CESC -0.132; TCGA HNSC -0.104; TCGA LUAD -0.162; TCGA LUSC -0.394; TCGA OV -0.083; TCGA PRAD -0.085; TCGA UCEC -0.161 |
hsa-miR-9-5p | TAGLN | 9 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUSC; OV; SARC; UCEC | miRNAWalker2 validate | TCGA BLCA -0.203; TCGA BRCA -0.061; TCGA CESC -0.113; TCGA HNSC -0.096; TCGA LGG -0.419; TCGA LUSC -0.227; TCGA OV -0.246; TCGA SARC -0.194; TCGA UCEC -0.156 |
hsa-miR-9-5p | TC2N | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUSC; OV; STAD | miRNAWalker2 validate | TCGA BLCA -0.075; TCGA BRCA -0.112; TCGA CESC -0.124; TCGA COAD -0.095; TCGA ESCA -0.186; TCGA LGG -1.288; TCGA LUSC -0.067; TCGA OV -0.129; TCGA STAD -0.158 |
hsa-miR-9-5p | SGMS2 | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.092; TCGA CESC -0.092; TCGA COAD -0.094; TCGA ESCA -0.162; TCGA HNSC -0.169; TCGA KIRP -0.067; TCGA LGG -1.351; TCGA LUAD -0.15; TCGA LUSC -0.353; TCGA OV -0.182; TCGA PAAD -0.105; TCGA PRAD -0.091; TCGA SARC -0.127; TCGA STAD -0.105 |
hsa-miR-9-5p | CRIM1 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.086; TCGA BRCA -0.076; TCGA CESC -0.144; TCGA ESCA -0.103; TCGA HNSC -0.134; TCGA LGG -0.323; TCGA LUAD -0.078; TCGA LUSC -0.113; TCGA OV -0.066; TCGA PRAD -0.104; TCGA STAD -0.07; TCGA UCEC -0.119 |
hsa-miR-9-5p | SLC31A2 | 9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC | MirTarget | TCGA BLCA -0.075; TCGA BRCA -0.054; TCGA HNSC -0.2; TCGA KIRC -0.099; TCGA KIRP -0.081; TCGA LGG -0.361; TCGA LUAD -0.081; TCGA LUSC -0.217; TCGA SARC -0.146 |
hsa-miR-9-5p | TINAGL1 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.142; TCGA CESC -0.158; TCGA COAD -0.118; TCGA ESCA -0.136; TCGA HNSC -0.057; TCGA LIHC -0.092; TCGA LUAD -0.067; TCGA LUSC -0.113; TCGA PRAD -0.088; TCGA SARC -0.127; TCGA THCA -0.091; TCGA STAD -0.094 |
hsa-miR-9-5p | UBL3 | 9 cancers: BLCA; BRCA; CESC; ESCA; LIHC; LUAD; LUSC; OV; THCA | MirTarget | TCGA BLCA -0.056; TCGA BRCA -0.086; TCGA CESC -0.091; TCGA ESCA -0.071; TCGA LIHC -0.055; TCGA LUAD -0.1; TCGA LUSC -0.178; TCGA OV -0.105; TCGA THCA -0.065 |
hsa-miR-9-5p | PDK4 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.112; TCGA BRCA -0.241; TCGA CESC -0.152; TCGA ESCA -0.282; TCGA HNSC -0.201; TCGA LIHC -0.154; TCGA LUAD -0.176; TCGA LUSC -0.5; TCGA THCA -0.154; TCGA UCEC -0.108 |
hsa-miR-9-5p | ITM2B | 9 cancers: BLCA; BRCA; HNSC; LGG; LUAD; LUSC; OV; SARC; UCEC | MirTarget | TCGA BLCA -0.102; TCGA BRCA -0.09; TCGA HNSC -0.076; TCGA LGG -0.109; TCGA LUAD -0.093; TCGA LUSC -0.096; TCGA OV -0.081; TCGA SARC -0.088; TCGA UCEC -0.112 |
hsa-miR-9-5p | IL33 | 9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC | MirTarget | TCGA BLCA -0.246; TCGA BRCA -0.199; TCGA ESCA -0.219; TCGA HNSC -0.247; TCGA KIRC -0.055; TCGA LUAD -0.233; TCGA LUSC -0.471; TCGA PRAD -0.138; TCGA SARC -0.175 |
hsa-miR-9-5p | DENND3 | 10 cancers: BLCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; OV; SARC; UCEC | MirTarget | TCGA BLCA -0.063; TCGA CESC -0.129; TCGA ESCA -0.111; TCGA KIRC -0.073; TCGA LGG -0.433; TCGA LUAD -0.107; TCGA LUSC -0.28; TCGA OV -0.144; TCGA SARC -0.096; TCGA UCEC -0.154 |
hsa-miR-9-5p | SHROOM4 | 11 cancers: BLCA; BRCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.145; TCGA BRCA -0.094; TCGA CESC -0.1; TCGA HNSC -0.063; TCGA LGG -0.215; TCGA LIHC -0.058; TCGA LUAD -0.222; TCGA LUSC -0.342; TCGA PRAD -0.119; TCGA THCA -0.259; TCGA UCEC -0.065 |
hsa-miR-9-5p | MEF2C | 10 cancers: BLCA; BRCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.089; TCGA BRCA -0.051; TCGA HNSC -0.161; TCGA KIRC -0.086; TCGA LGG -0.317; TCGA LUAD -0.121; TCGA LUSC -0.285; TCGA OV -0.097; TCGA PRAD -0.103; TCGA UCEC -0.112 |
