microRNA information: hsa-miR-10a-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-10a-3p | miRbase |
Accession: | MIMAT0004555 | miRbase |
Precursor name: | hsa-mir-10a | miRbase |
Precursor accession: | MI0000266 | miRbase |
Symbol: | MIR10A | HGNC |
RefSeq ID: | NR_029608 | GenBank |
Sequence: | CAAAUUCGUAUCUAGGGGAAUA |
Reported expression in cancers: hsa-miR-10a-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-10a-3p | acute myeloid leukemia | downregulation | "The differentially expressed microRNAs miRNAs miR ......" | 22967414 | qPCR; Microarray |
hsa-miR-10a-3p | cervical and endocervical cancer | upregulation | "Vote-counting analysis showed that up-regulation w ......" | 25920605 | |
hsa-miR-10a-3p | cervical and endocervical cancer | upregulation | "Upregulation of miR 20a and miR 10a expression lev ......" | 26427662 | qPCR |
hsa-miR-10a-3p | gastric cancer | deregulation | "miRNA expression profile in primary gastric cancer ......" | 22969895 | Microarray |
hsa-miR-10a-3p | head and neck cancer | deregulation | "A global miRNA profiling was done on 51 formalin-f ......" | 20145181 | Reverse transcription PCR |
hsa-miR-10a-3p | liver cancer | downregulation | "Because understanding the pathogenesis of viral-as ......" | 18307259 | qPCR |
hsa-miR-10a-3p | liver cancer | downregulation | "Expression levels of three identified miRNAs miR-1 ......" | 22976466 | |
hsa-miR-10a-3p | lung squamous cell cancer | deregulation | "We further validated our results by RT-qPCR for di ......" | 23756108 | qPCR |
hsa-miR-10a-3p | lung squamous cell cancer | deregulation | "Other miRNAs including miR-5100 and miR-650 were u ......" | 26870288 | |
hsa-miR-10a-3p | lymphoma | downregulation | "The expression levels of miR-10a and miR-342-3p we ......" | 26870215 | |
hsa-miR-10a-3p | pancreatic cancer | upregulation | "Retinoic acid receptor antagonists inhibit miR 10a ......" | 19747919 | Northern blot |
hsa-miR-10a-3p | prostate cancer | deregulation | "RESULTS A total of 162 miRNAs were differentially ......" | 26628405 | |
hsa-miR-10a-3p | thyroid cancer | deregulation | "Deregulated miRNAs were confirmed by quantitative ......" | 24127332 | qPCR; in situ hybridization |
Reported cancer pathway affected by hsa-miR-10a-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-10a-3p | head and neck cancer | cell cycle pathway | "A global miRNA profiling was done on 51 formalin-f ......" | 20145181 | Flow cytometry |
Reported cancer prognosis affected by hsa-miR-10a-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-10a-3p | acute myeloid leukemia | drug resistance; malignant trasformation | "MicroRNA 10a expression in FAB different subtype o ......" | 25687041 | |
hsa-miR-10a-3p | bladder cancer | poor survival | "miR-100 was under expressed in 100% of low grade p ......" | 22999546 | |
hsa-miR-10a-3p | bladder cancer | malignant trasformation | "Analyses in human urothelial cells identify methyl ......" | 23867826 | |
hsa-miR-10a-3p | breast cancer | metastasis | "Real Time RT-PCR was performed to identify the miR ......" | 22524830 | |
hsa-miR-10a-3p | breast cancer | poor survival | "Increased expression of miR 126 and miR 10a predic ......" | 23968733 | |
hsa-miR-10a-3p | breast cancer | recurrence | "Using microarray-based technology we have performe ......" | 24632820 | |
hsa-miR-10a-3p | breast cancer | malignant trasformation | "MicroRNA 10a is reduced in breast cancer and regul ......" | 25934412 | |
hsa-miR-10a-3p | breast cancer | drug resistance | "The few available studies investigating microRNA i ......" | 26473850 | |
hsa-miR-10a-3p | breast cancer | progression | "We identified eight microRNAs miR-10a miR-10b miR- ......" | 27433802 | |
hsa-miR-10a-3p | cervical and endocervical cancer | progression; worse prognosis; poor survival; staging | "Upregulation of miR 20a and miR 10a expression lev ......" | 26427662 | |
hsa-miR-10a-3p | esophageal cancer | cell migration | "To reveal miRNAs' signatures of ESCC we analyzed m ......" | 20588024 | |
hsa-miR-10a-3p | gastric cancer | metastasis; tumorigenesis | "miRNA expression profile in primary gastric cancer ......" | 22969895 | |
hsa-miR-10a-3p | glioblastoma | drug resistance | "miR 195 miR 455 3p and miR 10a * are implicated in ......" | 20444541 | |
hsa-miR-10a-3p | head and neck cancer | poor survival | "Taken together these findings strongly support the ......" | 27002147 | |
hsa-miR-10a-3p | liver cancer | malignant trasformation; worse prognosis | "Because understanding the pathogenesis of viral-as ......" | 18307259 | |
hsa-miR-10a-3p | liver cancer | metastasis | "Long non coding RNA TUSC7 acts a molecular sponge ......" | 27002617 | |
hsa-miR-10a-3p | lung cancer | drug resistance | "MicroRNA 10a silencing reverses cisplatin resistan ......" | 25586740 | |
hsa-miR-10a-3p | pancreatic cancer | metastasis | "Retinoic acid receptor antagonists inhibit miR 10a ......" | 19747919 | |
hsa-miR-10a-3p | pancreatic cancer | malignant trasformation | "miR-148a/b and miR-375 expression were found decre ......" | 21738581 |
Reported gene related to hsa-miR-10a-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-10a-3p | gastric cancer | HOXA1 | "Bioinformatic and immunoblot analysis indicated th ......" | 24498243 |
hsa-miR-10a-3p | pancreatic cancer | HOXA1 | "MicroRNA 10a is overexpressed in human pancreatic ......" | 22407312 |
hsa-miR-10a-3p | acute myeloid leukemia | BCL6 | "Luciferase reporter assay was used to analyze the ......" | 26590574 |
hsa-miR-10a-3p | cervical and endocervical cancer | CHL1 | "MicroRNA 10a targets CHL1 and promotes cell growth ......" | 22634495 |
hsa-miR-10a-3p | acute myeloid leukemia | FANCB | "MicroRNA 10a expression in FAB different subtype o ......" | 25687041 |
hsa-miR-10a-3p | pancreatic cancer | FGFR1 | "Predicted target mRNAs FGFR1 miR-10 and MLH1 miR-1 ......" | 21738581 |
hsa-miR-10a-3p | pancreatic cancer | HOXB1 | "These findings suggest that miR-10a is a key media ......" | 19747919 |
hsa-miR-10a-3p | pancreatic cancer | HOXB3 | "These findings suggest that miR-10a is a key media ......" | 19747919 |
hsa-miR-10a-3p | liver cancer | HOXB4 | "The concordance for HOXB4 methylation alteration a ......" | 22976466 |
hsa-miR-10a-3p | gastric cancer | HOXD10 | "While in GES-1 cells miR-10 overexpression resulte ......" | 22293682 |
hsa-miR-10a-3p | breast cancer | HOXD4 | "Here we show that microRNA-10a miR-10a targets a h ......" | 19232136 |
hsa-miR-10a-3p | acute myeloid leukemia | MDM4 | "miR 10a overexpression is associated with NPM1 mut ......" | 21784052 |
hsa-miR-10a-3p | pancreatic cancer | MLH1 | "Predicted target mRNAs FGFR1 miR-10 and MLH1 miR-1 ......" | 21738581 |
hsa-miR-10a-3p | acute myeloid leukemia | NPM1 | "miR 10a overexpression is associated with NPM1 mut ......" | 21784052 |
hsa-miR-10a-3p | bladder cancer | PTCRA | "miR-100 was under expressed in 100% of low grade p ......" | 22999546 |
hsa-miR-10a-3p | lymphoma | TIAM1 | "Expression of microRNA 10a microRNA 342 3p and the ......" | 26870215 |
hsa-miR-10a-3p | liver cancer | TUSC7 | "Long non coding RNA TUSC7 acts a molecular sponge ......" | 27002617 |
hsa-miR-10a-3p | chronic myeloid leukemia | USF2 | "Down regulation of hsa miR 10a in chronic myeloid ......" | 19074828 |
hsa-miR-10a-3p | thyroid cancer | YAP1 | "Overexpression of miR 10a and miR 375 and downregu ......" | 23685355 |
Expression profile in cancer corhorts: