microRNA information: hsa-miR-125a-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-125a-5p | miRbase |
| Accession: | MIMAT0000443 | miRbase |
| Precursor name: | hsa-mir-125a | miRbase |
| Precursor accession: | MI0000469 | miRbase |
| Symbol: | MIR125A | HGNC |
| RefSeq ID: | NR_029693 | GenBank |
| Sequence: | UCCCUGAGACCCUUUAACCUGUGA |
Reported expression in cancers: hsa-miR-125a-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-125a-5p | breast cancer | downregulation | "In addition HDACi mediated the expression of miR-1 ......" | 25531695 | |
| hsa-miR-125a-5p | breast cancer | downregulation | "miR 125a 5p expression is associated with the age ......" | 26782438 | |
| hsa-miR-125a-5p | cervical and endocervical cancer | downregulation | "MiR-125a has been characterized as a tumor suppres ......" | 26389681 | |
| hsa-miR-125a-5p | colon cancer | downregulation | "MiR-125 is a family of miRNAs that have been shown ......" | 26297542 | |
| hsa-miR-125a-5p | colorectal cancer | downregulation | "In contrast expression levels of let-7a-5p 7e-5p 7 ......" | 26643896 | |
| hsa-miR-125a-5p | colorectal cancer | downregulation | "Hypermethylation Associated Silencing of miR 125a ......" | 26693202 | Reverse transcription PCR; qPCR |
| hsa-miR-125a-5p | esophageal cancer | deregulation | "Differentially-expressed miRNAs were analyzed usin ......" | 23534712 | Reverse transcription PCR |
| hsa-miR-125a-5p | gastric cancer | downregulation | "MicroRNA 125a-5p miR-125a-5p has been reported to ......" | 21220473 | qPCR |
| hsa-miR-125a-5p | liver cancer | upregulation | "Studies have been shown that miR-125a plays an imp ......" | 22768249 | qPCR |
| hsa-miR-125a-5p | lung squamous cell cancer | downregulation | "Differential expression of miR 125a 5p and let 7e ......" | 24945821 | qPCR |
| hsa-miR-125a-5p | lymphoma | downregulation | "Clinical and epidemiological data suggest that chr ......" | 22307176 | Reverse transcription PCR; in situ hybridization |
| hsa-miR-125a-5p | ovarian cancer | downregulation | "miRNA mimics and miRNA inhibitors were used in qua ......" | 26646586 | qPCR |
| hsa-miR-125a-5p | ovarian cancer | downregulation | "The miR-125a was downregulated in several types of ......" | 27133078 | |
| hsa-miR-125a-5p | pancreatic cancer | upregulation | "Objective To investigate the effects of miR-125a-5 ......" | 27594154 | qPCR |
| hsa-miR-125a-5p | prostate cancer | downregulation | "Quantitative reverse transcription-polymerase chai ......" | 26719710 | Reverse transcription PCR; qPCR |
| hsa-miR-125a-5p | retinoblastoma | downregulation | "In this study we performed microarray analysis fol ......" | 27094723 | qPCR; Microarray |
| hsa-miR-125a-5p | sarcoma | upregulation | "In addition we found that curcumin suppressed the ......" | 27231954 | |
| hsa-miR-125a-5p | thyroid cancer | deregulation | "Both tumour types showed upregulation of miR-125a- ......" | 24443580 |
Reported cancer pathway affected by hsa-miR-125a-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-125a-5p | acute myeloid leukemia | cell cycle pathway; Apoptosis pathway | "miR 125a regulates cell cycle proliferation and ap ......" | 24484870 | |
| hsa-miR-125a-5p | breast cancer | Apoptosis pathway | "MicroRNA 125a represses cell growth by targeting H ......" | 19875930 | |
| hsa-miR-125a-5p | breast cancer | Apoptosis pathway | "Functional cooperation of miR 125a miR 125b and mi ......" | 23519125 | |
| hsa-miR-125a-5p | breast cancer | Apoptosis pathway | "HDAC inhibitors target HDAC5 upregulate microRNA 1 ......" | 25531695 | |
| hsa-miR-125a-5p | breast cancer | Hippo signaling pathway | "MicroRNA 125a influences breast cancer stem cells ......" | 25962054 | |
| hsa-miR-125a-5p | cervical and endocervical cancer | Epithelial mesenchymal transition pathway; cell cycle pathway | "MiR 125a suppresses tumor growth invasion and meta ......" | 26389681 | Luciferase |
| hsa-miR-125a-5p | cervical and endocervical cancer | Apoptosis pathway | "MiR 125a promotes paclitaxel sensitivity in cervic ......" | 26878391 | |
| hsa-miR-125a-5p | colon cancer | Apoptosis pathway | "miR 125a 5p inhibits cell proliferation and induce ......" | 26297542 | |
| hsa-miR-125a-5p | glioblastoma | Apoptosis pathway | "miR 29b and miR 125a regulate podoplanin and suppr ......" | 20665731 | |
| hsa-miR-125a-5p | glioblastoma | cell cycle pathway | "An unbiased functional microRNA screen identified ......" | 27399532 | |
| hsa-miR-125a-5p | liver cancer | cell cycle pathway | "Sirtuin7 oncogenic potential in human hepatocellul ......" | 23079745 | |
| hsa-miR-125a-5p | liver cancer | mTOR signaling pathway | "miR 125a inhibits the migration and invasion of li ......" | 26622553 | Western blot; Colony formation; Transwell assay |
| hsa-miR-125a-5p | lung cancer | Apoptosis pathway | "MicroRNA HSA miR 125a 5p induces apoptosis by acti ......" | 21777146 | Flow cytometry |
| hsa-miR-125a-5p | lung cancer | Apoptosis pathway | "MicroRNA hsa miR 125a 3p activates p53 and induces ......" | 24044511 | |
| hsa-miR-125a-5p | ovarian cancer | Apoptosis pathway | "miRNA mimics and miRNA inhibitors were used in qua ......" | 26646586 | Western blot; Luciferase |
| hsa-miR-125a-5p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "Effects of miR 125a 5p on Cell ProliferationApopto ......" | 27594154 | Flow cytometry; Colony formation |
Reported cancer prognosis affected by hsa-miR-125a-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-125a-5p | acute myeloid leukemia | drug resistance; progression | "miR 125a regulates cell cycle proliferation and ap ......" | 24484870 | |
| hsa-miR-125a-5p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
| hsa-miR-125a-5p | breast cancer | tumorigenesis | "Germline mutation of microRNA 125a is associated w ......" | 19411564 | |
| hsa-miR-125a-5p | breast cancer | cell migration | "MicroRNA 125a represses cell growth by targeting H ......" | 19875930 | |
| hsa-miR-125a-5p | breast cancer | drug resistance | "MiRNA microarray analysis identified 299 and 226 m ......" | 21399894 | |
| hsa-miR-125a-5p | breast cancer | tumor size | "Stem-loop real-time RT-PCR was used to detect the ......" | 25047098 | |
| hsa-miR-125a-5p | breast cancer | tumorigenesis; poor survival; tumor size | "miR 125a 5p is a prognostic biomarker that targets ......" | 25504437 | |
| hsa-miR-125a-5p | breast cancer | tumorigenesis; progression | "HDAC inhibitors target HDAC5 upregulate microRNA 1 ......" | 25531695 | |
| hsa-miR-125a-5p | breast cancer | poor survival | "Association between miR 125a rs12976445 and surviv ......" | 25628797 | |
| hsa-miR-125a-5p | breast cancer | malignant trasformation | "MicroRNA 125a influences breast cancer stem cells ......" | 25962054 | |
| hsa-miR-125a-5p | breast cancer | malignant trasformation; metastasis; tumor size; progression | "miR 125a 5p expression is associated with the age ......" | 26782438 | |
| hsa-miR-125a-5p | cervical and endocervical cancer | metastasis; staging; tumor size; tumorigenesis; progression | "MiR 125a suppresses tumor growth invasion and meta ......" | 26389681 | Luciferase |
| hsa-miR-125a-5p | cervical and endocervical cancer | drug resistance | "MiR 125a promotes paclitaxel sensitivity in cervic ......" | 26878391 | |
| hsa-miR-125a-5p | colorectal cancer | progression | "Clinicopathological significance of microRNA 21 an ......" | 19921579 | |
| hsa-miR-125a-5p | colorectal cancer | tumorigenesis | "In contrast expression levels of let-7a-5p 7e-5p 7 ......" | 26643896 | |
| hsa-miR-125a-5p | esophageal cancer | staging; poor survival | "Five polymorphisms miR-146a rs2910164 miR-196a2 rs ......" | 24288122 | |
| hsa-miR-125a-5p | esophageal cancer | drug resistance | "An in-vitro model of acquired chemotherapy resista ......" | 25356050 | |
| hsa-miR-125a-5p | gastric cancer | metastasis; malignant trasformation; worse prognosis; tumor size; poor survival | "MicroRNA 125a 5p is an independent prognostic fact ......" | 21220473 | |
| hsa-miR-125a-5p | glioblastoma | differentiation | "In this study we found that miR-125a-5p is an impo ......" | 25542152 | |
| hsa-miR-125a-5p | glioblastoma | drug resistance | "An unbiased functional microRNA screen identified ......" | 27399532 | |
| hsa-miR-125a-5p | liver cancer | metastasis; tumorigenesis; malignant trasformation | "Ectopic expression of MiR 125a inhibits the prolif ......" | 22768249 | Western blot; Luciferase; RNAi |
| hsa-miR-125a-5p | liver cancer | malignant trasformation | "miR 125a inhibits the migration and invasion of li ......" | 26622553 | Western blot; Colony formation; Transwell assay |
| hsa-miR-125a-5p | lung cancer | tumorigenesis | "Epidermal growth factor receptor regulated miR 125 ......" | 19702827 | |
| hsa-miR-125a-5p | lung cancer | staging | "The study contained 2 phases: first preliminary ma ......" | 25639977 | |
| hsa-miR-125a-5p | lung squamous cell cancer | metastasis; staging; cell migration | "Hsa miR 125a 3p and hsa miR 125a 5p are downregula ......" | 20569443 | |
| hsa-miR-125a-5p | lung squamous cell cancer | progression; worse prognosis; differentiation; poor survival | "Differential expression of miR 125a 5p and let 7e ......" | 24945821 | |
| hsa-miR-125a-5p | ovarian cancer | cell migration | "miRNA mimics and miRNA inhibitors were used in qua ......" | 26646586 | Western blot; Luciferase |
| hsa-miR-125a-5p | ovarian cancer | metastasis; staging | "MiR 125a regulates ovarian cancer proliferation an ......" | 27133078 | Western blot; Luciferase; MTT assay; Transwell assay |
| hsa-miR-125a-5p | pancreatic cancer | drug resistance | "MiR 125a regulates chemo sensitivity to gemcitabin ......" | 26758190 | Luciferase |
| hsa-miR-125a-5p | pancreatic cancer | malignant trasformation; staging | "Effects of miR 125a 5p on Cell ProliferationApopto ......" | 27594154 | Flow cytometry; Colony formation |
| hsa-miR-125a-5p | prostate cancer | motility | "MicroRNA miR 125a 3p modulates molecular pathway o ......" | 25594017 | |
| hsa-miR-125a-5p | retinoblastoma | staging; progression | "Suppression of microRNA 125a 5p upregulates the TA ......" | 27094723 |
Reported gene related to hsa-miR-125a-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-125a-5p | acute myeloid leukemia | EGFR | "miR 125a regulates cell cycle proliferation and ap ......" | 24484870 |
| hsa-miR-125a-5p | ovarian cancer | EGFR | "We report that EGFR signaling leads to transcripti ......" | 19881956 |
| hsa-miR-125a-5p | retinoblastoma | EGFR | "Suppression of microRNA 125a 5p upregulates the TA ......" | 27094723 |
| hsa-miR-125a-5p | breast cancer | TAZ | "Modulation of miR-125a led to a change in the acti ......" | 25962054 |
| hsa-miR-125a-5p | glioblastoma | TAZ | "In this study we found that miR-125a-5p is an impo ......" | 25542152 |
| hsa-miR-125a-5p | retinoblastoma | TAZ | "Suppression of microRNA 125a 5p upregulates the TA ......" | 27094723 |
| hsa-miR-125a-5p | cervical and endocervical cancer | TP53 | "Mechanistically inactivation of miR-125a during ce ......" | 26389681 |
| hsa-miR-125a-5p | liver cancer | TP53 | "Furthermore treatment of HCC cells with 5-aza-2'-d ......" | 23079745 |
| hsa-miR-125a-5p | lung cancer | TP53 | "In addition wild-type p53 mRNA and protein express ......" | 21777146 |
| hsa-miR-125a-5p | lung cancer | EGF | "Epidermal growth factor receptor regulated miR 125 ......" | 19702827 |
| hsa-miR-125a-5p | ovarian cancer | EGF | "The epidermal growth factor receptor responsive mi ......" | 19881956 |
| hsa-miR-125a-5p | gastric cancer | ERBB2 | "We investigated a tumor inhibitory effect of miR-1 ......" | 21220473 |
| hsa-miR-125a-5p | sarcoma | ERBB2 | "Moreover restoration of the expression of ErbB2 an ......" | 26966351 |
| hsa-miR-125a-5p | cervical and endocervical cancer | STAT3 | "MiR 125a suppresses tumor growth invasion and meta ......" | 26389681 |
| hsa-miR-125a-5p | cervical and endocervical cancer | STAT3 | "MiR 125a promotes paclitaxel sensitivity in cervic ......" | 26878391 |
| hsa-miR-125a-5p | cervical and endocervical cancer | ABL2 | "MicroRNA 125a 5p modulates human cervical carcinom ......" | 26766902 |
| hsa-miR-125a-5p | ovarian cancer | ARID3B | "We identify AT-rich interactive domain 3B ARID3B a ......" | 19881956 |
| hsa-miR-125a-5p | prostate cancer | CASP3 | "Direct regulation of miR-125a-5p on its downstream ......" | 26719710 |
| hsa-miR-125a-5p | ovarian cancer | EIF4EBP1 | "Increased expression of miR-125a and miR-125b inhi ......" | 26646586 |
| hsa-miR-125a-5p | breast cancer | ELAVL1 | "MicroRNA 125a represses cell growth by targeting H ......" | 19875930 |
| hsa-miR-125a-5p | ovarian cancer | ETV4 | "We report that EGFR signaling leads to transcripti ......" | 19881956 |
| hsa-miR-125a-5p | ovarian cancer | GALNT14 | "MiR 125a regulates ovarian cancer proliferation an ......" | 27133078 |
| hsa-miR-125a-5p | lung cancer | HBE1 | "The authors showed that hsa-miR-125a-5p expression ......" | 21777146 |
| hsa-miR-125a-5p | breast cancer | HDAC4 | "miR 125a 5p is a prognostic biomarker that targets ......" | 25504437 |
| hsa-miR-125a-5p | breast cancer | HDAC5 | "HDAC inhibitors target HDAC5 upregulate microRNA 1 ......" | 25531695 |
| hsa-miR-125a-5p | breast cancer | HDAC9 | "HDAC inhibitors target HDAC5 upregulate microRNA 1 ......" | 25531695 |
| hsa-miR-125a-5p | colorectal cancer | IBSP | "We investigated the methylation status of miR-125 ......" | 26693202 |
| hsa-miR-125a-5p | breast cancer | LIF | "MicroRNA 125a influences breast cancer stem cells ......" | 25962054 |
| hsa-miR-125a-5p | breast cancer | LIFR | "Gain of function and loss of function of LIFR dire ......" | 25962054 |
| hsa-miR-125a-5p | melanoma | LIN28B | "Mechanistically we discovered that Lin28B a well-c ......" | 26071398 |
| hsa-miR-125a-5p | pancreatic cancer | MIA | "After the expression level of miR-125a-5p in Panc- ......" | 27594154 |
| hsa-miR-125a-5p | liver cancer | MMP11 | "Ectopic expression of MiR 125a inhibits the prolif ......" | 22768249 |
| hsa-miR-125a-5p | liver cancer | MTOR | "The protein and messenger RNA expression of phosph ......" | 26622553 |
| hsa-miR-125a-5p | colorectal cancer | MTUS1 | "In contrast let-7a-5p 7e-5p 7f-5p miR-125a-5p and ......" | 26643896 |
| hsa-miR-125a-5p | prostate cancer | NAIF1 | "MicroRNA 125a 5p regulates cancer cell proliferati ......" | 26719710 |
| hsa-miR-125a-5p | breast cancer | NR4A1 | "There were no significant correlations between miR ......" | 26782438 |
| hsa-miR-125a-5p | glioblastoma | PDPN | "miR 29b and miR 125a regulate podoplanin and suppr ......" | 20665731 |
| hsa-miR-125a-5p | breast cancer | RUNX3 | "Thus a regulatory loop may exist in human breast c ......" | 25531695 |
| hsa-miR-125a-5p | lung squamous cell cancer | SCLC1 | "Cisplatin CDDP treatment of SCLC cells resulted in ......" | 25833836 |
| hsa-miR-125a-5p | liver cancer | SIRT7 | "A regulatory loop is proposed whereby SIRT7 inhibi ......" | 23079745 |
| hsa-miR-125a-5p | breast cancer | TSTA3 | "miR-125a-5p and miR-125b are upstream targets of T ......" | 26531722 |
| hsa-miR-125a-5p | liver cancer | VEGFA | "Ectopic expression of MiR 125a inhibits the prolif ......" | 22768249 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-125a-5p | ATL2 | 12 cancers: BLCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; UCEC | miRNAWalker2 validate; miRanda | TCGA BLCA -0.2; TCGA CESC -0.124; TCGA COAD -0.119; TCGA HNSC -0.13; TCGA LIHC -0.113; TCGA LUAD -0.099; TCGA LUSC -0.156; TCGA OV -0.11; TCGA PAAD -0.109; TCGA PRAD -0.118; TCGA SARC -0.175; TCGA UCEC -0.092 |
hsa-miR-125a-5p | BAK1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; OV; PAAD; THCA; UCEC | miRNAWalker2 validate; PITA; miRanda; miRNATAP | TCGA BLCA -0.103; TCGA BRCA -0.193; TCGA CESC -0.195; TCGA COAD -0.177; TCGA ESCA -0.301; TCGA KIRC -0.154; TCGA LGG -0.055; TCGA LUAD -0.061; TCGA OV -0.196; TCGA PAAD -0.392; TCGA THCA -0.174; TCGA UCEC -0.181 |
hsa-miR-125a-5p | CORO1C | 13 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.408; TCGA CESC -0.112; TCGA HNSC -0.16; TCGA KIRC -0.371; TCGA KIRP -0.35; TCGA LGG -0.358; TCGA LUAD -0.122; TCGA LUSC -0.284; TCGA OV -0.135; TCGA PAAD -0.26; TCGA SARC -0.446; TCGA THCA -0.192; TCGA UCEC -0.241 |
hsa-miR-125a-5p | CRK | 9 cancers: BLCA; COAD; ESCA; HNSC; LGG; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.135; TCGA COAD -0.144; TCGA ESCA -0.069; TCGA HNSC -0.211; TCGA LGG -0.083; TCGA PAAD -0.185; TCGA PRAD -0.066; TCGA THCA -0.088; TCGA STAD -0.061 |
hsa-miR-125a-5p | E2F7 | 14 cancers: BLCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.216; TCGA CESC -0.266; TCGA COAD -0.168; TCGA HNSC -0.205; TCGA KIRC -0.892; TCGA LGG -0.268; TCGA LIHC -0.308; TCGA LUAD -0.522; TCGA LUSC -0.839; TCGA OV -0.455; TCGA PAAD -0.697; TCGA PRAD -0.264; TCGA SARC -0.392; TCGA STAD -0.436 |
hsa-miR-125a-5p | ENO1 | 13 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; OV; PAAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.145; TCGA BRCA -0.136; TCGA CESC -0.181; TCGA ESCA -0.17; TCGA KIRC -0.139; TCGA KIRP -0.141; TCGA LUAD -0.197; TCGA LUSC -0.145; TCGA OV -0.285; TCGA PAAD -0.155; TCGA SARC -0.191; TCGA THCA -0.065; TCGA UCEC -0.297 |
hsa-miR-125a-5p | G2E3 | 12 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.108; TCGA CESC -0.109; TCGA COAD -0.188; TCGA HNSC -0.122; TCGA LGG -0.075; TCGA LUAD -0.265; TCGA LUSC -0.263; TCGA OV -0.11; TCGA PRAD -0.153; TCGA THCA -0.062; TCGA STAD -0.201; TCGA UCEC -0.139 |
hsa-miR-125a-5p | MRPL50 | 13 cancers: BLCA; CESC; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.121; TCGA CESC -0.136; TCGA COAD -0.159; TCGA ESCA -0.281; TCGA LGG -0.137; TCGA LIHC -0.081; TCGA LUAD -0.12; TCGA LUSC -0.266; TCGA OV -0.165; TCGA PAAD -0.13; TCGA PRAD -0.099; TCGA STAD -0.183; TCGA UCEC -0.241 |
hsa-miR-125a-5p | NIN | 12 cancers: BLCA; CESC; HNSC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate; miRanda | TCGA BLCA -0.247; TCGA CESC -0.186; TCGA HNSC -0.141; TCGA KIRP -0.113; TCGA LGG -0.166; TCGA LUAD -0.068; TCGA LUSC -0.125; TCGA OV -0.114; TCGA PRAD -0.116; TCGA SARC -0.196; TCGA THCA -0.244; TCGA UCEC -0.168 |
hsa-miR-125a-5p | NPM1 | 12 cancers: BLCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.157; TCGA COAD -0.114; TCGA ESCA -0.185; TCGA KIRC -0.167; TCGA LGG -0.21; TCGA LIHC -0.091; TCGA LUAD -0.199; TCGA LUSC -0.211; TCGA PAAD -0.096; TCGA PRAD -0.103; TCGA STAD -0.201; TCGA UCEC -0.278 |
hsa-miR-125a-5p | PANX1 | 9 cancers: BLCA; CESC; LGG; LUAD; PAAD; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate; miRanda | TCGA BLCA -0.255; TCGA CESC -0.134; TCGA LGG -0.196; TCGA LUAD -0.178; TCGA PAAD -0.167; TCGA PRAD -0.083; TCGA SARC -0.265; TCGA THCA -0.117; TCGA UCEC -0.102 |
hsa-miR-125a-5p | PGM3 | 13 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.091; TCGA COAD -0.138; TCGA ESCA -0.243; TCGA HNSC -0.087; TCGA KIRC -0.158; TCGA LGG -0.261; TCGA LUAD -0.214; TCGA LUSC -0.142; TCGA PAAD -0.251; TCGA PRAD -0.151; TCGA THCA -0.095; TCGA STAD -0.096; TCGA UCEC -0.186 |
hsa-miR-125a-5p | PPP2R5E | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.203; TCGA CESC -0.179; TCGA COAD -0.207; TCGA ESCA -0.093; TCGA HNSC -0.259; TCGA LGG -0.073; TCGA LUAD -0.191; TCGA LUSC -0.174; TCGA OV -0.112; TCGA PRAD -0.183; TCGA SARC -0.146; TCGA THCA -0.126; TCGA STAD -0.115; TCGA UCEC -0.159 |
hsa-miR-125a-5p | PRC1 | 18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.23; TCGA BRCA -0.127; TCGA CESC -0.152; TCGA COAD -0.191; TCGA ESCA -0.346; TCGA HNSC -0.158; TCGA KIRC -0.408; TCGA LGG -0.182; TCGA LIHC -0.245; TCGA LUAD -0.534; TCGA LUSC -0.62; TCGA OV -0.434; TCGA PAAD -0.454; TCGA PRAD -0.234; TCGA SARC -0.236; TCGA THCA -0.155; TCGA STAD -0.225; TCGA UCEC -0.285 |
hsa-miR-125a-5p | RRP1B | 12 cancers: BLCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRanda | TCGA BLCA -0.081; TCGA CESC -0.146; TCGA COAD -0.093; TCGA HNSC -0.13; TCGA LGG -0.123; TCGA LIHC -0.082; TCGA LUAD -0.158; TCGA LUSC -0.161; TCGA PRAD -0.067; TCGA THCA -0.06; TCGA STAD -0.135; TCGA UCEC -0.123 |
hsa-miR-125a-5p | TFRC | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.15; TCGA BRCA -0.093; TCGA CESC -0.16; TCGA COAD -0.204; TCGA HNSC -0.291; TCGA LUAD -0.152; TCGA LUSC -0.541; TCGA OV -0.449; TCGA PAAD -0.422; TCGA SARC -0.293; TCGA THCA -0.29; TCGA STAD -0.187; TCGA UCEC -0.477 |
hsa-miR-125a-5p | TPI1 | 12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.082; TCGA BRCA -0.163; TCGA COAD -0.131; TCGA ESCA -0.215; TCGA KIRC -0.348; TCGA KIRP -0.124; TCGA LIHC -0.104; TCGA LUAD -0.269; TCGA LUSC -0.315; TCGA OV -0.232; TCGA PAAD -0.207; TCGA UCEC -0.235 |
hsa-miR-125a-5p | TPM4 | 9 cancers: BLCA; CESC; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; THCA | miRNAWalker2 validate | TCGA BLCA -0.125; TCGA CESC -0.136; TCGA ESCA -0.197; TCGA LUAD -0.107; TCGA LUSC -0.116; TCGA PAAD -0.382; TCGA PRAD -0.071; TCGA SARC -0.392; TCGA THCA -0.262 |
hsa-miR-125a-5p | XPO1 | 9 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; OV; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.077; TCGA COAD -0.118; TCGA HNSC -0.069; TCGA KIRP -0.1; TCGA LUAD -0.159; TCGA LUSC -0.229; TCGA OV -0.075; TCGA STAD -0.16; TCGA UCEC -0.111 |
hsa-miR-125a-5p | YES1 | 12 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.081; TCGA CESC -0.107; TCGA COAD -0.138; TCGA HNSC -0.128; TCGA LUAD -0.192; TCGA LUSC -0.252; TCGA OV -0.209; TCGA PAAD -0.174; TCGA PRAD -0.15; TCGA THCA -0.086; TCGA STAD -0.139; TCGA UCEC -0.095 |
hsa-miR-125a-5p | SUV39H1 | 12 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.089; TCGA BRCA -0.146; TCGA ESCA -0.194; TCGA KIRC -0.201; TCGA LGG -0.072; TCGA LIHC -0.247; TCGA LUAD -0.157; TCGA LUSC -0.291; TCGA OV -0.216; TCGA SARC -0.227; TCGA STAD -0.101; TCGA UCEC -0.099 |
hsa-miR-125a-5p | PARP14 | 10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; STAD | MirTarget; miRanda; miRNATAP | TCGA BLCA -0.151; TCGA CESC -0.144; TCGA HNSC -0.116; TCGA KIRC -0.378; TCGA KIRP -0.333; TCGA LIHC -0.076; TCGA PAAD -0.15; TCGA PRAD -0.116; TCGA SARC -0.3; TCGA STAD -0.135 |
hsa-miR-125a-5p | WARS | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; PAAD; THCA; UCEC | MirTarget; miRanda; miRNATAP | TCGA BLCA -0.552; TCGA BRCA -0.183; TCGA CESC -0.283; TCGA HNSC -0.259; TCGA KIRC -0.122; TCGA LUAD -0.137; TCGA PAAD -0.217; TCGA THCA -0.403; TCGA UCEC -0.311 |
hsa-miR-125a-5p | CSNK2A1 | 11 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD | MirTarget; PITA; miRanda | TCGA BLCA -0.058; TCGA CESC -0.109; TCGA ESCA -0.086; TCGA HNSC -0.074; TCGA LGG -0.115; TCGA LUAD -0.136; TCGA LUSC -0.191; TCGA PAAD -0.094; TCGA PRAD -0.132; TCGA THCA -0.088; TCGA STAD -0.086 |
hsa-miR-125a-5p | PSMB8 | 11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; SARC; THCA | MirTarget; miRanda; miRNATAP | TCGA BLCA -0.12; TCGA BRCA -0.236; TCGA ESCA -0.239; TCGA KIRC -0.635; TCGA KIRP -0.436; TCGA LGG -0.139; TCGA LIHC -0.143; TCGA LUAD -0.097; TCGA PAAD -0.394; TCGA SARC -0.297; TCGA THCA -0.108 |
hsa-miR-125a-5p | PCGF6 | 13 cancers: BLCA; CESC; COAD; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRanda | TCGA BLCA -0.103; TCGA CESC -0.069; TCGA COAD -0.138; TCGA LGG -0.201; TCGA LIHC -0.073; TCGA LUAD -0.183; TCGA LUSC -0.26; TCGA OV -0.116; TCGA PAAD -0.129; TCGA PRAD -0.084; TCGA THCA -0.078; TCGA STAD -0.113; TCGA UCEC -0.224 |
hsa-miR-125a-5p | DPH2 | 15 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRanda; miRNATAP | TCGA BLCA -0.092; TCGA BRCA -0.134; TCGA CESC -0.183; TCGA ESCA -0.246; TCGA KIRP -0.089; TCGA LIHC -0.154; TCGA LUAD -0.114; TCGA LUSC -0.142; TCGA OV -0.247; TCGA PAAD -0.225; TCGA PRAD -0.087; TCGA SARC -0.121; TCGA THCA -0.093; TCGA STAD -0.148; TCGA UCEC -0.081 |
hsa-miR-125a-5p | DLD | 11 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget; miRanda | TCGA BLCA -0.111; TCGA COAD -0.1; TCGA HNSC -0.065; TCGA KIRP -0.133; TCGA LUAD -0.133; TCGA LUSC -0.231; TCGA OV -0.187; TCGA PRAD -0.06; TCGA THCA -0.156; TCGA STAD -0.098; TCGA UCEC -0.262 |
hsa-miR-125a-5p | TRIM14 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD | MirTarget; PITA; miRanda | TCGA BLCA -0.171; TCGA CESC -0.238; TCGA COAD -0.114; TCGA ESCA -0.216; TCGA HNSC -0.191; TCGA KIRC -0.776; TCGA KIRP -0.457; TCGA PAAD -0.234; TCGA PRAD -0.101; TCGA SARC -0.467; TCGA STAD -0.168 |
hsa-miR-125a-5p | B3GALNT2 | 12 cancers: BLCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget; miRanda; miRNATAP | TCGA BLCA -0.148; TCGA CESC -0.148; TCGA COAD -0.09; TCGA HNSC -0.083; TCGA LIHC -0.076; TCGA LUAD -0.115; TCGA LUSC -0.223; TCGA PAAD -0.131; TCGA PRAD -0.076; TCGA SARC -0.269; TCGA STAD -0.106; TCGA UCEC -0.174 |
hsa-miR-125a-5p | DCAF10 | 11 cancers: BLCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.143; TCGA CESC -0.099; TCGA HNSC -0.188; TCGA LIHC -0.063; TCGA LUAD -0.15; TCGA LUSC -0.17; TCGA OV -0.094; TCGA PRAD -0.13; TCGA SARC -0.094; TCGA STAD -0.11; TCGA UCEC -0.076 |
hsa-miR-125a-5p | CGREF1 | 12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA | MirTarget; miRanda | TCGA BLCA -0.374; TCGA BRCA -0.254; TCGA CESC -0.555; TCGA KIRC -1.313; TCGA KIRP -0.777; TCGA LGG -0.33; TCGA LIHC -0.279; TCGA LUAD -0.386; TCGA LUSC -0.829; TCGA PAAD -0.473; TCGA PRAD -0.25; TCGA THCA -0.829 |
hsa-miR-125a-5p | DHX33 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.217; TCGA CESC -0.173; TCGA COAD -0.176; TCGA ESCA -0.145; TCGA HNSC -0.387; TCGA LGG -0.137; TCGA LUAD -0.134; TCGA LUSC -0.311; TCGA PRAD -0.361; TCGA THCA -0.169; TCGA STAD -0.132 |
hsa-miR-125a-5p | SBNO1 | 9 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.297; TCGA CESC -0.33; TCGA COAD -0.106; TCGA HNSC -0.509; TCGA LUAD -0.263; TCGA LUSC -0.269; TCGA PRAD -0.302; TCGA THCA -0.296; TCGA STAD -0.166 |
hsa-miR-125a-5p | UBE2G1 | 13 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget; PITA; miRanda | TCGA BLCA -0.127; TCGA CESC -0.191; TCGA COAD -0.119; TCGA HNSC -0.119; TCGA KIRP -0.106; TCGA LUAD -0.103; TCGA LUSC -0.175; TCGA OV -0.163; TCGA PRAD -0.137; TCGA SARC -0.073; TCGA THCA -0.096; TCGA STAD -0.103; TCGA UCEC -0.183 |
hsa-miR-125a-5p | SLC7A1 | 11 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD | MirTarget; miRanda | TCGA BLCA -0.384; TCGA CESC -0.157; TCGA ESCA -0.229; TCGA HNSC -0.256; TCGA LGG -0.216; TCGA LUAD -0.23; TCGA LUSC -0.325; TCGA PRAD -0.181; TCGA SARC -0.136; TCGA THCA -0.215; TCGA STAD -0.22 |
hsa-miR-125a-5p | BAG4 | 9 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.161; TCGA CESC -0.163; TCGA COAD -0.174; TCGA HNSC -0.364; TCGA LUAD -0.202; TCGA LUSC -0.264; TCGA PRAD -0.24; TCGA THCA -0.191; TCGA STAD -0.156 |
hsa-miR-125a-5p | LACTB | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; PITA; miRanda | TCGA BLCA -0.079; TCGA BRCA -0.06; TCGA CESC -0.223; TCGA COAD -0.098; TCGA ESCA -0.255; TCGA HNSC -0.066; TCGA KIRC -0.182; TCGA KIRP -0.155; TCGA LIHC -0.07; TCGA LUAD -0.076; TCGA OV -0.175; TCGA PAAD -0.343; TCGA PRAD -0.171; TCGA SARC -0.206; TCGA THCA -0.304; TCGA STAD -0.1; TCGA UCEC -0.331 |
hsa-miR-125a-5p | SLC25A15 | 13 cancers: BLCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC | MirTarget; PITA; miRanda | TCGA BLCA -0.075; TCGA CESC -0.109; TCGA ESCA -0.261; TCGA HNSC -0.141; TCGA LGG -0.232; TCGA LIHC -0.258; TCGA LUAD -0.182; TCGA LUSC -0.336; TCGA OV -0.267; TCGA PAAD -0.339; TCGA PRAD -0.116; TCGA THCA -0.272; TCGA UCEC -0.246 |
hsa-miR-125a-5p | EAF1 | 13 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.087; TCGA COAD -0.074; TCGA ESCA -0.133; TCGA HNSC -0.227; TCGA LGG -0.086; TCGA LIHC -0.051; TCGA LUAD -0.125; TCGA OV -0.144; TCGA PRAD -0.142; TCGA SARC -0.142; TCGA THCA -0.099; TCGA STAD -0.121; TCGA UCEC -0.24 |
hsa-miR-125a-5p | USP37 | 10 cancers: BLCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC | MirTarget; PITA | TCGA BLCA -0.1; TCGA HNSC -0.166; TCGA LGG -0.115; TCGA LUAD -0.191; TCGA LUSC -0.128; TCGA OV -0.151; TCGA PAAD -0.113; TCGA SARC -0.096; TCGA STAD -0.14; TCGA UCEC -0.152 |
hsa-miR-125a-5p | PPAT | 12 cancers: BLCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget; PITA; miRanda | TCGA BLCA -0.149; TCGA CESC -0.112; TCGA COAD -0.101; TCGA HNSC -0.118; TCGA LIHC -0.072; TCGA LUAD -0.393; TCGA LUSC -0.371; TCGA OV -0.112; TCGA PRAD -0.235; TCGA THCA -0.094; TCGA STAD -0.207; TCGA UCEC -0.268 |
hsa-miR-125a-5p | TXNRD1 | 12 cancers: BLCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC | MirTarget; miRanda; miRNATAP | TCGA BLCA -0.431; TCGA COAD -0.091; TCGA HNSC -0.216; TCGA LGG -0.068; TCGA LIHC -0.229; TCGA LUAD -0.36; TCGA LUSC -0.541; TCGA OV -0.12; TCGA PRAD -0.165; TCGA SARC -0.292; TCGA THCA -0.199; TCGA UCEC -0.178 |
hsa-miR-125a-5p | CYTH1 | 10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LIHC; PAAD; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.064; TCGA BRCA -0.183; TCGA CESC -0.081; TCGA KIRC -0.247; TCGA KIRP -0.201; TCGA LGG -0.138; TCGA LIHC -0.137; TCGA PAAD -0.181; TCGA THCA -0.083; TCGA UCEC -0.105 |
hsa-miR-125a-5p | RNF168 | 10 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.293; TCGA CESC -0.306; TCGA COAD -0.143; TCGA HNSC -0.441; TCGA LGG -0.103; TCGA LUAD -0.096; TCGA LUSC -0.4; TCGA PRAD -0.209; TCGA SARC -0.235; TCGA THCA -0.253 |
hsa-miR-125a-5p | MFHAS1 | 11 cancers: BLCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.634; TCGA CESC -0.178; TCGA ESCA -0.275; TCGA HNSC -0.44; TCGA LUSC -0.272; TCGA PAAD -0.364; TCGA PRAD -0.242; TCGA SARC -0.354; TCGA THCA -0.366; TCGA STAD -0.114; TCGA UCEC -0.221 |
hsa-miR-125a-5p | FUT4 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PAAD; THCA; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.119; TCGA BRCA -0.094; TCGA COAD -0.384; TCGA ESCA -0.394; TCGA KIRC -0.318; TCGA KIRP -0.393; TCGA PAAD -0.494; TCGA THCA -0.259; TCGA UCEC -0.179 |
hsa-miR-125a-5p | WDR5 | 10 cancers: BLCA; BRCA; CESC; ESCA; LIHC; LUAD; LUSC; OV; STAD; UCEC | MirTarget | TCGA BLCA -0.143; TCGA BRCA -0.125; TCGA CESC -0.138; TCGA ESCA -0.198; TCGA LIHC -0.092; TCGA LUAD -0.088; TCGA LUSC -0.284; TCGA OV -0.1; TCGA STAD -0.118; TCGA UCEC -0.136 |
hsa-miR-125a-5p | E2F2 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.301; TCGA BRCA -0.29; TCGA CESC -0.352; TCGA COAD -0.195; TCGA ESCA -0.401; TCGA HNSC -0.131; TCGA KIRC -1.165; TCGA KIRP -0.51; TCGA LGG -0.462; TCGA LIHC -0.198; TCGA LUAD -0.412; TCGA LUSC -0.474; TCGA OV -0.424; TCGA PAAD -0.651; TCGA THCA -0.172; TCGA STAD -0.323; TCGA UCEC -0.465 |
hsa-miR-125a-5p | RBM7 | 11 cancers: BLCA; COAD; HNSC; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.172; TCGA COAD -0.145; TCGA HNSC -0.051; TCGA LGG -0.166; TCGA LUAD -0.116; TCGA PAAD -0.113; TCGA PRAD -0.093; TCGA SARC -0.124; TCGA THCA -0.132; TCGA STAD -0.08; TCGA UCEC -0.115 |
hsa-miR-125a-5p | UBE2W | 9 cancers: BLCA; CESC; HNSC; LUAD; PRAD; SARC; THCA; STAD; UCEC | PITA; miRanda | TCGA BLCA -0.084; TCGA CESC -0.122; TCGA HNSC -0.096; TCGA LUAD -0.167; TCGA PRAD -0.204; TCGA SARC -0.106; TCGA THCA -0.097; TCGA STAD -0.113; TCGA UCEC -0.212 |
hsa-miR-125a-5p | SBNO2 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; THCA; STAD | PITA | TCGA BLCA -0.085; TCGA BRCA -0.261; TCGA CESC -0.18; TCGA ESCA -0.14; TCGA HNSC -0.097; TCGA KIRC -0.56; TCGA KIRP -0.22; TCGA LGG -0.125; TCGA PAAD -0.17; TCGA THCA -0.097; TCGA STAD -0.108 |
hsa-miR-125a-5p | FBXO45 | 13 cancers: BLCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | PITA; miRanda | TCGA BLCA -0.207; TCGA CESC -0.271; TCGA COAD -0.093; TCGA HNSC -0.191; TCGA LIHC -0.104; TCGA LUAD -0.273; TCGA LUSC -0.524; TCGA OV -0.257; TCGA PAAD -0.1; TCGA PRAD -0.118; TCGA SARC -0.145; TCGA STAD -0.14; TCGA UCEC -0.251 |
hsa-miR-125a-5p | SET | 10 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; OV; PRAD; STAD; UCEC | PITA; miRanda | TCGA BLCA -0.127; TCGA COAD -0.097; TCGA ESCA -0.172; TCGA LGG -0.114; TCGA LUAD -0.203; TCGA LUSC -0.295; TCGA OV -0.123; TCGA PRAD -0.084; TCGA STAD -0.129; TCGA UCEC -0.161 |
hsa-miR-125a-5p | SOCS4 | 10 cancers: BLCA; COAD; HNSC; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC | PITA; miRanda; miRNATAP | TCGA BLCA -0.119; TCGA COAD -0.16; TCGA HNSC -0.092; TCGA LGG -0.096; TCGA LUAD -0.082; TCGA PRAD -0.101; TCGA SARC -0.122; TCGA THCA -0.067; TCGA STAD -0.165; TCGA UCEC -0.126 |
