microRNA information: hsa-let-7i-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-let-7i-3p | miRbase |
Accession: | MIMAT0004585 | miRbase |
Precursor name: | hsa-let-7i | miRbase |
Precursor accession: | MI0000434 | miRbase |
Symbol: | MIRLET7I | HGNC |
RefSeq ID: | NR_029661 | GenBank |
Sequence: | CUGCGCAAGCUACUGCCUUGCU |
Reported expression in cancers: hsa-let-7i-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-let-7i-3p | breast cancer | deregulation | "We selected 18 miRNAs with predicted roles in brea ......" | 27012041 | |
hsa-let-7i-3p | colorectal cancer | deregulation | "Four miRNAs downregulated in LM let-7i miR-10b miR ......" | 25663689 | in situ hybridization |
hsa-let-7i-3p | gastric cancer | downregulation | "Decreased expression of microRNA let 7i and its as ......" | 23107361 | qPCR |
hsa-let-7i-3p | glioblastoma | downregulation | "Here miRNA expression profiles from 82 pGBM sample ......" | 25869098 | qPCR |
hsa-let-7i-3p | lung cancer | downregulation | "In this study we determined the serum miRNA profil ......" | 25386559 | Microarray |
Reported cancer pathway affected by hsa-let-7i-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-let-7i-3p | esophageal cancer | Apoptosis pathway | "BAG3 mediated miRNA let 7g and let 7i inhibit prol ......" | 26655271 | Western blot; Luciferase |
hsa-let-7i-3p | head and neck cancer | cell cycle pathway | "A global miRNA profiling was done on 51 formalin-f ......" | 20145181 | Flow cytometry |
hsa-let-7i-3p | ovarian cancer | Apoptosis pathway | "Propofol induces apoptosis of epithelial ovarian c ......" | 25556276 | Flow cytometry; MTT assay |
hsa-let-7i-3p | retinoblastoma | cell cycle pathway | "To investigate differential expression of microRNA ......" | 21941147 |
Reported cancer prognosis affected by hsa-let-7i-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-let-7i-3p | breast cancer | worse prognosis | "Breast cancer signatures for invasiveness and prog ......" | 22315424 | |
hsa-let-7i-3p | colorectal cancer | metastasis | "Comprehensive gene and microRNA expression profili ......" | 21625861 | |
hsa-let-7i-3p | colorectal cancer | metastasis; worse prognosis | "Four miRNAs downregulated in LM let-7i miR-10b miR ......" | 25663689 | |
hsa-let-7i-3p | esophageal cancer | drug resistance | "BAG3 mediated miRNA let 7g and let 7i inhibit prol ......" | 26655271 | Western blot; Luciferase |
hsa-let-7i-3p | gastric cancer | drug resistance; progression; staging; malignant trasformation; poor survival; metastasis; worse prognosis | "Decreased expression of microRNA let 7i and its as ......" | 23107361 | |
hsa-let-7i-3p | lymphoma | staging; progression | "Herein we used a global quantitative real-time pol ......" | 25503151 | |
hsa-let-7i-3p | ovarian cancer | drug resistance; staging; progression; poor survival | "MicroRNA microarray identifies Let 7i as a novel b ......" | 19074899 |
Reported gene related to hsa-let-7i-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-let-7i-3p | esophageal cancer | ABCC10 | "BAG3 mediated miRNA let 7g and let 7i inhibit prol ......" | 26655271 |
hsa-let-7i-3p | esophageal cancer | BAG3 | "BAG3 mediated miRNA let 7g and let 7i inhibit prol ......" | 26655271 |
hsa-let-7i-3p | breast cancer | ESR1 | "In this study we further found that endogenous lev ......" | 21826373 |
hsa-let-7i-3p | ovarian cancer | PGRMC1 | "Therefore progesterone may exert its effect on PGR ......" | 21109987 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-let-7i-3p | COPG2 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; OV; PAAD; PRAD | MirTarget | TCGA BLCA -0.091; TCGA BRCA -0.081; TCGA CESC -0.078; TCGA HNSC -0.124; TCGA KIRP -0.144; TCGA LUAD -0.063; TCGA OV -0.094; TCGA PAAD -0.107; TCGA PRAD -0.058 |
hsa-let-7i-3p | ADHFE1 | 9 cancers: BLCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.542; TCGA KIRC -0.758; TCGA KIRP -0.373; TCGA LIHC -0.212; TCGA LUAD -0.16; TCGA LUSC -0.431; TCGA PRAD -0.192; TCGA SARC -0.45; TCGA STAD -0.219 |
hsa-let-7i-3p | LRRC14 | 9 cancers: BLCA; BRCA; CESC; KIRP; LGG; LIHC; LUSC; PRAD; SARC | mirMAP | TCGA BLCA -0.104; TCGA BRCA -0.155; TCGA CESC -0.114; TCGA KIRP -0.127; TCGA LGG -0.085; TCGA LIHC -0.29; TCGA LUSC -0.125; TCGA PRAD -0.063; TCGA SARC -0.147 |
Enriched cancer pathways of putative targets