microRNA information: hsa-miR-99a-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-99a-3p | miRbase |
| Accession: | MIMAT0004511 | miRbase |
| Precursor name: | hsa-mir-99a | miRbase |
| Precursor accession: | MI0000101 | miRbase |
| Symbol: | MIR99A | HGNC |
| RefSeq ID: | NR_029514 | GenBank |
| Sequence: | CAAGCUCGCUUCUAUGGGUCUG |
Reported expression in cancers: hsa-miR-99a-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-99a-3p | bladder cancer | downregulation | "microRNA 99a acts as a tumor suppressor and is dow ......" | 24957100 | qPCR |
| hsa-miR-99a-3p | bladder cancer | downregulation | "Cell free urinary microRNA 99a and microRNA 125b a ......" | 25014919 | Microarray; qPCR |
| hsa-miR-99a-3p | bladder cancer | downregulation | "In the first - discovery - phase microarray cards ......" | 27468885 | Microarray; qPCR |
| hsa-miR-99a-3p | breast cancer | downregulation | "miR-99a has been reported as a tumor suppressor ge ......" | 24637915 | |
| hsa-miR-99a-3p | breast cancer | downregulation | "Based on microarray data we identified miR-99a as ......" | 26417931 | Microarray |
| hsa-miR-99a-3p | breast cancer | downregulation | "Low levels of serum miR 99a is a predictor of poor ......" | 27706621 | qPCR |
| hsa-miR-99a-3p | cervical and endocervical cancer | downregulation | "Here we showed that miR-99a and -99b miR-99a/b wer ......" | 24668416 | |
| hsa-miR-99a-3p | colon cancer | downregulation | "Among the miRNAs demonstrating the largest fold up ......" | 21694772 | |
| hsa-miR-99a-3p | esophageal cancer | downregulation | "In this study we focused on miR-99a and miR-100 wh ......" | 23292834 | qPCR |
| hsa-miR-99a-3p | gastric cancer | deregulation | "miRNA expression signature was first analyzed by r ......" | 21628394 | qPCR |
| hsa-miR-99a-3p | head and neck cancer | downregulation | "To explore circulating miRNAs as cancer therapy bi ......" | 25950115 | qPCR; Microarray |
| hsa-miR-99a-3p | kidney renal cell cancer | downregulation | "MicroRNA 99a induces G1 phase cell cycle arrest an ......" | 23173671 | Reverse transcription PCR; qPCR |
| hsa-miR-99a-3p | kidney renal cell cancer | downregulation | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
| hsa-miR-99a-3p | liver cancer | downregulation | "MicroRNA 99a inhibits hepatocellular carcinoma gro ......" | 21878637 | RNA-Seq |
| hsa-miR-99a-3p | lung cancer | downregulation | "miR-99a is frequently downregulated in various typ ......" | 26986073 | |
| hsa-miR-99a-3p | lung squamous cell cancer | downregulation | "Recently several studies have shown that miR-99a i ......" | 25187230 | |
| hsa-miR-99a-3p | lung squamous cell cancer | downregulation | "miRNA-99a miR-99a which is downregulated in severa ......" | 25663868 | qPCR |
| hsa-miR-99a-3p | sarcoma | deregulation | "The most significantly downregulated miRNAs were m ......" | 24027049 |
Reported cancer pathway affected by hsa-miR-99a-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-99a-3p | bladder cancer | cell cycle pathway | "microRNA 99a acts as a tumor suppressor and is dow ......" | 24957100 | |
| hsa-miR-99a-3p | breast cancer | Apoptosis pathway | "MiR 99a antitumor activity in human breast cancer ......" | 24637915 | Luciferase |
| hsa-miR-99a-3p | cervical and endocervical cancer | mTOR signaling pathway | "miR 99a and 99b inhibit cervical cancer cell proli ......" | 24668416 | Luciferase |
| hsa-miR-99a-3p | endometrial cancer | cell cycle pathway | "Integrated microRNA and mRNA transcriptome sequenc ......" | 25329664 | |
| hsa-miR-99a-3p | endometrial cancer | mTOR signaling pathway; Apoptosis pathway | "A dual PI3K/AKT/mTOR signaling inhibitor miR 99a s ......" | 27158364 | |
| hsa-miR-99a-3p | esophageal cancer | Apoptosis pathway; mTOR signaling pathway | "In this study we focused on miR-99a and miR-100 wh ......" | 23292834 | Western blot; Luciferase |
| hsa-miR-99a-3p | glioblastoma | PI3K/Akt signaling pathway; Apoptosis pathway | "Photofrin based photodynamic therapy and miR 99a t ......" | 23409016 | Western blot |
| hsa-miR-99a-3p | head and neck cancer | mTOR signaling pathway | "Selected microRNAs including members of miR-99 fam ......" | 22425712 | |
| hsa-miR-99a-3p | kidney renal cell cancer | cell cycle pathway | "MicroRNA 99a induces G1 phase cell cycle arrest an ......" | 23173671 | Colony formation; Western blot; Luciferase |
| hsa-miR-99a-3p | liver cancer | cell cycle pathway | "MicroRNA 99a inhibits hepatocellular carcinoma gro ......" | 21878637 | |
| hsa-miR-99a-3p | lung cancer | Apoptosis pathway | "Clinic significance of microRNA 99a expression in ......" | 23893385 | Western blot; Flow cytometry; Luciferase |
| hsa-miR-99a-3p | lung cancer | cell cycle pathway | "MiR 99a regulates ROS mediated invasion and migrat ......" | 26986073 | |
| hsa-miR-99a-3p | lung squamous cell cancer | cell cycle pathway | "Intriguingly D261 modified expressions of some miR ......" | 25046358 | |
| hsa-miR-99a-3p | lung squamous cell cancer | cell cycle pathway | "microRNA 99a is downregulated and promotes prolife ......" | 25663868 | Colony formation |
| hsa-miR-99a-3p | sarcoma | cell cycle pathway; Apoptosis pathway | "Tumor suppressive miR 99a inhibits cell proliferat ......" | 27158394 | Colony formation |
| hsa-miR-99a-3p | thyroid cancer | Apoptosis pathway | "MiR 99a Inhibits Cell Proliferation and Tumorigene ......" | 26163618 | Luciferase |
Reported cancer prognosis affected by hsa-miR-99a-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-99a-3p | bladder cancer | cell migration | "microRNA 99a inhibiting cell proliferation migrati ......" | 24944696 | Western blot; Luciferase; Cell migration assay |
| hsa-miR-99a-3p | bladder cancer | malignant trasformation | "Cell free urinary microRNA 99a and microRNA 125b a ......" | 25014919 | |
| hsa-miR-99a-3p | bladder cancer | progression; poor survival | "Of the eight most important progression-related mi ......" | 25990459 | |
| hsa-miR-99a-3p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
| hsa-miR-99a-3p | breast cancer | tumorigenesis | "MiR 99a antitumor activity in human breast cancer ......" | 24637915 | Luciferase |
| hsa-miR-99a-3p | breast cancer | cell migration; malignant trasformation | "miR 99a directly targets the mTOR signalling pathw ......" | 25348507 | Western blot |
| hsa-miR-99a-3p | breast cancer | metastasis; poor survival | "MicroRNA 99a inhibits tumor aggressive phenotypes ......" | 26417931 | Luciferase |
| hsa-miR-99a-3p | breast cancer | worse prognosis | "MiR 99a suppress proliferation migration and invas ......" | 27212167 | MTT assay; Transwell assay; Luciferase; Western blot |
| hsa-miR-99a-3p | breast cancer | worse prognosis; staging; metastasis; poor survival | "Low levels of serum miR 99a is a predictor of poor ......" | 27706621 | |
| hsa-miR-99a-3p | cervical and endocervical cancer | metastasis | "miR 99a and 99b inhibit cervical cancer cell proli ......" | 24668416 | Luciferase |
| hsa-miR-99a-3p | colorectal cancer | staging; drug resistance; progression; poor survival | "MiR 107 and miR 99a 3p predict chemotherapy respon ......" | 25197016 | |
| hsa-miR-99a-3p | endometrial cancer | drug resistance | "Expression levels of ERα and PR and their respons ......" | 21472251 | |