hsa-miR-9-5p | PMP22 | 9 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; OV; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.11; TCGA BRCA -0.112; TCGA ESCA -0.108; TCGA HNSC -0.084; TCGA LGG -0.418; TCGA LUAD -0.11; TCGA LUSC -0.252; TCGA OV -0.149; TCGA UCEC -0.085 |
hsa-miR-9-5p | TPK1 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.134; TCGA BRCA -0.089; TCGA CESC -0.165; TCGA ESCA -0.254; TCGA HNSC -0.064; TCGA LGG -0.264; TCGA LUAD -0.163; TCGA LUSC -0.255; TCGA SARC -0.055; TCGA STAD -0.074; TCGA UCEC -0.145 |
hsa-miR-9-5p | NOX4 | 11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; OV; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.081; TCGA BRCA -0.095; TCGA CESC -0.083; TCGA KIRC -0.08; TCGA KIRP -0.095; TCGA LGG -0.584; TCGA OV -0.184; TCGA SARC -0.116; TCGA THCA -0.218; TCGA STAD -0.11; TCGA UCEC -0.069 |
hsa-miR-9-5p | EHD4 | 9 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC | MirTarget | TCGA BLCA -0.058; TCGA BRCA -0.054; TCGA ESCA -0.1; TCGA HNSC -0.119; TCGA LGG -0.612; TCGA LUAD -0.053; TCGA LUSC -0.118; TCGA PRAD -0.051; TCGA SARC -0.082 |
hsa-miR-9-5p | LHFPL2 | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LGG; LUSC; OV; PRAD | MirTarget | TCGA BLCA -0.074; TCGA CESC -0.07; TCGA ESCA -0.089; TCGA HNSC -0.085; TCGA KIRP -0.054; TCGA LGG -0.655; TCGA LUSC -0.17; TCGA OV -0.06; TCGA PRAD -0.062 |
hsa-miR-9-5p | KCTD12 | 10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; LUSC; OV; PRAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.124; TCGA BRCA -0.092; TCGA CESC -0.055; TCGA HNSC -0.152; TCGA LGG -0.482; TCGA LUAD -0.11; TCGA LUSC -0.274; TCGA OV -0.247; TCGA PRAD -0.064; TCGA UCEC -0.23 |
hsa-miR-9-5p | PDGFRB | 10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; LUSC; OV; PRAD; SARC | MirTarget; miRNATAP | TCGA BLCA -0.128; TCGA BRCA -0.096; TCGA CESC -0.077; TCGA HNSC -0.102; TCGA LGG -0.368; TCGA LUAD -0.06; TCGA LUSC -0.172; TCGA OV -0.135; TCGA PRAD -0.057; TCGA SARC -0.139 |
hsa-miR-9-5p | SLC9A1 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.067; TCGA BRCA -0.057; TCGA COAD -0.076; TCGA ESCA -0.105; TCGA HNSC -0.097; TCGA LGG -0.703; TCGA LUAD -0.067; TCGA LUSC -0.052; TCGA SARC -0.067; TCGA THCA -0.059; TCGA STAD -0.076 |
hsa-miR-9-5p | ANO6 | 9 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUSC; PRAD; THCA; UCEC | MirTarget | TCGA BLCA -0.05; TCGA BRCA -0.078; TCGA CESC -0.058; TCGA HNSC -0.11; TCGA LGG -0.559; TCGA LUSC -0.112; TCGA PRAD -0.13; TCGA THCA -0.097; TCGA UCEC -0.078 |
hsa-miR-9-5p | COL4A2 | 10 cancers: BLCA; CESC; HNSC; KIRC; LGG; LUSC; OV; PRAD; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.066; TCGA CESC -0.101; TCGA HNSC -0.056; TCGA KIRC -0.101; TCGA LGG -1.111; TCGA LUSC -0.089; TCGA OV -0.093; TCGA PRAD -0.053; TCGA THCA -0.054; TCGA UCEC -0.063 |
hsa-miR-9-5p | FOXP1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC | MirTarget; miRNATAP | TCGA BLCA -0.061; TCGA BRCA -0.127; TCGA CESC -0.084; TCGA COAD -0.065; TCGA ESCA -0.122; TCGA HNSC -0.073; TCGA LUAD -0.088; TCGA LUSC -0.18; TCGA PAAD -0.075; TCGA SARC -0.078 |
hsa-miR-9-5p | COL15A1 | 9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; OV; PRAD; SARC | MirTarget; miRNATAP | TCGA BLCA -0.143; TCGA BRCA -0.05; TCGA ESCA -0.142; TCGA HNSC -0.057; TCGA KIRC -0.114; TCGA LGG -1.527; TCGA OV -0.072; TCGA PRAD -0.076; TCGA SARC -0.129 |
hsa-miR-9-5p | TMEM63A | 9 cancers: BLCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; LUSC; STAD | MirTarget | TCGA BLCA -0.089; TCGA CESC -0.129; TCGA COAD -0.094; TCGA ESCA -0.222; TCGA KIRP -0.053; TCGA LGG -0.334; TCGA LIHC -0.058; TCGA LUSC -0.067; TCGA STAD -0.141 |