hsa-miR-125a-5p | ABHD3 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; UCEC | PITA; miRanda | TCGA BLCA -0.1; TCGA CESC -0.192; TCGA COAD -0.189; TCGA ESCA -0.226; TCGA HNSC -0.1; TCGA LUAD -0.117; TCGA LUSC -0.468; TCGA OV -0.472; TCGA PAAD -0.184; TCGA PRAD -0.165; TCGA SARC -0.234; TCGA UCEC -0.371 |
hsa-miR-125a-5p | NIPA1 | 11 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | PITA | TCGA BLCA -0.16; TCGA CESC -0.145; TCGA ESCA -0.138; TCGA HNSC -0.176; TCGA LUAD -0.091; TCGA LUSC -0.253; TCGA PRAD -0.099; TCGA SARC -0.233; TCGA THCA -0.101; TCGA STAD -0.113; TCGA UCEC -0.249 |
hsa-miR-125a-5p | CCNC | 10 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.077; TCGA COAD -0.164; TCGA ESCA -0.101; TCGA HNSC -0.085; TCGA LGG -0.089; TCGA LUAD -0.118; TCGA LUSC -0.144; TCGA THCA -0.077; TCGA STAD -0.154; TCGA UCEC -0.232 |
hsa-miR-125a-5p | VPS33A | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; SARC; UCEC | miRanda | TCGA BLCA -0.054; TCGA CESC -0.126; TCGA COAD -0.069; TCGA ESCA -0.1; TCGA HNSC -0.077; TCGA KIRC -0.099; TCGA LGG -0.061; TCGA LIHC -0.128; TCGA LUAD -0.168; TCGA LUSC -0.129; TCGA SARC -0.085; TCGA UCEC -0.072 |
hsa-miR-125a-5p | UBAP1 | 9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; PAAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.163; TCGA CESC -0.101; TCGA ESCA -0.187; TCGA HNSC -0.152; TCGA LUAD -0.068; TCGA PAAD -0.102; TCGA SARC -0.181; TCGA THCA -0.077; TCGA UCEC -0.127 |
hsa-miR-125a-5p | PSMB9 | 11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; SARC; THCA | miRanda | TCGA BLCA -0.407; TCGA BRCA -0.379; TCGA ESCA -0.236; TCGA KIRC -0.915; TCGA KIRP -0.641; TCGA LGG -0.149; TCGA LIHC -0.13; TCGA LUAD -0.159; TCGA PAAD -0.477; TCGA SARC -0.446; TCGA THCA -0.363 |
hsa-miR-125a-5p | LMNB1 | 15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.177; TCGA BRCA -0.211; TCGA COAD -0.18; TCGA ESCA -0.269; TCGA HNSC -0.149; TCGA KIRC -0.563; TCGA LGG -0.454; TCGA LUAD -0.425; TCGA LUSC -0.413; TCGA OV -0.284; TCGA PAAD -0.306; TCGA PRAD -0.148; TCGA THCA -0.257; TCGA STAD -0.258; TCGA UCEC -0.289 |
hsa-miR-125a-5p | CD84 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PRAD; SARC; THCA | miRanda | TCGA BLCA -0.665; TCGA BRCA -0.172; TCGA CESC -0.461; TCGA HNSC -0.423; TCGA KIRC -1.207; TCGA KIRP -0.841; TCGA PRAD -0.223; TCGA SARC -0.402; TCGA THCA -0.827 |
hsa-miR-125a-5p | PPM1D | 9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LGG; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.118; TCGA COAD -0.086; TCGA ESCA -0.099; TCGA HNSC -0.149; TCGA KIRP -0.253; TCGA LGG -0.219; TCGA PRAD -0.126; TCGA THCA -0.091; TCGA STAD -0.113 |
hsa-miR-125a-5p | SMC2 | 12 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.328; TCGA CESC -0.111; TCGA COAD -0.189; TCGA HNSC -0.204; TCGA LGG -0.162; TCGA LUAD -0.313; TCGA LUSC -0.382; TCGA OV -0.276; TCGA PRAD -0.108; TCGA THCA -0.098; TCGA STAD -0.278; TCGA UCEC -0.277 |
hsa-miR-125a-5p | KIAA0586 | 10 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; PRAD; SARC; THCA; STAD | miRanda | TCGA BLCA -0.084; TCGA CESC -0.082; TCGA COAD -0.21; TCGA HNSC -0.161; TCGA LGG -0.133; TCGA LUAD -0.102; TCGA PRAD -0.087; TCGA SARC -0.105; TCGA THCA -0.053; TCGA STAD -0.218 |
hsa-miR-125a-5p | MPHOSPH9 | 12 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.307; TCGA CESC -0.131; TCGA COAD -0.154; TCGA HNSC -0.208; TCGA LGG -0.208; TCGA LUAD -0.296; TCGA LUSC -0.353; TCGA OV -0.143; TCGA PRAD -0.206; TCGA THCA -0.317; TCGA STAD -0.251; TCGA UCEC -0.237 |
hsa-miR-125a-5p | DIAPH3 | 13 cancers: BLCA; COAD; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.382; TCGA COAD -0.154; TCGA HNSC -0.122; TCGA LIHC -0.34; TCGA LUAD -0.494; TCGA LUSC -0.276; TCGA OV -0.476; TCGA PAAD -0.741; TCGA PRAD -0.38; TCGA SARC -0.281; TCGA THCA -0.398; TCGA STAD -0.317; TCGA UCEC -0.513 |
hsa-miR-125a-5p | CAPZA2 | 9 cancers: BLCA; COAD; HNSC; LUAD; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.113; TCGA COAD -0.103; TCGA HNSC -0.059; TCGA LUAD -0.165; TCGA PRAD -0.068; TCGA SARC -0.172; TCGA THCA -0.082; TCGA STAD -0.094; TCGA UCEC -0.3 |
hsa-miR-125a-5p | RAD51C | 9 cancers: BLCA; KIRP; LIHC; LUAD; LUSC; OV; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.065; TCGA KIRP -0.132; TCGA LIHC -0.158; TCGA LUAD -0.116; TCGA LUSC -0.311; TCGA OV -0.197; TCGA SARC -0.137; TCGA THCA -0.065; TCGA UCEC -0.187 |
hsa-miR-125a-5p | HLA-H | 10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; OV; PAAD; SARC; THCA | miRanda | TCGA BLCA -0.235; TCGA BRCA -0.382; TCGA KIRC -0.684; TCGA KIRP -0.505; TCGA LGG -0.163; TCGA LIHC -0.137; TCGA OV -0.204; TCGA PAAD -0.229; TCGA SARC -0.369; TCGA THCA -0.255 |
hsa-miR-125a-5p | FAM129A | 9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; THCA | miRanda | TCGA BLCA -0.687; TCGA CESC -0.327; TCGA HNSC -0.364; TCGA KIRC -0.226; TCGA KIRP -0.341; TCGA LUSC -0.161; TCGA PRAD -0.193; TCGA SARC -0.887; TCGA THCA -0.35 |
hsa-miR-125a-5p | CTAGE5 | 10 cancers: BLCA; COAD; HNSC; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.078; TCGA COAD -0.113; TCGA HNSC -0.067; TCGA LIHC -0.106; TCGA LUAD -0.08; TCGA LUSC -0.233; TCGA OV -0.182; TCGA PRAD -0.064; TCGA STAD -0.117; TCGA UCEC -0.248 |
hsa-miR-125a-5p | IL12RB2 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; OV; THCA; UCEC | miRanda | TCGA BLCA -1.074; TCGA BRCA -0.345; TCGA CESC -1.122; TCGA HNSC -0.363; TCGA KIRC -0.652; TCGA KIRP -1.715; TCGA LUAD -0.401; TCGA OV -0.342; TCGA THCA -0.655; TCGA UCEC -0.373 |
hsa-miR-125a-5p | RAD23B | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.162; TCGA CESC -0.134; TCGA COAD -0.09; TCGA ESCA -0.21; TCGA HNSC -0.123; TCGA LIHC -0.083; TCGA LUAD -0.211; TCGA LUSC -0.216; TCGA OV -0.122; TCGA PRAD -0.17; TCGA SARC -0.09; TCGA STAD -0.124; TCGA UCEC -0.153 |
hsa-miR-125a-5p | TFAM | 10 cancers: BLCA; COAD; HNSC; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.091; TCGA COAD -0.157; TCGA HNSC -0.134; TCGA LGG -0.158; TCGA LUAD -0.221; TCGA LUSC -0.151; TCGA PRAD -0.141; TCGA THCA -0.091; TCGA STAD -0.127; TCGA UCEC -0.272 |
hsa-miR-125a-5p | FPR3 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.505; TCGA BRCA -0.233; TCGA CESC -0.365; TCGA HNSC -0.247; TCGA KIRC -0.969; TCGA KIRP -0.544; TCGA LGG -0.373; TCGA PRAD -0.296; TCGA SARC -0.343; TCGA THCA -0.721; TCGA UCEC -0.244 |
hsa-miR-125a-5p | UCHL5 | 15 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.191; TCGA CESC -0.255; TCGA COAD -0.135; TCGA ESCA -0.174; TCGA HNSC -0.175; TCGA LIHC -0.081; TCGA LUAD -0.217; TCGA LUSC -0.319; TCGA OV -0.143; TCGA PAAD -0.128; TCGA PRAD -0.163; TCGA SARC -0.148; TCGA THCA -0.381; TCGA STAD -0.132; TCGA UCEC -0.283 |
hsa-miR-125a-5p | HTATIP2 | 13 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.124; TCGA CESC -0.178; TCGA ESCA -0.355; TCGA KIRC -0.487; TCGA KIRP -0.236; TCGA LIHC -0.172; TCGA LUAD -0.122; TCGA LUSC -0.322; TCGA OV -0.34; TCGA PAAD -0.319; TCGA SARC -0.646; TCGA THCA -0.142; TCGA UCEC -0.324 |
hsa-miR-125a-5p | NRBF2 | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.155; TCGA CESC -0.153; TCGA ESCA -0.177; TCGA HNSC -0.088; TCGA KIRC -0.147; TCGA LUAD -0.098; TCGA PAAD -0.146; TCGA PRAD -0.099; TCGA THCA -0.141; TCGA STAD -0.058; TCGA UCEC -0.166 |
hsa-miR-125a-5p | MFN1 | 12 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.058; TCGA CESC -0.111; TCGA COAD -0.08; TCGA HNSC -0.135; TCGA LUAD -0.129; TCGA LUSC -0.342; TCGA OV -0.155; TCGA PAAD -0.161; TCGA PRAD -0.141; TCGA THCA -0.107; TCGA STAD -0.16; TCGA UCEC -0.12 |
hsa-miR-125a-5p | IPMK | 9 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.451; TCGA CESC -0.362; TCGA COAD -0.236; TCGA HNSC -0.716; TCGA LGG -0.402; TCGA LUAD -0.288; TCGA PRAD -0.455; TCGA THCA -0.487; TCGA STAD -0.259 |
hsa-miR-125a-5p | IMPA2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; PAAD; PRAD; SARC; UCEC | miRanda | TCGA BLCA -0.535; TCGA BRCA -0.247; TCGA CESC -0.203; TCGA COAD -0.164; TCGA ESCA -0.217; TCGA HNSC -0.141; TCGA KIRP -0.222; TCGA LUSC -0.368; TCGA OV -0.46; TCGA PAAD -0.318; TCGA PRAD -0.092; TCGA SARC -0.447; TCGA UCEC -0.439 |
hsa-miR-125a-5p | TOP3A | 11 cancers: BLCA; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.102; TCGA COAD -0.098; TCGA HNSC -0.109; TCGA KIRP -0.106; TCGA LGG -0.143; TCGA LIHC -0.059; TCGA LUAD -0.083; TCGA LUSC -0.189; TCGA SARC -0.218; TCGA STAD -0.115; TCGA UCEC -0.154 |
hsa-miR-125a-5p | NMI | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; PAAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.182; TCGA BRCA -0.198; TCGA CESC -0.104; TCGA COAD -0.123; TCGA ESCA -0.154; TCGA KIRC -0.438; TCGA KIRP -0.312; TCGA LUAD -0.111; TCGA PAAD -0.346; TCGA SARC -0.16; TCGA THCA -0.128; TCGA STAD -0.098; TCGA UCEC -0.166 |
hsa-miR-125a-5p | ANKRD13A | 9 cancers: BLCA; CESC; HNSC; KIRP; LGG; PRAD; SARC; THCA; STAD | miRanda | TCGA BLCA -0.08; TCGA CESC -0.079; TCGA HNSC -0.064; TCGA KIRP -0.202; TCGA LGG -0.13; TCGA PRAD -0.095; TCGA SARC -0.183; TCGA THCA -0.112; TCGA STAD -0.119 |
hsa-miR-125a-5p | PAPOLA | 10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.073; TCGA COAD -0.133; TCGA ESCA -0.128; TCGA HNSC -0.11; TCGA LUAD -0.173; TCGA LUSC -0.191; TCGA PRAD -0.1; TCGA THCA -0.095; TCGA STAD -0.1; TCGA UCEC -0.193 |
hsa-miR-125a-5p | RAB35 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUSC; THCA; UCEC | miRanda | TCGA BLCA -0.098; TCGA BRCA -0.091; TCGA CESC -0.164; TCGA ESCA -0.14; TCGA HNSC -0.064; TCGA KIRC -0.085; TCGA LUSC -0.09; TCGA THCA -0.133; TCGA UCEC -0.124 |
hsa-miR-125a-5p | IL7R | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PRAD; SARC; THCA | miRanda | TCGA BLCA -0.703; TCGA BRCA -0.205; TCGA CESC -0.337; TCGA HNSC -0.369; TCGA KIRC -0.66; TCGA KIRP -0.755; TCGA PRAD -0.268; TCGA SARC -0.866; TCGA THCA -1.381 |
hsa-miR-125a-5p | WDR62 | 12 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.153; TCGA BRCA -0.382; TCGA ESCA -0.371; TCGA KIRC -0.795; TCGA LIHC -0.179; TCGA LUAD -0.312; TCGA LUSC -0.501; TCGA OV -0.408; TCGA SARC -0.349; TCGA THCA -0.099; TCGA STAD -0.257; TCGA UCEC -0.234 |
hsa-miR-125a-5p | ACTL6A | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.067; TCGA CESC -0.152; TCGA COAD -0.116; TCGA ESCA -0.159; TCGA HNSC -0.099; TCGA LGG -0.132; TCGA LUAD -0.229; TCGA LUSC -0.534; TCGA OV -0.174; TCGA PAAD -0.183; TCGA PRAD -0.116; TCGA STAD -0.09; TCGA UCEC -0.182 |
hsa-miR-125a-5p | NEDD1 | 9 cancers: BLCA; COAD; HNSC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.168; TCGA COAD -0.075; TCGA HNSC -0.067; TCGA LUAD -0.241; TCGA LUSC -0.23; TCGA PRAD -0.149; TCGA THCA -0.067; TCGA STAD -0.173; TCGA UCEC -0.139 |
hsa-miR-125a-5p | API5 | 12 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.153; TCGA COAD -0.129; TCGA ESCA -0.116; TCGA HNSC -0.065; TCGA LIHC -0.051; TCGA LUAD -0.107; TCGA LUSC -0.158; TCGA OV -0.161; TCGA SARC -0.166; TCGA THCA -0.052; TCGA STAD -0.157; TCGA UCEC -0.282 |
hsa-miR-125a-5p | NLRC5 | 9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; PAAD; SARC; THCA; STAD | miRanda | TCGA BLCA -0.478; TCGA BRCA -0.279; TCGA CESC -0.354; TCGA KIRC -0.793; TCGA KIRP -0.305; TCGA PAAD -0.258; TCGA SARC -0.415; TCGA THCA -0.478; TCGA STAD -0.187 |
hsa-miR-125a-5p | TAP2 | 11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; PAAD; THCA; STAD | miRanda | TCGA BLCA -0.299; TCGA BRCA -0.248; TCGA CESC -0.277; TCGA ESCA -0.263; TCGA KIRC -0.364; TCGA KIRP -0.28; TCGA LGG -0.102; TCGA LUAD -0.092; TCGA PAAD -0.161; TCGA THCA -0.343; TCGA STAD -0.129 |
hsa-miR-125a-5p | PPP2CA | 11 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRanda | TCGA BLCA -0.053; TCGA COAD -0.081; TCGA ESCA -0.115; TCGA HNSC -0.082; TCGA LIHC -0.056; TCGA LUAD -0.109; TCGA LUSC -0.103; TCGA OV -0.118; TCGA PRAD -0.051; TCGA SARC -0.097; TCGA UCEC -0.116 |
hsa-miR-125a-5p | BRCC3 | 12 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.13; TCGA COAD -0.127; TCGA ESCA -0.156; TCGA HNSC -0.16; TCGA LUAD -0.139; TCGA LUSC -0.196; TCGA OV -0.16; TCGA PAAD -0.101; TCGA PRAD -0.122; TCGA THCA -0.059; TCGA STAD -0.176; TCGA UCEC -0.15 |
hsa-miR-125a-5p | CHTF8 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; SARC; THCA; STAD; UCEC | miRanda; mirMAP; miRNATAP | TCGA BLCA -0.07; TCGA CESC -0.071; TCGA COAD -0.084; TCGA ESCA -0.087; TCGA HNSC -0.087; TCGA KIRP -0.099; TCGA PAAD -0.084; TCGA SARC -0.058; TCGA THCA -0.113; TCGA STAD -0.051; TCGA UCEC -0.141 |
hsa-miR-125a-5p | KIF23 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.265; TCGA BRCA -0.147; TCGA CESC -0.133; TCGA COAD -0.187; TCGA ESCA -0.328; TCGA HNSC -0.125; TCGA KIRC -0.272; TCGA LGG -0.267; TCGA LUAD -0.628; TCGA LUSC -0.621; TCGA OV -0.501; TCGA PAAD -0.718; TCGA PRAD -0.263; TCGA SARC -0.177; TCGA THCA -0.333; TCGA STAD -0.24; TCGA UCEC -0.372 |
hsa-miR-125a-5p | TCF19 | 15 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.2; TCGA BRCA -0.12; TCGA COAD -0.176; TCGA ESCA -0.22; TCGA KIRC -0.364; TCGA LGG -0.196; TCGA LIHC -0.247; TCGA LUAD -0.215; TCGA LUSC -0.273; TCGA OV -0.227; TCGA PAAD -0.296; TCGA SARC -0.332; TCGA THCA -0.153; TCGA STAD -0.124; TCGA UCEC -0.314 |
hsa-miR-125a-5p | GBP5 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.95; TCGA BRCA -0.596; TCGA CESC -0.733; TCGA HNSC -0.271; TCGA KIRC -1.491; TCGA KIRP -0.64; TCGA LUAD -0.231; TCGA SARC -0.632; TCGA THCA -0.939; TCGA UCEC -0.456 |
hsa-miR-125a-5p | HPRT1 | 10 cancers: BLCA; COAD; ESCA; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.115; TCGA COAD -0.149; TCGA ESCA -0.22; TCGA LIHC -0.086; TCGA LUAD -0.288; TCGA LUSC -0.485; TCGA OV -0.143; TCGA SARC -0.111; TCGA STAD -0.13; TCGA UCEC -0.315 |
hsa-miR-125a-5p | DHFR | 12 cancers: BLCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.175; TCGA COAD -0.177; TCGA HNSC -0.161; TCGA LGG -0.209; TCGA LIHC -0.078; TCGA LUAD -0.244; TCGA LUSC -0.236; TCGA OV -0.355; TCGA PAAD -0.236; TCGA PRAD -0.202; TCGA SARC -0.16; TCGA STAD -0.163 |
hsa-miR-125a-5p | PHAX | 9 cancers: BLCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; THCA; UCEC | miRanda | TCGA BLCA -0.156; TCGA CESC -0.064; TCGA COAD -0.086; TCGA HNSC -0.081; TCGA LGG -0.052; TCGA LIHC -0.098; TCGA LUAD -0.111; TCGA THCA -0.109; TCGA UCEC -0.151 |
hsa-miR-125a-5p | RRM2 | 19 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.233; TCGA BRCA -0.341; TCGA CESC -0.215; TCGA COAD -0.267; TCGA ESCA -0.476; TCGA HNSC -0.166; TCGA KIRC -1.144; TCGA KIRP -0.395; TCGA LGG -0.722; TCGA LIHC -0.366; TCGA LUAD -0.674; TCGA LUSC -0.767; TCGA OV -0.576; TCGA PAAD -0.779; TCGA PRAD -0.373; TCGA SARC -0.219; TCGA THCA -0.394; TCGA STAD -0.326; TCGA UCEC -0.72 |
hsa-miR-125a-5p | UBR7 | 9 cancers: BLCA; COAD; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.157; TCGA COAD -0.158; TCGA HNSC -0.084; TCGA LUAD -0.097; TCGA LUSC -0.149; TCGA PRAD -0.089; TCGA SARC -0.148; TCGA STAD -0.13; TCGA UCEC -0.167 |
hsa-miR-125a-5p | BATF2 | 11 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; PAAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.392; TCGA BRCA -0.222; TCGA CESC -0.251; TCGA COAD -0.18; TCGA KIRC -0.365; TCGA KIRP -0.161; TCGA LUAD -0.187; TCGA PAAD -0.212; TCGA SARC -0.651; TCGA THCA -0.456; TCGA UCEC -0.223 |
hsa-miR-125a-5p | PLIN3 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC | miRanda | TCGA BLCA -0.146; TCGA BRCA -0.181; TCGA CESC -0.262; TCGA ESCA -0.186; TCGA HNSC -0.1; TCGA KIRC -0.26; TCGA KIRP -0.185; TCGA LUAD -0.146; TCGA LUSC -0.086; TCGA PAAD -0.32; TCGA UCEC -0.152 |
hsa-miR-125a-5p | RACGAP1 | 16 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.286; TCGA CESC -0.2; TCGA COAD -0.145; TCGA ESCA -0.327; TCGA HNSC -0.14; TCGA KIRC -0.274; TCGA LGG -0.229; TCGA LIHC -0.193; TCGA LUAD -0.472; TCGA LUSC -0.448; TCGA OV -0.368; TCGA PAAD -0.365; TCGA PRAD -0.217; TCGA THCA -0.311; TCGA STAD -0.2; TCGA UCEC -0.351 |
hsa-miR-125a-5p | TMOD3 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.105; TCGA CESC -0.183; TCGA COAD -0.145; TCGA ESCA -0.234; TCGA HNSC -0.241; TCGA LUAD -0.098; TCGA PAAD -0.27; TCGA PRAD -0.149; TCGA THCA -0.18; TCGA STAD -0.156; TCGA UCEC -0.148 |
hsa-miR-125a-5p | FLVCR2 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; PAAD; THCA; UCEC | miRanda | TCGA BLCA -0.114; TCGA BRCA -0.2; TCGA CESC -0.449; TCGA HNSC -0.227; TCGA KIRC -0.32; TCGA KIRP -0.401; TCGA LGG -0.499; TCGA PAAD -0.248; TCGA THCA -0.218; TCGA UCEC -0.155 |