| hsa-miR-99a-3p | endometrial cancer | staging | "Integrated microRNA and mRNA transcriptome sequenc ......" | 25329664 | |
| hsa-miR-99a-3p | endometrial cancer | progression; differentiation; tumorigenesis | "A dual PI3K/AKT/mTOR signaling inhibitor miR 99a s ......" | 27158364 | |
| hsa-miR-99a-3p | glioblastoma | poor survival | "Photofrin based photodynamic therapy and miR 99a t ......" | 23409016 | Western blot |
| hsa-miR-99a-3p | head and neck cancer | tumorigenesis | "Selected microRNAs including members of miR-99 fam ......" | 22425712 | |
| hsa-miR-99a-3p | kidney renal cell cancer | tumorigenesis; poor survival | "MicroRNA 99a induces G1 phase cell cycle arrest an ......" | 23173671 | Colony formation; Western blot; Luciferase |
| hsa-miR-99a-3p | kidney renal cell cancer | worse prognosis | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
| hsa-miR-99a-3p | liver cancer | worse prognosis; poor survival | "MicroRNA 99a inhibits hepatocellular carcinoma gro ......" | 21878637 | |
| hsa-miR-99a-3p | lung cancer | worse prognosis; staging; metastasis; poor survival | "Clinic significance of microRNA 99a expression in ......" | 23893385 | Western blot; Flow cytometry; Luciferase |
| hsa-miR-99a-3p | lung cancer | progression; staging; metastasis | "MiR 99a regulates ROS mediated invasion and migrat ......" | 26986073 | |
| hsa-miR-99a-3p | lung squamous cell cancer | metastasis; staging; tumorigenesis | "miR 99a suppresses the metastasis of human non sma ......" | 25187230 | |
| hsa-miR-99a-3p | lung squamous cell cancer | cell migration | "microRNA 99a is downregulated and promotes prolife ......" | 25663868 | Colony formation |
| hsa-miR-99a-3p | ovarian cancer | worse prognosis | "miR 99a promotes proliferation targeting FGFR3 in ......" | 24456664 | Luciferase |
| hsa-miR-99a-3p | pancreatic cancer | tumorigenesis | "Antagonism of microRNA 99a promotes cell invasion ......" | 24461517 | |
| hsa-miR-99a-3p | pancreatic cancer | worse prognosis; poor survival | "The aim of this study was to investigate microRNAs ......" | 25906450 | |
| hsa-miR-99a-3p | prostate cancer | staging; worse prognosis | "miR 99 family of MicroRNAs suppresses the expressi ......" | 21212412 | |
| hsa-miR-99a-3p | prostate cancer | drug resistance | "The miR-99 family has been shown to play an import ......" | 27340920 | |
| hsa-miR-99a-3p | sarcoma | malignant trasformation; progression; worse prognosis | "Aberrant expression of microRNA 99a and its target ......" | 27073323 | |
| hsa-miR-99a-3p | sarcoma | progression; metastasis | "Tumor suppressive miR 99a inhibits cell proliferat ......" | 27158394 | Colony formation |
| hsa-miR-99a-3p | thyroid cancer | tumorigenesis | "MiR 99a Inhibits Cell Proliferation and Tumorigene ......" | 26163618 | Luciferase |
Reported gene related to hsa-miR-99a-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-99a-3p | breast cancer | MTOR | "miR 99a directly targets the mTOR signalling pathw ......" | 25348507 |
| hsa-miR-99a-3p | breast cancer | MTOR | "MiR 99a antitumor activity in human breast cancer ......" | 24637915 |
| hsa-miR-99a-3p | cervical and endocervical cancer | MTOR | "miR 99a and 99b inhibit cervical cancer cell proli ......" | 24668416 |
| hsa-miR-99a-3p | endometrial cancer | MTOR | "Intriguingly two major members of this pathway AKT ......" | 27158364 |
| hsa-miR-99a-3p | esophageal cancer | MTOR | "In conclusion these results indicated that miR-99a ......" | 23292834 |
| hsa-miR-99a-3p | head and neck cancer | MTOR | "Furthermore ectopic transfection of miR-99 family ......" | 22425712 |
| hsa-miR-99a-3p | kidney renal cell cancer | MTOR | "In addition we also fond that mammalian target of ......" | 23173671 |
| hsa-miR-99a-3p | liver cancer | MTOR | "Insulin-like growth factor 1 receptor IGF-1R and m ......" | 21878637 |
| hsa-miR-99a-3p | lung cancer | MTOR | "Functional analyses showed that upregulation of mi ......" | 23893385 |
| hsa-miR-99a-3p | lung squamous cell cancer | MTOR | "Intriguingly D261 modified expressions of some miR ......" | 25046358 |
| hsa-miR-99a-3p | sarcoma | MTOR | "Aberrant expression of microRNA 99a and its target ......" | 27073323 |
| hsa-miR-99a-3p | thyroid cancer | MTOR | "MiR 99a Inhibits Cell Proliferation and Tumorigene ......" | 26163618 |
| hsa-miR-99a-3p | glioblastoma | FGFR3 | "Photofrin based photodynamic therapy and miR 99a t ......" | 23409016 |
| hsa-miR-99a-3p | glioblastoma | FGFR3 | "The tumorigenic FGFR3 TACC3 gene fusion escapes mi ......" | 23298836 |
| hsa-miR-99a-3p | ovarian cancer | FGFR3 | "miR 99a promotes proliferation targeting FGFR3 in ......" | 24456664 |
| hsa-miR-99a-3p | endometrial cancer | AKT1 | "Intriguingly two major members of this pathway AKT ......" | 27158364 |
| hsa-miR-99a-3p | lung squamous cell cancer | AKT1 | "miR 99a suppresses the metastasis of human non sma ......" | 25187230 |
| hsa-miR-99a-3p | prostate cancer | SMARCA5 | "The miR-99 family has been shown to play an import ......" | 27340920 |
| hsa-miR-99a-3p | prostate cancer | SMARCA5 | "We determined that PSA is posttranscriptionally re ......" | 21212412 |
| hsa-miR-99a-3p | sarcoma | ANXA5 | "In addition FACS and Annexin V assays identified t ......" | 27158394 |
| hsa-miR-99a-3p | thyroid cancer | ATM | "Recently miR-99a has been reported as a tumor supp ......" | 26163618 |
| hsa-miR-99a-3p | thyroid cancer | BP1 | "Up-regulation of miR-99a would markedly reduce the ......" | 26163618 |
| hsa-miR-99a-3p | pancreatic cancer | CDH1 | "Antagonism of microRNA 99a promotes cell invasion ......" | 24461517 |
| hsa-miR-99a-3p | bladder cancer | FOXA1 | "MicroRNA 99a and 100 mediated upregulation of FOXA ......" | 25071007 |
| hsa-miR-99a-3p | breast cancer | HOXA1 | "MicroRNA 99a inhibits tumor aggressive phenotypes ......" | 26417931 |
| hsa-miR-99a-3p | head and neck cancer | IGF1R | "Furthermore ectopic transfection of miR-99 family ......" | 22425712 |
| hsa-miR-99a-3p | breast cancer | LINC00478 | "We found 78 miRNAs differentially expressed betwee ......" | 25388283 |
| hsa-miR-99a-3p | lung cancer | NOX4 | "MiR 99a regulates ROS mediated invasion and migrat ......" | 26986073 |
| hsa-miR-99a-3p | prostate cancer | NR3C1 | "Strikingly treatment of prostate cells with the gl ......" | 27340920 |
| hsa-miR-99a-3p | lung cancer | ROS1 | "MiR 99a regulates ROS mediated invasion and migrat ......" | 26986073 |
| hsa-miR-99a-3p | prostate cancer | SMARCD1 | "The miR-99 family has been shown to play an import ......" | 27340920 |
| hsa-miR-99a-3p | glioblastoma | TACC3 | "The tumorigenic FGFR3 TACC3 gene fusion escapes mi ......" | 23298836 |
| hsa-miR-99a-3p | sarcoma | TNFAIP8 | "Tumor suppressive miR 99a inhibits cell proliferat ......" | 27158394 |
| hsa-miR-99a-3p | glioblastoma | TP53 | "Therefore our results indicated that the anti-tumo ......" | 23409016 |
| hsa-miR-99a-3p | cervical and endocervical cancer | TRIB2 | "miR 99 inhibits cervical carcinoma cell proliferat ......" | 24137458 |
| hsa-miR-99a-3p | prostate cancer | XRCC5 | "Relation between Ku80 and microRNA 99a expression ......" | 25937401 |
Expression profile in cancer corhorts:
