microRNA information: hsa-miR-939-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-939-5p | miRbase |
| Accession: | MIMAT0004982 | miRbase |
| Precursor name: | hsa-mir-939 | miRbase |
| Precursor accession: | MI0005761 | miRbase |
| Symbol: | MIR939 | HGNC |
| RefSeq ID: | NR_030635 | GenBank |
| Sequence: | UGGGGAGCUGAGGCUCUGGGGGUG |
Reported expression in cancers: hsa-miR-939-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-939-5p | breast cancer | upregulation | "By in silico analysis miR-939 was found highly exp ......" | 27693459 | |
| hsa-miR-939-5p | colon cancer | downregulation | "We assessed by qRT-PCR expression of 754 microRNAs ......" | 27485175 | qPCR |
| hsa-miR-939-5p | ovarian cancer | upregulation | "In this present study miR-939 expression was marke ......" | 25960217 |
Reported cancer pathway affected by hsa-miR-939-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-939-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-939-5p | breast cancer | poor survival; worse prognosis | "Breast cancer secreted miR 939 downregulates VE ca ......" | 27693459 | |
| hsa-miR-939-5p | colon cancer | staging | "A validation study was done to corroborate a subse ......" | 26626874 | |
| hsa-miR-939-5p | colon cancer | staging; metastasis; poor survival | "We assessed by qRT-PCR expression of 754 microRNAs ......" | 27485175 |
Reported gene related to hsa-miR-939-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-939-5p | ovarian cancer | APC2 | "MiR 939 promotes the proliferation of human ovaria ......" | 25960217 |
| hsa-miR-939-5p | breast cancer | CDH5 | "Breast cancer secreted miR 939 downregulates VE ca ......" | 27693459 |
Expression profile in cancer corhorts:
