microRNA information: hsa-miR-99b-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-99b-5p | miRbase |
Accession: | MIMAT0000689 | miRbase |
Precursor name: | hsa-mir-99b | miRbase |
Precursor accession: | MI0000746 | miRbase |
Symbol: | MIR99B | HGNC |
RefSeq ID: | NR_029843 | GenBank |
Sequence: | CACCCGUAGAACCGACCUUGCG |
Reported expression in cancers: hsa-miR-99b-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-99b-5p | colorectal cancer | upregulation | "miR-99b-5p was found to be more than 6-fold higher ......" | 26259252 | |
hsa-miR-99b-5p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
hsa-miR-99b-5p | lung squamous cell cancer | downregulation | "microRNA 99b acts as a tumor suppressor in non sma ......" | 22969861 | Microarray |
hsa-miR-99b-5p | prostate cancer | downregulation | "PCR array was performed in FFPE PCa tissues 5 Cauc ......" | 24167554 | qPCR |
hsa-miR-99b-5p | sarcoma | upregulation | "There were 21 significantly up-regulated miRNAs in ......" | 21213367 |
Reported cancer pathway affected by hsa-miR-99b-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-99b-5p | head and neck cancer | mTOR signaling pathway | "Selected microRNAs including members of miR-99 fam ......" | 22425712 |
Reported cancer prognosis affected by hsa-miR-99b-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-99b-5p | breast cancer | tumorigenesis | "Microarray-based techniques are being useful to ob ......" | 22167321 | |
hsa-miR-99b-5p | colorectal cancer | metastasis; staging; poor survival; cell migration | "miR-99b-5p was found to be more than 6-fold higher ......" | 26259252 | Luciferase |
hsa-miR-99b-5p | colorectal cancer | poor survival | "A total of 1893 carcinoma samples were run on the ......" | 27198570 | |
hsa-miR-99b-5p | head and neck cancer | tumorigenesis | "Selected microRNAs including members of miR-99 fam ......" | 22425712 | |
hsa-miR-99b-5p | kidney renal cell cancer | drug resistance; progression; poor survival | "MiR 99b 5p expression and response to tyrosine kin ......" | 27738339 | |
hsa-miR-99b-5p | liver cancer | metastasis; poor survival; recurrence | "miR 99b promotes metastasis of hepatocellular carc ......" | 26134929 | Luciferase |
hsa-miR-99b-5p | pancreatic cancer | drug resistance | "miR 99b targeted mTOR induction contributes to irr ......" | 23886294 | Western blot |
hsa-miR-99b-5p | prostate cancer | staging; worse prognosis | "miR 99 family of MicroRNAs suppresses the expressi ......" | 21212412 | |
hsa-miR-99b-5p | prostate cancer | drug resistance | "The miR-99 family has been shown to play an import ......" | 27340920 |
Reported gene related to hsa-miR-99b-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-99b-5p | colorectal cancer | MTOR | "Besides miR-99b-5p silencing in miR-99b-5p-positiv ......" | 26259252 |
hsa-miR-99b-5p | head and neck cancer | MTOR | "Furthermore ectopic transfection of miR-99 family ......" | 22425712 |
hsa-miR-99b-5p | pancreatic cancer | MTOR | "miR 99b targeted mTOR induction contributes to irr ......" | 23886294 |
hsa-miR-99b-5p | prostate cancer | SMARCA5 | "The miR-99 family has been shown to play an import ......" | 27340920 |
hsa-miR-99b-5p | prostate cancer | SMARCA5 | "We determined that PSA is posttranscriptionally re ......" | 21212412 |
hsa-miR-99b-5p | liver cancer | CLDN11 | "Furthermore using a dual‑luciferase assay we dem ......" | 26134929 |
hsa-miR-99b-5p | lung squamous cell cancer | FGFR3 | "miR-99b was downregulated and FGFR3 was upregulate ......" | 22969861 |
hsa-miR-99b-5p | head and neck cancer | IGF1R | "Furthermore ectopic transfection of miR-99 family ......" | 22425712 |
hsa-miR-99b-5p | prostate cancer | SMARCD1 | "The miR-99 family has been shown to play an import ......" | 27340920 |
hsa-miR-99b-5p | cervical and endocervical cancer | TRIB2 | "miR 99 inhibits cervical carcinoma cell proliferat ......" | 24137458 |
hsa-miR-99b-5p | kidney renal cell cancer | TXK | "MiR 99b 5p expression and response to tyrosine kin ......" | 27738339 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-99b-5p | ALDH1B1 | 9 cancers: BLCA; COAD; LGG; LIHC; LUAD; PAAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.348; TCGA COAD -0.164; TCGA LGG -0.2; TCGA LIHC -0.22; TCGA LUAD -0.096; TCGA PAAD -0.242; TCGA SARC -0.942; TCGA THCA -0.132; TCGA UCEC -0.121 |
hsa-miR-99b-5p | EEF2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.127; TCGA BRCA -0.171; TCGA CESC -0.097; TCGA COAD -0.103; TCGA ESCA -0.123; TCGA HNSC -0.138; TCGA LGG -0.272; TCGA LIHC -0.101; TCGA LUAD -0.066; TCGA LUSC -0.117; TCGA OV -0.249; TCGA PAAD -0.13; TCGA PRAD -0.103; TCGA STAD -0.16 |
hsa-miR-99b-5p | RNF213 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; SARC; THCA | miRNAWalker2 validate | TCGA BLCA -0.137; TCGA CESC -0.259; TCGA ESCA -0.16; TCGA HNSC -0.147; TCGA KIRC -0.149; TCGA KIRP -0.19; TCGA LIHC -0.085; TCGA LUAD -0.194; TCGA SARC -0.136; TCGA THCA -0.304 |
hsa-miR-99b-5p | MBNL1 | 11 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.224; TCGA CESC -0.103; TCGA COAD -0.07; TCGA HNSC -0.11; TCGA LUAD -0.08; TCGA LUSC -0.087; TCGA OV -0.113; TCGA SARC -0.465; TCGA THCA -0.137; TCGA STAD -0.171; TCGA UCEC -0.246 |
hsa-miR-99b-5p | EDF1 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.236; TCGA ESCA -0.187; TCGA KIRC -0.296; TCGA KIRP -0.222; TCGA LGG -0.065; TCGA LIHC -0.165; TCGA LUSC -0.105; TCGA PAAD -0.291; TCGA PRAD -0.13; TCGA UCEC -0.134 |
hsa-miR-99b-5p | RPS2 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; THCA | miRNAWalker2 validate | TCGA BRCA -0.099; TCGA ESCA -0.157; TCGA KIRC -0.326; TCGA KIRP -0.156; TCGA LGG -0.198; TCGA LUAD -0.099; TCGA LUSC -0.108; TCGA OV -0.158; TCGA PAAD -0.413; TCGA THCA -0.145 |
hsa-miR-99b-5p | ETV6 | 9 cancers: ESCA; KIRC; KIRP; LUAD; OV; PAAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA ESCA -0.124; TCGA KIRC -0.313; TCGA KIRP -0.193; TCGA LUAD -0.102; TCGA OV -0.182; TCGA PAAD -0.121; TCGA SARC -0.161; TCGA THCA -0.079; TCGA STAD -0.122 |
Enriched cancer pathways of putative targets