microRNA information: hsa-miR-935
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-935 | miRbase |
| Accession: | MIMAT0004978 | miRbase |
| Precursor name: | hsa-mir-935 | miRbase |
| Precursor accession: | MI0005757 | miRbase |
| Symbol: | MIR935 | HGNC |
| RefSeq ID: | NR_030632 | GenBank |
| Sequence: | CCAGUUACCGCUUCCGCUACCGC |
Reported expression in cancers: hsa-miR-935
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-935 | bladder cancer | deregulation | "Thus the current study focused on a comprehensive ......" | 27350368 | Microarray |
| hsa-miR-935 | gastric cancer | upregulation | "Here we found miR-935 was upregulated in gastric c ......" | 27044823 | |
| hsa-miR-935 | liver cancer | upregulation | "Aberrant expression of MicroRNA-935 MiR-935 has be ......" | 27697092 |
Reported cancer pathway affected by hsa-miR-935
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-935 | liver cancer | cell cycle pathway | "MiR 935 promotes liver cancer cell proliferation a ......" | 27697092 |
Reported cancer prognosis affected by hsa-miR-935
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-935 | gastric cancer | tumorigenesis | "miR 935 promotes gastric cancer cell proliferation ......" | 27044823 | Colony formation |
| hsa-miR-935 | liver cancer | progression; tumorigenesis; motility | "MiR 935 promotes liver cancer cell proliferation a ......" | 27697092 |
Reported gene related to hsa-miR-935
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-935 | gastric cancer | SOX7 | "miR 935 promotes gastric cancer cell proliferation ......" | 27044823 |
| hsa-miR-935 | liver cancer | SOX7 | "MiR 935 promotes liver cancer cell proliferation a ......" | 27697092 |
Expression profile in cancer corhorts:
