microRNA information: hsa-miR-1179
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1179 | miRbase |
| Accession: | MIMAT0005824 | miRbase |
| Precursor name: | hsa-mir-1179 | miRbase |
| Precursor accession: | MI0006272 | miRbase |
| Symbol: | MIR1179 | HGNC |
| RefSeq ID: | NR_031590 | GenBank |
| Sequence: | AAGCAUUCUUUCAUUGGUUGG |
Reported expression in cancers: hsa-miR-1179
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-1179 | colorectal cancer | deregulation | "To identify miRNA expression patterns associated w ......" | 21174058 | qPCR; Microarray |
| hsa-miR-1179 | esophageal cancer | upregulation | "miR 1179 promotes cell invasion through SLIT2/ROBO ......" | 25755718 | |
| hsa-miR-1179 | thyroid cancer | deregulation | "MicroRNA deep sequencing reveals master regulators ......" | 25720323 | RNA-Seq |
Reported cancer pathway affected by hsa-miR-1179
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-1179
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1179 | colorectal cancer | metastasis | "To identify miRNA expression patterns associated w ......" | 21174058 | |
| hsa-miR-1179 | esophageal cancer | metastasis | "miR 1179 promotes cell invasion through SLIT2/ROBO ......" | 25755718 | Luciferase |
Reported gene related to hsa-miR-1179
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-1179 | esophageal cancer | SLIT2 | "Bioinformatics analysis indicated that SLIT2 actin ......" | 25755718 |