microRNA information: hsa-miR-921
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-921 | miRbase |
Accession: | MIMAT0004971 | miRbase |
Precursor name: | hsa-mir-921 | miRbase |
Precursor accession: | MI0005713 | miRbase |
Symbol: | MIR921 | HGNC |
RefSeq ID: | NR_030626 | GenBank |
Sequence: | CUAGUGAGGGACAGAACCAGGAUUC |
Reported expression in cancers: hsa-miR-921
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-921 | bladder cancer | deregulation | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | qPCR |
Reported cancer pathway affected by hsa-miR-921
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-921
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-921 | bladder cancer | staging | "Expression levels of miRNAs were assessed by quant ......" | 23169479 |
Reported gene related to hsa-miR-921
miRNA | cancer | gene | reporting | PUBMED |
---|