hsa-miR-125a-5p | ESPL1 | 16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.138; TCGA BRCA -0.246; TCGA CESC -0.227; TCGA ESCA -0.434; TCGA HNSC -0.209; TCGA KIRC -0.418; TCGA LGG -0.551; TCGA LIHC -0.178; TCGA LUAD -0.592; TCGA LUSC -0.665; TCGA OV -0.41; TCGA PAAD -0.635; TCGA PRAD -0.278; TCGA THCA -0.342; TCGA STAD -0.334; TCGA UCEC -0.26 |
hsa-miR-125a-5p | CKS1B | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRanda | TCGA BLCA -0.126; TCGA BRCA -0.117; TCGA CESC -0.175; TCGA COAD -0.105; TCGA ESCA -0.28; TCGA KIRC -0.167; TCGA LGG -0.097; TCGA LIHC -0.121; TCGA LUAD -0.353; TCGA LUSC -0.438; TCGA OV -0.228; TCGA PAAD -0.401; TCGA UCEC -0.289 |
hsa-miR-125a-5p | PSMD14 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BLCA -0.077; TCGA BRCA -0.051; TCGA CESC -0.143; TCGA COAD -0.082; TCGA ESCA -0.145; TCGA KIRC -0.208; TCGA LGG -0.085; TCGA LIHC -0.068; TCGA LUAD -0.229; TCGA LUSC -0.277; TCGA OV -0.212; TCGA PAAD -0.159; TCGA STAD -0.095; TCGA UCEC -0.234 |
hsa-miR-125a-5p | CYB5R4 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.151; TCGA CESC -0.205; TCGA COAD -0.147; TCGA ESCA -0.316; TCGA HNSC -0.175; TCGA LGG -0.183; TCGA LUAD -0.116; TCGA LUSC -0.212; TCGA OV -0.149; TCGA SARC -0.257; TCGA THCA -0.308; TCGA STAD -0.169; TCGA UCEC -0.381 |
hsa-miR-125a-5p | LILRA6 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PRAD; SARC; THCA | miRanda | TCGA BLCA -0.668; TCGA BRCA -0.287; TCGA CESC -0.443; TCGA HNSC -0.178; TCGA KIRC -1.329; TCGA KIRP -1.064; TCGA PRAD -0.227; TCGA SARC -0.379; TCGA THCA -0.598 |
hsa-miR-125a-5p | TAF4B | 9 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.497; TCGA CESC -0.311; TCGA COAD -0.183; TCGA HNSC -0.181; TCGA LUAD -0.098; TCGA LUSC -0.277; TCGA PRAD -0.249; TCGA THCA -0.358; TCGA STAD -0.248 |
hsa-miR-125a-5p | PRKAR2A | 9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; PRAD; SARC; THCA; STAD | miRanda | TCGA BLCA -0.378; TCGA CESC -0.27; TCGA ESCA -0.164; TCGA HNSC -0.51; TCGA LUAD -0.119; TCGA PRAD -0.311; TCGA SARC -0.37; TCGA THCA -0.35; TCGA STAD -0.122 |
hsa-miR-125a-5p | PTPN2 | 9 cancers: BLCA; CESC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BLCA -0.079; TCGA CESC -0.129; TCGA KIRC -0.161; TCGA LUAD -0.083; TCGA LUSC -0.165; TCGA OV -0.195; TCGA PAAD -0.129; TCGA STAD -0.106; TCGA UCEC -0.125 |
hsa-miR-125a-5p | PI4K2B | 12 cancers: BLCA; CESC; COAD; HNSC; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.068; TCGA CESC -0.117; TCGA COAD -0.113; TCGA HNSC -0.086; TCGA LIHC -0.147; TCGA LUAD -0.109; TCGA OV -0.166; TCGA PRAD -0.171; TCGA SARC -0.213; TCGA THCA -0.266; TCGA STAD -0.246; TCGA UCEC -0.207 |
hsa-miR-125a-5p | TAF5L | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.076; TCGA CESC -0.124; TCGA COAD -0.088; TCGA ESCA -0.092; TCGA HNSC -0.097; TCGA LGG -0.236; TCGA LUAD -0.066; TCGA LUSC -0.106; TCGA PAAD -0.075; TCGA PRAD -0.051; TCGA SARC -0.25; TCGA THCA -0.067; TCGA STAD -0.061; TCGA UCEC -0.1 |
hsa-miR-125a-5p | RBM41 | 11 cancers: BLCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.121; TCGA CESC -0.172; TCGA HNSC -0.123; TCGA LGG -0.106; TCGA LIHC -0.115; TCGA LUAD -0.121; TCGA LUSC -0.097; TCGA PAAD -0.139; TCGA PRAD -0.135; TCGA THCA -0.08; TCGA STAD -0.153 |
hsa-miR-125a-5p | SREBF2 | 10 cancers: BLCA; CESC; HNSC; LGG; LIHC; OV; PRAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.077; TCGA CESC -0.206; TCGA HNSC -0.172; TCGA LGG -0.16; TCGA LIHC -0.122; TCGA OV -0.253; TCGA PRAD -0.075; TCGA SARC -0.148; TCGA THCA -0.122; TCGA UCEC -0.131 |
hsa-miR-125a-5p | PNPT1 | 12 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.067; TCGA CESC -0.132; TCGA COAD -0.132; TCGA HNSC -0.076; TCGA LGG -0.083; TCGA LUAD -0.211; TCGA LUSC -0.293; TCGA OV -0.212; TCGA PRAD -0.108; TCGA THCA -0.069; TCGA STAD -0.199; TCGA UCEC -0.149 |
hsa-miR-125a-5p | BAZ1A | 17 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.113; TCGA CESC -0.296; TCGA COAD -0.145; TCGA ESCA -0.12; TCGA HNSC -0.212; TCGA KIRC -0.275; TCGA KIRP -0.249; TCGA LGG -0.388; TCGA LUAD -0.167; TCGA LUSC -0.27; TCGA OV -0.303; TCGA PAAD -0.331; TCGA PRAD -0.133; TCGA SARC -0.251; TCGA THCA -0.089; TCGA STAD -0.112; TCGA UCEC -0.193 |
hsa-miR-125a-5p | PGAM5 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.184; TCGA BRCA -0.094; TCGA CESC -0.241; TCGA COAD -0.11; TCGA ESCA -0.278; TCGA HNSC -0.214; TCGA LUAD -0.247; TCGA LUSC -0.344; TCGA OV -0.128; TCGA PRAD -0.125; TCGA SARC -0.104; TCGA THCA -0.135; TCGA STAD -0.104; TCGA UCEC -0.141 |
hsa-miR-125a-5p | GINS3 | 14 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.155; TCGA CESC -0.173; TCGA COAD -0.159; TCGA HNSC -0.064; TCGA KIRC -0.132; TCGA KIRP -0.149; TCGA LIHC -0.086; TCGA LUAD -0.28; TCGA LUSC -0.444; TCGA OV -0.16; TCGA PAAD -0.224; TCGA THCA -0.099; TCGA STAD -0.153; TCGA UCEC -0.26 |
hsa-miR-125a-5p | CFLAR | 10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.225; TCGA CESC -0.127; TCGA HNSC -0.077; TCGA KIRC -0.214; TCGA KIRP -0.102; TCGA PAAD -0.226; TCGA PRAD -0.072; TCGA SARC -0.189; TCGA THCA -0.315; TCGA UCEC -0.096 |
hsa-miR-125a-5p | NUAK2 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; SARC; THCA; STAD | miRanda | TCGA BLCA -0.458; TCGA BRCA -0.181; TCGA CESC -0.235; TCGA COAD -0.159; TCGA ESCA -0.338; TCGA HNSC -0.217; TCGA PRAD -0.189; TCGA SARC -0.206; TCGA THCA -0.304; TCGA STAD -0.263 |
hsa-miR-125a-5p | RBBP5 | 9 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.24; TCGA CESC -0.157; TCGA COAD -0.081; TCGA HNSC -0.279; TCGA LUAD -0.137; TCGA LUSC -0.111; TCGA PRAD -0.19; TCGA THCA -0.15; TCGA STAD -0.109 |
hsa-miR-125a-5p | PLEKHA8 | 11 cancers: BLCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.175; TCGA HNSC -0.093; TCGA LIHC -0.151; TCGA LUAD -0.181; TCGA LUSC -0.245; TCGA OV -0.278; TCGA PAAD -0.148; TCGA PRAD -0.175; TCGA THCA -0.197; TCGA STAD -0.11; TCGA UCEC -0.208 |
hsa-miR-125a-5p | BLZF1 | 11 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.174; TCGA CESC -0.289; TCGA ESCA -0.118; TCGA HNSC -0.145; TCGA LUAD -0.12; TCGA LUSC -0.124; TCGA PAAD -0.146; TCGA PRAD -0.107; TCGA SARC -0.132; TCGA STAD -0.104; TCGA UCEC -0.188 |
hsa-miR-125a-5p | ZBTB6 | 9 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; STAD; UCEC | miRanda | TCGA BLCA -0.167; TCGA CESC -0.109; TCGA COAD -0.101; TCGA HNSC -0.099; TCGA LGG -0.103; TCGA LUAD -0.112; TCGA LUSC -0.104; TCGA STAD -0.146; TCGA UCEC -0.114 |
hsa-miR-125a-5p | GOLGA5 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.057; TCGA CESC -0.078; TCGA COAD -0.106; TCGA ESCA -0.109; TCGA HNSC -0.076; TCGA LUAD -0.149; TCGA LUSC -0.145; TCGA PRAD -0.143; TCGA THCA -0.05; TCGA STAD -0.08; TCGA UCEC -0.179 |
hsa-miR-125a-5p | AEN | 14 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.119; TCGA BRCA -0.08; TCGA CESC -0.087; TCGA ESCA -0.231; TCGA KIRC -0.481; TCGA KIRP -0.231; TCGA LGG -0.334; TCGA LIHC -0.134; TCGA LUAD -0.07; TCGA LUSC -0.127; TCGA PAAD -0.182; TCGA PRAD -0.101; TCGA STAD -0.155; TCGA UCEC -0.139 |
hsa-miR-125a-5p | NUP205 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.181; TCGA CESC -0.263; TCGA COAD -0.116; TCGA ESCA -0.17; TCGA HNSC -0.26; TCGA LGG -0.107; TCGA LUAD -0.258; TCGA LUSC -0.34; TCGA OV -0.202; TCGA PRAD -0.114; TCGA STAD -0.22; TCGA UCEC -0.194 |
hsa-miR-125a-5p | TRIM65 | 10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; OV; UCEC | miRanda | TCGA BLCA -0.089; TCGA BRCA -0.132; TCGA CESC -0.138; TCGA ESCA -0.192; TCGA KIRC -0.215; TCGA KIRP -0.341; TCGA LGG -0.052; TCGA LUSC -0.154; TCGA OV -0.167; TCGA UCEC -0.138 |
hsa-miR-125a-5p | CDC23 | 12 cancers: BLCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.074; TCGA CESC -0.09; TCGA COAD -0.103; TCGA HNSC -0.105; TCGA LGG -0.091; TCGA LIHC -0.098; TCGA LUAD -0.073; TCGA LUSC -0.095; TCGA OV -0.128; TCGA PRAD -0.079; TCGA STAD -0.114; TCGA UCEC -0.087 |
hsa-miR-125a-5p | TINF2 | 9 cancers: BLCA; CESC; COAD; ESCA; LGG; LIHC; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.159; TCGA CESC -0.118; TCGA COAD -0.118; TCGA ESCA -0.107; TCGA LGG -0.085; TCGA LIHC -0.058; TCGA SARC -0.109; TCGA THCA -0.124; TCGA UCEC -0.149 |
