microRNA information: hsa-miR-944
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-944 | miRbase |
| Accession: | MIMAT0004987 | miRbase |
| Precursor name: | hsa-mir-944 | miRbase |
| Precursor accession: | MI0005769 | miRbase |
| Symbol: | MIR944 | HGNC |
| RefSeq ID: | NR_030642 | GenBank |
| Sequence: | AAAUUAUUGUACAUCGGAUGAG |
Reported expression in cancers: hsa-miR-944
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-944 | breast cancer | upregulation | "MiR 944 functions as a novel oncogene and regulate ......" | 26298722 | |
| hsa-miR-944 | lung cancer | upregulation | "Plasma circulating microRNA 944 and microRNA 3662 ......" | 26079400 | Reverse transcription PCR |
| hsa-miR-944 | lung squamous cell cancer | downregulation | "cDNA microarray luciferase reporter assay and miRN ......" | 27681722 | Microarray |
Reported cancer pathway affected by hsa-miR-944
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-944 | cervical and endocervical cancer | Apoptosis pathway | "Novel functions and targets of miR 944 in human ce ......" | 25156441 | Western blot; Luciferase |
| hsa-miR-944 | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 944 Affects Cell Growth by Targeting EPHA ......" | 27681722 | Luciferase |
Reported cancer prognosis affected by hsa-miR-944
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-944 | breast cancer | drug resistance; metastasis | "MiR 944 functions as a novel oncogene and regulate ......" | 26298722 | |
| hsa-miR-944 | breast cancer | cell migration | "Suppression of cell migration is promoted by miR 9 ......" | 27377268 | Luciferase; Western blot; RNAi |
| hsa-miR-944 | cervical and endocervical cancer | tumorigenesis | "Novel functions and targets of miR 944 in human ce ......" | 25156441 | Western blot; Luciferase |
| hsa-miR-944 | colorectal cancer | recurrence | "TaqMan® Human MicroRNA Array Set v2.0 was used to ......" | 23280316 | |
| hsa-miR-944 | lung cancer | staging; metastasis | "Characterization of microRNA transcriptome in lung ......" | 24785186 | |
| hsa-miR-944 | lung squamous cell cancer | progression | "MicroRNA 944 Affects Cell Growth by Targeting EPHA ......" | 27681722 | Luciferase |
Reported gene related to hsa-miR-944
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-944 | breast cancer | BNIP3 | "Furthermore we indicated that miR-944 is associate ......" | 26298722 |
| hsa-miR-944 | breast cancer | CASP3 | "Finally we demonstrated that miR-944 inhibitors pr ......" | 26298722 |
| hsa-miR-944 | lung squamous cell cancer | EPHA7 | "MicroRNA 944 Affects Cell Growth by Targeting EPHA ......" | 27681722 |
| hsa-miR-944 | breast cancer | PTP4A1 | "Suppression of cell migration is promoted by miR 9 ......" | 27377268 |
| hsa-miR-944 | breast cancer | SIAH1 | "Suppression of cell migration is promoted by miR 9 ......" | 27377268 |
| hsa-miR-944 | lung cancer | SOCS4 | "Manipulation of miR-944 expression in NSCLC cells ......" | 24785186 |
Expression profile in cancer corhorts:
