microRNA information: hsa-miR-1224-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1224-3p | miRbase |
| Accession: | MIMAT0005459 | miRbase |
| Precursor name: | hsa-mir-1224 | miRbase |
| Precursor accession: | MI0003764 | miRbase |
| Symbol: | MIR1224 | HGNC |
| RefSeq ID: | NR_030410 | GenBank |
| Sequence: | CCCCACCUCCUCUCUCCUCAG |
Reported expression in cancers: hsa-miR-1224-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-1224-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-1224-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1224-3p | bladder cancer | malignant trasformation; staging; worse prognosis | "The methylation status of 865 small RNAs was evalu ......" | 21138856 |
Reported gene related to hsa-miR-1224-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|