hsa-miR-9-5p | FLRT3 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.144; TCGA BRCA -0.258; TCGA CESC -0.241; TCGA COAD -0.173; TCGA ESCA -0.199; TCGA HNSC -0.631; TCGA LIHC -0.157; TCGA LUAD -0.236; TCGA LUSC -0.494; TCGA THCA -0.154; TCGA STAD -0.132; TCGA UCEC -0.265 |
hsa-miR-9-5p | CBX7 | 9 cancers: BLCA; BRCA; KIRC; LIHC; LUAD; LUSC; OV; SARC; UCEC | MirTarget | TCGA BLCA -0.077; TCGA BRCA -0.131; TCGA KIRC -0.056; TCGA LIHC -0.056; TCGA LUAD -0.148; TCGA LUSC -0.157; TCGA OV -0.11; TCGA SARC -0.088; TCGA UCEC -0.173 |
hsa-miR-9-5p | FLI1 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.069; TCGA BRCA -0.07; TCGA CESC -0.134; TCGA ESCA -0.076; TCGA HNSC -0.062; TCGA KIRC -0.092; TCGA LGG -0.29; TCGA LUAD -0.146; TCGA LUSC -0.341; TCGA OV -0.098; TCGA PRAD -0.052; TCGA UCEC -0.099 |
hsa-miR-9-5p | ZEB2 | 10 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; OV; PRAD; SARC; UCEC | MirTarget | TCGA BLCA -0.11; TCGA BRCA -0.07; TCGA CESC -0.058; TCGA HNSC -0.105; TCGA LUAD -0.119; TCGA LUSC -0.3; TCGA OV -0.139; TCGA PRAD -0.124; TCGA SARC -0.086; TCGA UCEC -0.115 |
hsa-miR-9-5p | THEMIS | 9 cancers: BLCA; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | MirTarget | TCGA BLCA -0.113; TCGA KIRC -0.128; TCGA LGG -0.66; TCGA LUAD -0.098; TCGA LUSC -0.153; TCGA OV -0.219; TCGA PRAD -0.098; TCGA SARC -0.234; TCGA UCEC -0.135 |
hsa-miR-9-5p | SLCO2B1 | 14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | MirTarget | TCGA BLCA -0.16; TCGA BRCA -0.064; TCGA CESC -0.08; TCGA ESCA -0.168; TCGA HNSC -0.113; TCGA KIRC -0.121; TCGA KIRP -0.064; TCGA LGG -0.169; TCGA LUAD -0.145; TCGA LUSC -0.369; TCGA OV -0.127; TCGA PRAD -0.05; TCGA SARC -0.233; TCGA UCEC -0.119 |
hsa-miR-9-5p | MSR1 | 10 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; SARC; UCEC | mirMAP | TCGA BLCA -0.11; TCGA HNSC -0.061; TCGA KIRC -0.113; TCGA KIRP -0.092; TCGA LGG -0.883; TCGA LUAD -0.126; TCGA LUSC -0.428; TCGA OV -0.149; TCGA SARC -0.19; TCGA UCEC -0.091 |
hsa-miR-9-5p | CD84 | 12 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | mirMAP | TCGA BLCA -0.129; TCGA ESCA -0.116; TCGA HNSC -0.078; TCGA KIRC -0.175; TCGA KIRP -0.086; TCGA LGG -0.594; TCGA LUAD -0.091; TCGA LUSC -0.256; TCGA OV -0.129; TCGA PRAD -0.15; TCGA SARC -0.2; TCGA UCEC -0.074 |
hsa-miR-9-5p | PLXNA2 | 10 cancers: BLCA; COAD; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.109; TCGA COAD -0.071; TCGA KIRC -0.098; TCGA LGG -0.125; TCGA LUAD -0.174; TCGA LUSC -0.134; TCGA PAAD -0.122; TCGA PRAD -0.056; TCGA THCA -0.1; TCGA STAD -0.074 |
hsa-miR-9-5p | TNS1 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; OV; PRAD; UCEC | mirMAP | TCGA BLCA -0.189; TCGA BRCA -0.144; TCGA CESC -0.15; TCGA HNSC -0.08; TCGA KIRC -0.068; TCGA LUAD -0.189; TCGA LUSC -0.302; TCGA OV -0.144; TCGA PRAD -0.092; TCGA UCEC -0.137 |
hsa-miR-9-5p | FAM78A | 10 cancers: BLCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; OV; SARC; UCEC | mirMAP | TCGA BLCA -0.073; TCGA CESC -0.092; TCGA ESCA -0.109; TCGA KIRC -0.161; TCGA LGG -0.397; TCGA LUAD -0.084; TCGA LUSC -0.194; TCGA OV -0.072; TCGA SARC -0.093; TCGA UCEC -0.094 |
hsa-miR-9-5p | WDFY4 | 9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; LUSC; OV; SARC | mirMAP | TCGA BLCA -0.142; TCGA BRCA -0.05; TCGA KIRC -0.184; TCGA KIRP -0.111; TCGA LGG -0.609; TCGA LUAD -0.136; TCGA LUSC -0.344; TCGA OV -0.162; TCGA SARC -0.197 |
hsa-miR-9-5p | GLIPR1 | 9 cancers: BLCA; CESC; HNSC; LGG; LUAD; LUSC; OV; SARC; UCEC | mirMAP | TCGA BLCA -0.122; TCGA CESC -0.126; TCGA HNSC -0.182; TCGA LGG -0.558; TCGA LUAD -0.051; TCGA LUSC -0.208; TCGA OV -0.099; TCGA SARC -0.148; TCGA UCEC -0.141 |
hsa-miR-9-5p | JDP2 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; UCEC | mirMAP | TCGA BLCA -0.088; TCGA BRCA -0.112; TCGA CESC -0.105; TCGA ESCA -0.059; TCGA HNSC -0.089; TCGA KIRC -0.064; TCGA LGG -0.175; TCGA LIHC -0.073; TCGA LUAD -0.077; TCGA LUSC -0.178; TCGA UCEC -0.071 |
hsa-miR-9-5p | COL8A1 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; THCA | mirMAP | TCGA BLCA -0.11; TCGA BRCA -0.087; TCGA CESC -0.131; TCGA HNSC -0.088; TCGA KIRC -0.146; TCGA LGG -1.921; TCGA LUAD -0.079; TCGA LUSC -0.261; TCGA OV -0.384; TCGA PRAD -0.121; TCGA THCA -0.103 |
hsa-miR-9-5p | SETD7 | 10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUSC; OV; PRAD; SARC; UCEC | mirMAP | TCGA BLCA -0.051; TCGA BRCA -0.067; TCGA HNSC -0.071; TCGA KIRC -0.059; TCGA KIRP -0.058; TCGA LUSC -0.066; TCGA OV -0.117; TCGA PRAD -0.085; TCGA SARC -0.074; TCGA UCEC -0.08 |
hsa-miR-9-5p | ARHGAP26 | 10 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; OV; STAD | mirMAP | TCGA BLCA -0.055; TCGA CESC -0.137; TCGA COAD -0.085; TCGA ESCA -0.209; TCGA KIRC -0.076; TCGA LGG -0.281; TCGA LUAD -0.08; TCGA LUSC -0.091; TCGA OV -0.131; TCGA STAD -0.084 |
hsa-miR-9-5p | TACC1 | 9 cancers: BLCA; BRCA; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | mirMAP | TCGA BLCA -0.129; TCGA BRCA -0.065; TCGA LGG -0.116; TCGA LUAD -0.114; TCGA LUSC -0.185; TCGA OV -0.091; TCGA PRAD -0.084; TCGA SARC -0.065; TCGA UCEC -0.068 |
hsa-miR-9-5p | GNAQ | 9 cancers: BLCA; COAD; ESCA; LUAD; LUSC; OV; PRAD; THCA; STAD | mirMAP | TCGA BLCA -0.053; TCGA COAD -0.063; TCGA ESCA -0.093; TCGA LUAD -0.102; TCGA LUSC -0.145; TCGA OV -0.087; TCGA PRAD -0.06; TCGA THCA -0.074; TCGA STAD -0.053 |
hsa-miR-9-5p | KCNMA1 | 10 cancers: BLCA; BRCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC | mirMAP; miRNATAP | TCGA BLCA -0.106; TCGA BRCA -0.198; TCGA KIRC -0.151; TCGA LGG -0.303; TCGA LIHC -0.077; TCGA LUAD -0.077; TCGA LUSC -0.152; TCGA OV -0.192; TCGA PRAD -0.121; TCGA UCEC -0.089 |
hsa-miR-9-5p | GBP4 | 12 cancers: BLCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.138; TCGA CESC -0.128; TCGA ESCA -0.126; TCGA KIRC -0.093; TCGA LGG -0.505; TCGA LUAD -0.083; TCGA LUSC -0.25; TCGA OV -0.119; TCGA PRAD -0.07; TCGA SARC -0.135; TCGA STAD -0.162; TCGA UCEC -0.152 |
hsa-miR-9-5p | SNED1 | 10 cancers: BLCA; BRCA; CESC; KIRC; LGG; LIHC; LUAD; LUSC; OV; UCEC | mirMAP | TCGA BLCA -0.098; TCGA BRCA -0.174; TCGA CESC -0.153; TCGA KIRC -0.113; TCGA LGG -0.412; TCGA LIHC -0.13; TCGA LUAD -0.151; TCGA LUSC -0.252; TCGA OV -0.126; TCGA UCEC -0.106 |
hsa-miR-9-5p | SHE | 9 cancers: BLCA; BRCA; KIRC; LGG; LUAD; LUSC; PRAD; THCA; UCEC | mirMAP | TCGA BLCA -0.073; TCGA BRCA -0.129; TCGA KIRC -0.062; TCGA LGG -0.219; TCGA LUAD -0.273; TCGA LUSC -0.381; TCGA PRAD -0.105; TCGA THCA -0.178; TCGA UCEC -0.093 |
hsa-miR-9-5p | HEG1 | 10 cancers: BLCA; BRCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA | mirMAP | TCGA BLCA -0.114; TCGA BRCA -0.08; TCGA HNSC -0.109; TCGA LGG -0.264; TCGA LUAD -0.121; TCGA LUSC -0.216; TCGA OV -0.176; TCGA PRAD -0.104; TCGA SARC -0.132; TCGA THCA -0.093 |
hsa-miR-9-5p | FAM26E | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | mirMAP | TCGA BLCA -0.108; TCGA BRCA -0.102; TCGA CESC -0.082; TCGA ESCA -0.108; TCGA HNSC -0.187; TCGA LGG -0.551; TCGA LUAD -0.052; TCGA LUSC -0.15; TCGA OV -0.148; TCGA PRAD -0.106; TCGA SARC -0.118; TCGA UCEC -0.077 |
hsa-miR-9-5p | HRH1 | 12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; OV; PAAD; SARC; THCA; UCEC | mirMAP | TCGA BLCA -0.083; TCGA CESC -0.138; TCGA ESCA -0.109; TCGA HNSC -0.17; TCGA KIRC -0.05; TCGA LGG -0.542; TCGA LUSC -0.177; TCGA OV -0.201; TCGA PAAD -0.119; TCGA SARC -0.165; TCGA THCA -0.162; TCGA UCEC -0.213 |
hsa-miR-9-5p | PARVA | 9 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; LUSC; PRAD; SARC | mirMAP | TCGA BLCA -0.103; TCGA BRCA -0.065; TCGA CESC -0.147; TCGA HNSC -0.106; TCGA LGG -0.237; TCGA LUAD -0.076; TCGA LUSC -0.117; TCGA PRAD -0.081; TCGA SARC -0.06 |
hsa-miR-9-5p | STARD13 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD | miRNATAP | TCGA BLCA -0.124; TCGA BRCA -0.162; TCGA CESC -0.154; TCGA ESCA -0.126; TCGA HNSC -0.161; TCGA LGG -0.363; TCGA LIHC -0.098; TCGA LUAD -0.141; TCGA LUSC -0.31; TCGA OV -0.072; TCGA PRAD -0.082 |
hsa-miR-9-5p | ERG | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV | miRNATAP | TCGA BLCA -0.067; TCGA BRCA -0.117; TCGA ESCA -0.086; TCGA HNSC -0.099; TCGA KIRC -0.069; TCGA LGG -0.148; TCGA LIHC -0.071; TCGA LUAD -0.159; TCGA LUSC -0.311; TCGA OV -0.086 |
hsa-miR-9-5p | NR5A2 | 9 cancers: BLCA; BRCA; CESC; ESCA; LGG; LIHC; LUAD; LUSC; PRAD | miRNATAP | TCGA BLCA -0.06; TCGA BRCA -0.105; TCGA CESC -0.103; TCGA ESCA -0.285; TCGA LGG -0.584; TCGA LIHC -0.077; TCGA LUAD -0.105; TCGA LUSC -0.253; TCGA PRAD -0.086 |
hsa-miR-9-5p | FYCO1 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; UCEC | miRNATAP | TCGA BLCA -0.111; TCGA BRCA -0.119; TCGA CESC -0.064; TCGA ESCA -0.066; TCGA HNSC -0.113; TCGA LGG -0.516; TCGA LUAD -0.091; TCGA LUSC -0.154; TCGA OV -0.053; TCGA PRAD -0.107; TCGA UCEC -0.053 |
hsa-miR-9-5p | CPEB2 | 10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUSC; OV; THCA | miRNATAP | TCGA BLCA -0.069; TCGA BRCA -0.195; TCGA CESC -0.052; TCGA COAD -0.065; TCGA HNSC -0.216; TCGA KIRC -0.057; TCGA LGG -0.463; TCGA LUSC -0.161; TCGA OV -0.125; TCGA THCA -0.051 |
hsa-miR-9-5p | NRP1 | 10 cancers: BLCA; BRCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; SARC | miRNATAP | TCGA BLCA -0.055; TCGA BRCA -0.057; TCGA HNSC -0.16; TCGA KIRC -0.092; TCGA LGG -0.551; TCGA LIHC -0.059; TCGA LUAD -0.062; TCGA LUSC -0.243; TCGA OV -0.074; TCGA SARC -0.06 |
hsa-miR-9-5p | MYO1C | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA | miRNATAP | TCGA BLCA -0.087; TCGA BRCA -0.072; TCGA CESC -0.096; TCGA ESCA -0.052; TCGA HNSC -0.12; TCGA LGG -0.5; TCGA LUAD -0.061; TCGA LUSC -0.124; TCGA OV -0.065; TCGA PAAD -0.071; TCGA PRAD -0.077; TCGA SARC -0.052; TCGA THCA -0.062 |
hsa-miR-9-5p | TGFBR2 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRNATAP | TCGA BLCA -0.12; TCGA BRCA -0.12; TCGA CESC -0.159; TCGA ESCA -0.191; TCGA HNSC -0.233; TCGA LGG -0.687; TCGA LIHC -0.076; TCGA LUAD -0.173; TCGA LUSC -0.356; TCGA OV -0.118; TCGA PRAD -0.122; TCGA SARC -0.122; TCGA UCEC -0.129 |
hsa-miR-9-5p | CPEB4 | 9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; PRAD | miRNATAP | TCGA BLCA -0.061; TCGA BRCA -0.099; TCGA CESC -0.069; TCGA HNSC -0.166; TCGA LIHC -0.058; TCGA LUAD -0.079; TCGA LUSC -0.155; TCGA OV -0.073; TCGA PRAD -0.079 |
hsa-miR-9-5p | PLEKHA6 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; OV; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.084; TCGA BRCA -0.075; TCGA CESC -0.216; TCGA COAD -0.097; TCGA ESCA -0.364; TCGA LIHC -0.056; TCGA OV -0.076; TCGA PAAD -0.136; TCGA PRAD -0.092; TCGA STAD -0.097; TCGA UCEC -0.113 |
hsa-miR-9-5p | TMEM200A | 13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRNATAP | TCGA BLCA -0.119; TCGA CESC -0.176; TCGA ESCA -0.124; TCGA HNSC -0.064; TCGA KIRC -0.174; TCGA KIRP -0.126; TCGA LGG -0.87; TCGA LUAD -0.052; TCGA LUSC -0.188; TCGA OV -0.157; TCGA PRAD -0.089; TCGA SARC -0.156; TCGA UCEC -0.097 |
hsa-miR-9-5p | WIPF1 | 10 cancers: BLCA; CESC; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRNATAP | TCGA BLCA -0.086; TCGA CESC -0.132; TCGA KIRC -0.114; TCGA LGG -0.116; TCGA LUAD -0.054; TCGA LUSC -0.173; TCGA OV -0.075; TCGA PRAD -0.057; TCGA SARC -0.055; TCGA UCEC -0.11 |
hsa-miR-9-5p | CMTM6 | 9 cancers: BLCA; CESC; LGG; LIHC; LUSC; OV; PAAD; THCA; STAD | miRNATAP | TCGA BLCA -0.058; TCGA CESC -0.057; TCGA LGG -0.409; TCGA LIHC -0.052; TCGA LUSC -0.05; TCGA OV -0.079; TCGA PAAD -0.074; TCGA THCA -0.072; TCGA STAD -0.053 |
hsa-miR-9-5p | TLN1 | 11 cancers: BLCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRNATAP | TCGA BLCA -0.065; TCGA CESC -0.063; TCGA HNSC -0.116; TCGA KIRC -0.051; TCGA LGG -0.229; TCGA LUAD -0.068; TCGA LUSC -0.113; TCGA OV -0.066; TCGA PRAD -0.088; TCGA SARC -0.068; TCGA UCEC -0.063 |
hsa-miR-9-5p | RHOJ | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; UCEC | miRNATAP | TCGA BLCA -0.133; TCGA BRCA -0.09; TCGA CESC -0.088; TCGA ESCA -0.117; TCGA HNSC -0.099; TCGA LGG -0.431; TCGA LUAD -0.133; TCGA LUSC -0.345; TCGA OV -0.059; TCGA PRAD -0.1; TCGA UCEC -0.058 |
hsa-miR-9-5p | MAF | 9 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; UCEC | miRNATAP | TCGA BLCA -0.075; TCGA HNSC -0.185; TCGA KIRC -0.125; TCGA KIRP -0.149; TCGA LGG -0.32; TCGA LUAD -0.057; TCGA LUSC -0.062; TCGA OV -0.158; TCGA UCEC -0.118 |
hsa-miR-9-5p | AMOTL2 | 11 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.093; TCGA BRCA -0.082; TCGA CESC -0.056; TCGA HNSC -0.103; TCGA LIHC -0.089; TCGA LUAD -0.052; TCGA LUSC -0.108; TCGA OV -0.058; TCGA PRAD -0.088; TCGA STAD -0.07; TCGA UCEC -0.171 |
hsa-miR-9-5p | YAP1 | 10 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.077; TCGA BRCA -0.051; TCGA HNSC -0.122; TCGA LGG -0.677; TCGA LIHC -0.069; TCGA LUAD -0.073; TCGA LUSC -0.067; TCGA PRAD -0.114; TCGA THCA -0.092; TCGA STAD -0.071 |
hsa-miR-9-5p | PDE7B | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; THCA; UCEC | miRNATAP | TCGA BLCA -0.094; TCGA BRCA -0.081; TCGA CESC -0.144; TCGA ESCA -0.102; TCGA HNSC -0.084; TCGA LGG -0.364; TCGA LIHC -0.139; TCGA LUAD -0.134; TCGA LUSC -0.196; TCGA PRAD -0.091; TCGA THCA -0.122; TCGA UCEC -0.131 |
hsa-miR-9-5p | RCAN2 | 9 cancers: BLCA; BRCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC; UCEC | miRNATAP | TCGA BLCA -0.122; TCGA BRCA -0.081; TCGA HNSC -0.129; TCGA LGG -0.52; TCGA LUAD -0.136; TCGA LUSC -0.286; TCGA PRAD -0.091; TCGA SARC -0.196; TCGA UCEC -0.113 |
hsa-miR-9-5p | EPAS1 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PRAD; SARC | miRNATAP | TCGA BLCA -0.096; TCGA BRCA -0.104; TCGA ESCA -0.062; TCGA HNSC -0.103; TCGA KIRC -0.087; TCGA LIHC -0.072; TCGA LUAD -0.132; TCGA LUSC -0.368; TCGA OV -0.077; TCGA PRAD -0.072; TCGA SARC -0.173 |
hsa-miR-9-5p | KIF13B | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; THCA; STAD | miRNATAP | TCGA BLCA -0.052; TCGA BRCA -0.229; TCGA CESC -0.092; TCGA COAD -0.097; TCGA ESCA -0.308; TCGA HNSC -0.105; TCGA LGG -0.151; TCGA LUAD -0.093; TCGA LUSC -0.171; TCGA OV -0.063; TCGA PAAD -0.084; TCGA THCA -0.075; TCGA STAD -0.08 |
hsa-miR-9-5p | ADCY9 | 10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; LUSC; OV; PRAD; UCEC | miRNATAP | TCGA BLCA -0.066; TCGA BRCA -0.129; TCGA CESC -0.064; TCGA HNSC -0.069; TCGA LGG -0.414; TCGA LUAD -0.104; TCGA LUSC -0.164; TCGA OV -0.097; TCGA PRAD -0.07; TCGA UCEC -0.238 |
hsa-miR-9-5p | ABCA1 | 9 cancers: BLCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA | miRNATAP | TCGA BLCA -0.096; TCGA HNSC -0.113; TCGA KIRC -0.089; TCGA KIRP -0.082; TCGA LIHC -0.071; TCGA LUAD -0.064; TCGA LUSC -0.078; TCGA OV -0.098; TCGA THCA -0.176 |
