---

microRNA information: hsa-miR-1225-3p

Section	ID	link
Mature name:	hsa-miR-1225-3p	miRbase
Accession:	MIMAT0005573	miRbase
Precursor name:	hsa-mir-1225	miRbase
Precursor accession:	MI0006311	miRbase
Symbol:	MIR1225	HGNC
RefSeq ID:	NR_030646	GenBank
Sequence:	UGAGCCCCUGUGCCGCCCCCAG

---

Reported expression in cancers: hsa-miR-1225-3p

miRNA	cancer	regulation	reporting	PUBMED	method

---

Reported cancer pathway affected by hsa-miR-1225-3p

miRNA	cancer	pathway	reporting	PUBMED	functional study

---

Reported cancer prognosis affected by hsa-miR-1225-3p

miRNA	cancer	prognosis	reporting	PUBMED	functional study
hsa-miR-1225-3p	gastric cancer	metastasis	"MicroRNA 1225 5p inhibits proliferation and metast ......"	26684358

---

Reported gene related to hsa-miR-1225-3p

miRNA	cancer	gene	reporting	PUBMED
hsa-miR-1225-3p	gastric cancer	INSR	"MicroRNA 1225 5p inhibits proliferation and metast ......"	26684358