microRNA information: hsa-let-7d-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-let-7d-3p | miRbase |
Accession: | MIMAT0004484 | miRbase |
Precursor name: | hsa-let-7d | miRbase |
Precursor accession: | MI0000065 | miRbase |
Symbol: | MIRLET7D | HGNC |
RefSeq ID: | NR_029481 | GenBank |
Sequence: | CUAUACGACCUGCUGCCUUUCU |
Reported expression in cancers: hsa-let-7d-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-let-7d-3p | acute myeloid leukemia | deregulation | "TaqMan miRNA microarray was performed to identify ......" | 23391324 | Microarray; qPCR |
hsa-let-7d-3p | breast cancer | deregulation | "Breast cancer signatures for invasiveness and prog ......" | 22315424 | RNA-Seq |
hsa-let-7d-3p | glioblastoma | upregulation | "Specifically miR-181b miR-153 miR-145 miR-137 and ......" | 22722712 | |
hsa-let-7d-3p | pancreatic cancer | deregulation | "The primary objective of this study was to determi ......" | 22929886 | qPCR; Microarray |
hsa-let-7d-3p | prostate cancer | downregulation | "We investigated the expression profiles of 6 micro ......" | 20873592 | Microarray; in situ hybridization |
Reported cancer pathway affected by hsa-let-7d-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-let-7d-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-let-7d-3p | breast cancer | worse prognosis; progression | "Breast cancer signatures for invasiveness and prog ......" | 22315424 | |
hsa-let-7d-3p | head and neck cancer | poor survival | "Low level expression of microRNAs let 7d and miR 2 ......" | 19179615 |
Reported gene related to hsa-let-7d-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-let-7d-3p | colon cancer | IGF1R | "Focusing on the let-7d-5p/3p pair the respectively ......" | 25287248 |
hsa-let-7d-3p | colon cancer | KRAS | "Focusing on the let-7d-5p/3p pair the respectively ......" | 25287248 |
hsa-let-7d-3p | sarcoma | VIM | "Moreover let-7d induced mesenchymal-to-epithelial- ......" | 26679758 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-let-7d-3p | ABCA8 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.803; TCGA BRCA -0.705; TCGA CESC -0.627; TCGA COAD -1.449; TCGA ESCA -1.449; TCGA HNSC -0.567; TCGA LUSC -0.618; TCGA PAAD -0.923; TCGA PRAD -0.542; TCGA THCA -0.61; TCGA STAD -1.304; TCGA UCEC -0.805 |
hsa-let-7d-3p | GLIPR1 | 10 cancers: BLCA; COAD; HNSC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.609; TCGA COAD -0.338; TCGA HNSC -0.311; TCGA LUSC -0.447; TCGA PAAD -0.401; TCGA PRAD -0.469; TCGA SARC -0.205; TCGA THCA -0.528; TCGA STAD -0.295; TCGA UCEC -0.584 |
hsa-let-7d-3p | PHYHIPL | 10 cancers: BLCA; BRCA; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.409; TCGA BRCA -0.159; TCGA ESCA -0.859; TCGA LGG -0.356; TCGA LUAD -0.2; TCGA LUSC -0.795; TCGA PAAD -0.816; TCGA PRAD -0.527; TCGA SARC -0.599; TCGA STAD -0.701 |
hsa-let-7d-3p | SIGLEC6 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.487; TCGA BRCA -0.426; TCGA COAD -0.646; TCGA ESCA -0.975; TCGA HNSC -0.276; TCGA KIRP -0.857; TCGA PRAD -0.689; TCGA SARC -0.853; TCGA THCA -0.633; TCGA STAD -0.611 |
Enriched cancer pathways of putative targets