hsa-miR-9-5p | AXL | 10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; LUSC; OV; SARC; UCEC | miRNATAP | TCGA BLCA -0.194; TCGA BRCA -0.112; TCGA CESC -0.103; TCGA HNSC -0.137; TCGA LGG -0.196; TCGA LUAD -0.101; TCGA LUSC -0.244; TCGA OV -0.099; TCGA SARC -0.084; TCGA UCEC -0.136 |
hsa-miR-9-5p | ANXA2 | 9 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUSC; OV; SARC; STAD | miRNATAP | TCGA BLCA -0.056; TCGA COAD -0.097; TCGA ESCA -0.094; TCGA HNSC -0.103; TCGA LGG -1.12; TCGA LUSC -0.053; TCGA OV -0.121; TCGA SARC -0.1; TCGA STAD -0.172 |
hsa-miR-9-5p | TSPAN15 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; PAAD; SARC; STAD | miRNATAP | TCGA BLCA -0.11; TCGA BRCA -0.188; TCGA CESC -0.064; TCGA COAD -0.121; TCGA ESCA -0.228; TCGA LUSC -0.092; TCGA PAAD -0.131; TCGA SARC -0.069; TCGA STAD -0.097 |
hsa-miR-9-5p | FBXL3 | 9 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; UCEC | miRNATAP | TCGA BLCA -0.064; TCGA BRCA -0.078; TCGA HNSC -0.054; TCGA LGG -0.068; TCGA LIHC -0.054; TCGA LUAD -0.075; TCGA LUSC -0.086; TCGA OV -0.067; TCGA UCEC -0.078 |
hsa-miR-9-5p | RPS6KA2 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; THCA | miRNATAP | TCGA BLCA -0.077; TCGA BRCA -0.055; TCGA CESC -0.179; TCGA ESCA -0.141; TCGA HNSC -0.106; TCGA LUAD -0.131; TCGA LUSC -0.29; TCGA PRAD -0.067; TCGA THCA -0.127 |
hsa-miR-9-5p | CCND1 | 11 cancers: BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.162; TCGA HNSC -0.135; TCGA KIRC -0.164; TCGA KIRP -0.1; TCGA LIHC -0.137; TCGA LUAD -0.074; TCGA LUSC -0.139; TCGA OV -0.163; TCGA PAAD -0.156; TCGA THCA -0.241; TCGA STAD -0.139 |
hsa-miR-9-5p | CCNG1 | 11 cancers: BRCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BRCA -0.074; TCGA CESC -0.066; TCGA COAD -0.099; TCGA KIRC -0.065; TCGA KIRP -0.067; TCGA LGG -0.228; TCGA LUAD -0.085; TCGA LUSC -0.074; TCGA PRAD -0.054; TCGA THCA -0.072; TCGA STAD -0.064 |
hsa-miR-9-5p | FRMD4B | 12 cancers: BRCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD | miRNAWalker2 validate | TCGA BRCA -0.076; TCGA CESC -0.056; TCGA COAD -0.061; TCGA HNSC -0.14; TCGA KIRC -0.052; TCGA LGG -0.649; TCGA LIHC -0.066; TCGA LUAD -0.111; TCGA LUSC -0.112; TCGA OV -0.145; TCGA PAAD -0.088; TCGA PRAD -0.051 |
hsa-miR-9-5p | EMB | 9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV | MirTarget; miRNATAP | TCGA BRCA -0.105; TCGA CESC -0.187; TCGA ESCA -0.181; TCGA HNSC -0.127; TCGA KIRC -0.086; TCGA LGG -0.842; TCGA LUAD -0.081; TCGA LUSC -0.204; TCGA OV -0.188 |
hsa-miR-9-5p | PALMD | 9 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC | MirTarget; miRNATAP | TCGA BRCA -0.131; TCGA HNSC -0.213; TCGA LGG -0.726; TCGA LIHC -0.148; TCGA LUAD -0.177; TCGA LUSC -0.258; TCGA OV -0.133; TCGA PRAD -0.073; TCGA SARC -0.085 |
hsa-miR-9-5p | PTPRB | 11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; THCA | mirMAP; miRNATAP | TCGA BRCA -0.162; TCGA CESC -0.137; TCGA ESCA -0.182; TCGA HNSC -0.062; TCGA KIRC -0.091; TCGA LIHC -0.098; TCGA LUAD -0.186; TCGA LUSC -0.401; TCGA PRAD -0.114; TCGA SARC -0.064; TCGA THCA -0.069 |
hsa-miR-9-5p | SHROOM3 | 11 cancers: BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD | mirMAP; miRNATAP | TCGA BRCA -0.069; TCGA CESC -0.204; TCGA COAD -0.069; TCGA ESCA -0.227; TCGA LGG -1.5; TCGA LUAD -0.086; TCGA LUSC -0.176; TCGA OV -0.107; TCGA PRAD -0.096; TCGA THCA -0.085; TCGA STAD -0.151 |
hsa-miR-9-5p | MTHFR | 9 cancers: BRCA; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; THCA; UCEC | mirMAP | TCGA BRCA -0.094; TCGA ESCA -0.075; TCGA HNSC -0.052; TCGA KIRC -0.054; TCGA LGG -0.227; TCGA LUAD -0.061; TCGA LUSC -0.118; TCGA THCA -0.097; TCGA UCEC -0.068 |
hsa-miR-9-5p | AR | 9 cancers: BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PRAD | miRNATAP | TCGA BRCA -0.477; TCGA CESC -0.162; TCGA HNSC -0.105; TCGA KIRC -0.169; TCGA LGG -0.661; TCGA LIHC -0.211; TCGA LUAD -0.175; TCGA LUSC -0.33; TCGA PRAD -0.208 |
hsa-miR-9-5p | SH3BGRL2 | 9 cancers: BRCA; COAD; ESCA; LIHC; LUAD; LUSC; PRAD; THCA; STAD | miRNATAP | TCGA BRCA -0.099; TCGA COAD -0.08; TCGA ESCA -0.231; TCGA LIHC -0.113; TCGA LUAD -0.085; TCGA LUSC -0.139; TCGA PRAD -0.091; TCGA THCA -0.13; TCGA STAD -0.075 |
hsa-miR-9-5p | SLC1A1 | 9 cancers: BRCA; CESC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; STAD | miRNATAP | TCGA BRCA -0.264; TCGA CESC -0.147; TCGA KIRC -0.121; TCGA KIRP -0.094; TCGA LIHC -0.117; TCGA LUAD -0.174; TCGA LUSC -0.384; TCGA PRAD -0.141; TCGA STAD -0.167 |
hsa-miR-9-5p | DPP4 | 14 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA BRCA -0.093; TCGA CESC -0.197; TCGA ESCA -0.243; TCGA HNSC -0.103; TCGA KIRC -0.074; TCGA KIRP -0.202; TCGA LGG -1.085; TCGA LUAD -0.102; TCGA LUSC -0.357; TCGA OV -0.241; TCGA PRAD -0.111; TCGA SARC -0.245; TCGA THCA -0.44; TCGA UCEC -0.355 |
hsa-miR-9-5p | P4HA2 | 9 cancers: CESC; COAD; HNSC; KIRC; KIRP; LGG; OV; SARC; THCA | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA CESC -0.057; TCGA COAD -0.069; TCGA HNSC -0.14; TCGA KIRC -0.093; TCGA KIRP -0.066; TCGA LGG -0.946; TCGA OV -0.073; TCGA SARC -0.108; TCGA THCA -0.205 |
hsa-miR-9-5p | SLC39A14 | 9 cancers: CESC; COAD; ESCA; KIRC; LIHC; PAAD; PRAD; SARC; STAD | miRNAWalker2 validate; miRNATAP | TCGA CESC -0.106; TCGA COAD -0.086; TCGA ESCA -0.163; TCGA KIRC -0.067; TCGA LIHC -0.057; TCGA PAAD -0.095; TCGA PRAD -0.071; TCGA SARC -0.135; TCGA STAD -0.116 |
hsa-miR-9-5p | SPTBN1 | 11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD | miRNAWalker2 validate | TCGA CESC -0.069; TCGA ESCA -0.135; TCGA HNSC -0.054; TCGA KIRC -0.053; TCGA KIRP -0.059; TCGA LGG -0.084; TCGA LIHC -0.063; TCGA LUAD -0.09; TCGA LUSC -0.168; TCGA PRAD -0.095; TCGA STAD -0.073 |
hsa-miR-9-5p | ATP11A | 10 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; THCA | MirTarget; miRNATAP | TCGA CESC -0.125; TCGA ESCA -0.132; TCGA HNSC -0.073; TCGA KIRC -0.148; TCGA KIRP -0.073; TCGA LGG -0.239; TCGA LUAD -0.12; TCGA LUSC -0.225; TCGA OV -0.157; TCGA THCA -0.148 |
hsa-miR-9-5p | PRRG1 | 10 cancers: CESC; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; THCA; UCEC | mirMAP | TCGA CESC -0.153; TCGA ESCA -0.191; TCGA HNSC -0.252; TCGA LIHC -0.053; TCGA LUAD -0.096; TCGA LUSC -0.192; TCGA OV -0.12; TCGA PRAD -0.075; TCGA THCA -0.16; TCGA UCEC -0.17 |
hsa-miR-9-5p | SH2B3 | 10 cancers: CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; SARC; UCEC | miRNATAP | TCGA CESC -0.089; TCGA ESCA -0.113; TCGA HNSC -0.057; TCGA KIRC -0.11; TCGA LGG -0.411; TCGA LUAD -0.072; TCGA LUSC -0.208; TCGA OV -0.073; TCGA SARC -0.075; TCGA UCEC -0.088 |
hsa-miR-9-5p | CD47 | 10 cancers: CESC; ESCA; HNSC; LGG; LUAD; LUSC; SARC; THCA; STAD; UCEC | miRNATAP | TCGA CESC -0.083; TCGA ESCA -0.128; TCGA HNSC -0.107; TCGA LGG -0.116; TCGA LUAD -0.073; TCGA LUSC -0.175; TCGA SARC -0.072; TCGA THCA -0.056; TCGA STAD -0.099; TCGA UCEC -0.153 |
hsa-miR-9-5p | RNF128 | 9 cancers: COAD; ESCA; HNSC; LGG; LUAD; LUSC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA COAD -0.133; TCGA ESCA -0.302; TCGA HNSC -0.122; TCGA LGG -1.077; TCGA LUAD -0.111; TCGA LUSC -0.204; TCGA THCA -0.137; TCGA STAD -0.262; TCGA UCEC -0.152 |
Enriched cancer pathways of putative targets