microRNA information: hsa-miR-95-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-95-3p | miRbase |
| Accession: | MIMAT0000094 | miRbase |
| Precursor name: | hsa-mir-95 | miRbase |
| Precursor accession: | MI0000097 | miRbase |
| Symbol: | MIR95 | HGNC |
| RefSeq ID: | NR_029511 | GenBank |
| Sequence: | UUCAACGGGUAUUUAUUGAGCA |
Reported expression in cancers: hsa-miR-95-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-95-3p | colorectal cancer | upregulation | "In this study we defined the oncogenic significanc ......" | 21427358 | Microarray |
| hsa-miR-95-3p | glioblastoma | downregulation | "We used high-throughput sequencing to comprehensiv ......" | 21912681 | RNA-Seq |
| hsa-miR-95-3p | head and neck cancer | deregulation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | qPCR; Microarray |
| hsa-miR-95-3p | pancreatic cancer | upregulation | "Profiling of 95 microRNAs in pancreatic cancer cel ......" | 19030927 | qPCR |
Reported cancer pathway affected by hsa-miR-95-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-95-3p | colorectal cancer | Apoptosis pathway | "Glargine Promotes Human Colorectal Cancer Cell Pro ......" | 25671802 | Flow cytometry; MTT assay; Western blot |
| hsa-miR-95-3p | colorectal cancer | Apoptosis pathway | "Genistein inhibits human colorectal cancer growth ......" | 25871428 | Flow cytometry; MTT assay; Western blot |
| hsa-miR-95-3p | colorectal cancer | Apoptosis pathway; PI3K/Akt signaling pathway | "The CCK8 assay flow cytometry and Hoechst 33258 st ......" | 27393650 | Flow cytometry; Western blot |
| hsa-miR-95-3p | pancreatic cancer | Apoptosis pathway | "Real-time polymerase chain reaction array RT-PCR w ......" | 22690071 | Cell migration assay |
Reported cancer prognosis affected by hsa-miR-95-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-95-3p | head and neck cancer | malignant trasformation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | |
| hsa-miR-95-3p | lung cancer | drug resistance | "Abnormal Expression of miR 21 and miR 95 in Cancer ......" | 25831148 | |
| hsa-miR-95-3p | lung cancer | metastasis; poor survival; worse prognosis | "Overexpression of microRNA 95 3p suppresses brain ......" | 25971210 | Western blot |
| hsa-miR-95-3p | lung squamous cell cancer | drug resistance | "MiR 95 induces proliferation and chemo or radiores ......" | 24835695 | Luciferase |
Reported gene related to hsa-miR-95-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-95-3p | colorectal cancer | SNX1 | "The expression of microRNA-95 miR-95 and sorting n ......" | 25671802 |
| hsa-miR-95-3p | colorectal cancer | SNX1 | "MicroRNA 95 promotes cell proliferation and target ......" | 21427358 |
| hsa-miR-95-3p | lung squamous cell cancer | SNX1 | "MiR 95 induces proliferation and chemo or radiores ......" | 24835695 |
| hsa-miR-95-3p | lung cancer | CCND1 | "Overexpression of microRNA 95 3p suppresses brain ......" | 25971210 |
| hsa-miR-95-3p | liver cancer | CELF2 | "We further identified CUG triplet repeat RNA-bindi ......" | 24530415 |
| hsa-miR-95-3p | lung cancer | PCNA | "Overexpression of microRNA 95 3p suppresses brain ......" | 25971210 |
| hsa-miR-95-3p | colorectal cancer | SGK1 | "Genistein inhibits human colorectal cancer growth ......" | 25871428 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-95-3p | RAI14 | 10 cancers: CESC; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; THCA; STAD; UCEC | MirTarget | TCGA CESC -0.097; TCGA COAD -0.224; TCGA ESCA -0.09; TCGA HNSC -0.076; TCGA LIHC -0.053; TCGA LUAD -0.092; TCGA PAAD -0.243; TCGA THCA -0.228; TCGA STAD -0.111; TCGA UCEC -0.077 |
Enriched cancer pathways of putative targets