hsa-miR-125a-5p | IFNG | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.796; TCGA BRCA -0.633; TCGA CESC -0.637; TCGA HNSC -0.236; TCGA KIRC -1.816; TCGA LUAD -0.407; TCGA SARC -0.633; TCGA THCA -1.007; TCGA UCEC -0.548 |
hsa-miR-125a-5p | FBXO48 | 10 cancers: BLCA; CESC; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.128; TCGA CESC -0.15; TCGA HNSC -0.107; TCGA LIHC -0.097; TCGA LUAD -0.079; TCGA LUSC -0.155; TCGA PRAD -0.105; TCGA SARC -0.17; TCGA THCA -0.154; TCGA UCEC -0.1 |
hsa-miR-125a-5p | NUB1 | 9 cancers: BLCA; KIRC; KIRP; LIHC; LUAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.06; TCGA KIRC -0.101; TCGA KIRP -0.154; TCGA LIHC -0.103; TCGA LUAD -0.074; TCGA SARC -0.097; TCGA THCA -0.051; TCGA STAD -0.102; TCGA UCEC -0.116 |
hsa-miR-125a-5p | POLR1A | 10 cancers: BLCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; THCA | miRanda; mirMAP | TCGA BLCA -0.195; TCGA CESC -0.178; TCGA ESCA -0.112; TCGA HNSC -0.27; TCGA LGG -0.169; TCGA LIHC -0.102; TCGA LUAD -0.158; TCGA LUSC -0.174; TCGA PRAD -0.183; TCGA THCA -0.08 |
hsa-miR-125a-5p | MAN2A1 | 9 cancers: BLCA; CESC; HNSC; LUAD; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.288; TCGA CESC -0.303; TCGA HNSC -0.395; TCGA LUAD -0.186; TCGA PRAD -0.255; TCGA SARC -0.344; TCGA THCA -0.524; TCGA STAD -0.105; TCGA UCEC -0.186 |
hsa-miR-125a-5p | MARCH7 | 10 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BLCA -0.075; TCGA CESC -0.13; TCGA COAD -0.106; TCGA HNSC -0.143; TCGA LGG -0.054; TCGA LUAD -0.103; TCGA LUSC -0.091; TCGA OV -0.09; TCGA STAD -0.105; TCGA UCEC -0.102 |
hsa-miR-125a-5p | FEN1 | 15 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.21; TCGA BRCA -0.215; TCGA COAD -0.155; TCGA ESCA -0.237; TCGA KIRC -0.218; TCGA LGG -0.166; TCGA LIHC -0.188; TCGA LUAD -0.362; TCGA LUSC -0.478; TCGA OV -0.301; TCGA PAAD -0.196; TCGA SARC -0.414; TCGA THCA -0.109; TCGA STAD -0.162; TCGA UCEC -0.344 |
hsa-miR-125a-5p | MRPS10 | 12 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.07; TCGA CESC -0.098; TCGA COAD -0.109; TCGA ESCA -0.159; TCGA LIHC -0.082; TCGA LUAD -0.2; TCGA LUSC -0.154; TCGA OV -0.115; TCGA PAAD -0.186; TCGA THCA -0.072; TCGA STAD -0.121; TCGA UCEC -0.154 |
hsa-miR-125a-5p | B2M | 10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; PAAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.204; TCGA BRCA -0.144; TCGA CESC -0.17; TCGA ESCA -0.192; TCGA KIRC -0.488; TCGA KIRP -0.245; TCGA PAAD -0.197; TCGA SARC -0.376; TCGA THCA -0.4; TCGA UCEC -0.132 |
hsa-miR-125a-5p | KIF20B | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.261; TCGA CESC -0.194; TCGA COAD -0.171; TCGA ESCA -0.16; TCGA HNSC -0.222; TCGA LGG -0.184; TCGA LUAD -0.43; TCGA LUSC -0.361; TCGA OV -0.245; TCGA PAAD -0.236; TCGA PRAD -0.146; TCGA THCA -0.137; TCGA STAD -0.247; TCGA UCEC -0.317 |
hsa-miR-125a-5p | RANBP9 | 9 cancers: BLCA; CESC; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.075; TCGA CESC -0.124; TCGA HNSC -0.095; TCGA LUAD -0.081; TCGA LUSC -0.112; TCGA OV -0.125; TCGA PRAD -0.143; TCGA SARC -0.111; TCGA STAD -0.109 |
hsa-miR-125a-5p | ECE2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA; UCEC | miRanda | TCGA BLCA -0.146; TCGA BRCA -0.322; TCGA CESC -0.219; TCGA COAD -0.15; TCGA ESCA -0.33; TCGA KIRC -0.262; TCGA KIRP -0.217; TCGA LIHC -0.222; TCGA LUAD -0.279; TCGA LUSC -0.767; TCGA OV -0.357; TCGA THCA -0.173; TCGA UCEC -0.28 |
hsa-miR-125a-5p | APPL1 | 9 cancers: BLCA; HNSC; LGG; LUAD; OV; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.074; TCGA HNSC -0.143; TCGA LGG -0.11; TCGA LUAD -0.084; TCGA OV -0.114; TCGA PRAD -0.102; TCGA THCA -0.099; TCGA STAD -0.146; TCGA UCEC -0.141 |
hsa-miR-125a-5p | ZBTB11 | 9 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.059; TCGA CESC -0.16; TCGA COAD -0.077; TCGA HNSC -0.13; TCGA LUAD -0.061; TCGA LUSC -0.111; TCGA PRAD -0.149; TCGA STAD -0.13; TCGA UCEC -0.071 |
hsa-miR-125a-5p | ARHGAP11B | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; SARC; STAD | miRanda | TCGA BLCA -0.249; TCGA CESC -0.357; TCGA COAD -0.185; TCGA ESCA -0.274; TCGA HNSC -0.359; TCGA KIRC -0.7; TCGA LGG -0.344; TCGA LUAD -0.498; TCGA LUSC -0.537; TCGA PAAD -0.303; TCGA SARC -0.315; TCGA STAD -0.233 |
hsa-miR-125a-5p | HAT1 | 11 cancers: BLCA; CESC; COAD; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.155; TCGA CESC -0.084; TCGA COAD -0.123; TCGA LUAD -0.146; TCGA LUSC -0.154; TCGA OV -0.184; TCGA PAAD -0.105; TCGA SARC -0.13; TCGA THCA -0.135; TCGA STAD -0.096; TCGA UCEC -0.233 |
hsa-miR-125a-5p | OAS3 | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; THCA | mirMAP | TCGA BLCA -0.168; TCGA CESC -0.422; TCGA ESCA -0.249; TCGA HNSC -0.252; TCGA KIRC -0.269; TCGA LUAD -0.284; TCGA LUSC -0.153; TCGA OV -0.253; TCGA PAAD -0.35; TCGA PRAD -0.334; TCGA THCA -0.32 |
hsa-miR-125a-5p | ADM2 | 9 cancers: BLCA; BRCA; KIRC; KIRP; LUSC; OV; PAAD; THCA; UCEC | mirMAP | TCGA BLCA -0.205; TCGA BRCA -0.305; TCGA KIRC -0.792; TCGA KIRP -0.646; TCGA LUSC -0.234; TCGA OV -0.272; TCGA PAAD -0.82; TCGA THCA -0.326; TCGA UCEC -0.435 |
hsa-miR-125a-5p | CENPO | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC | mirMAP | TCGA BLCA -0.141; TCGA BRCA -0.125; TCGA CESC -0.119; TCGA COAD -0.132; TCGA ESCA -0.218; TCGA LGG -0.162; TCGA LUAD -0.299; TCGA LUSC -0.379; TCGA OV -0.208; TCGA PAAD -0.198; TCGA PRAD -0.105; TCGA THCA -0.08; TCGA UCEC -0.252 |
hsa-miR-125a-5p | ISY1 | 9 cancers: BLCA; BRCA; KIRP; LGG; LUAD; LUSC; OV; PAAD; UCEC | mirMAP | TCGA BLCA -0.081; TCGA BRCA -0.063; TCGA KIRP -0.061; TCGA LGG -0.144; TCGA LUAD -0.091; TCGA LUSC -0.102; TCGA OV -0.083; TCGA PAAD -0.152; TCGA UCEC -0.166 |
hsa-miR-125a-5p | RFX5 | 11 cancers: BLCA; BRCA; KIRC; LGG; LIHC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.119; TCGA BRCA -0.091; TCGA KIRC -0.118; TCGA LGG -0.107; TCGA LIHC -0.141; TCGA OV -0.155; TCGA PRAD -0.111; TCGA SARC -0.209; TCGA THCA -0.096; TCGA STAD -0.079; TCGA UCEC -0.065 |
hsa-miR-125a-5p | CBLL1 | 9 cancers: BLCA; CESC; HNSC; LGG; LUAD; LUSC; OV; PRAD; STAD | miRNATAP | TCGA BLCA -0.094; TCGA CESC -0.1; TCGA HNSC -0.142; TCGA LGG -0.076; TCGA LUAD -0.164; TCGA LUSC -0.126; TCGA OV -0.083; TCGA PRAD -0.142; TCGA STAD -0.095 |
hsa-miR-125a-5p | QSOX2 | 10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; STAD | miRNATAP | TCGA BLCA -0.156; TCGA BRCA -0.085; TCGA ESCA -0.162; TCGA KIRC -0.21; TCGA KIRP -0.078; TCGA LGG -0.158; TCGA LIHC -0.073; TCGA LUAD -0.11; TCGA LUSC -0.226; TCGA STAD -0.168 |
hsa-miR-125a-5p | CD300LF | 9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; PAAD; SARC; THCA; UCEC | miRNATAP | TCGA BLCA -0.419; TCGA BRCA -0.423; TCGA CESC -0.22; TCGA KIRC -1.42; TCGA KIRP -1.163; TCGA PAAD -0.3; TCGA SARC -0.512; TCGA THCA -0.421; TCGA UCEC -0.245 |
hsa-miR-125a-5p | EIF4A3 | 11 cancers: BLCA; CESC; COAD; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; UCEC | RAID | TCGA BLCA -0.078; TCGA CESC -0.076; TCGA COAD -0.144; TCGA KIRP -0.121; TCGA LGG -0.124; TCGA LIHC -0.092; TCGA LUAD -0.172; TCGA LUSC -0.359; TCGA PAAD -0.103; TCGA THCA -0.083; TCGA UCEC -0.167 |
hsa-miR-125a-5p | ARPC5 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LIHC; PAAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.052; TCGA ESCA -0.15; TCGA KIRC -0.289; TCGA KIRP -0.145; TCGA LIHC -0.067; TCGA PAAD -0.109; TCGA SARC -0.111; TCGA THCA -0.118; TCGA STAD -0.11; TCGA UCEC -0.228 |
hsa-miR-125a-5p | ATP5J2 | 10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; UCEC | miRNAWalker2 validate | TCGA BRCA -0.219; TCGA CESC -0.113; TCGA ESCA -0.348; TCGA KIRC -0.212; TCGA KIRP -0.249; TCGA LIHC -0.181; TCGA LUAD -0.141; TCGA LUSC -0.232; TCGA OV -0.326; TCGA UCEC -0.226 |
hsa-miR-125a-5p | EIF4EBP1 | 13 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; SARC; THCA; UCEC | miRNAWalker2 validate; MirTarget; miRanda; miRNATAP | TCGA BRCA -0.262; TCGA CESC -0.187; TCGA ESCA -0.414; TCGA KIRC -0.693; TCGA KIRP -0.201; TCGA LGG -0.461; TCGA LUAD -0.264; TCGA LUSC -0.518; TCGA OV -0.263; TCGA PAAD -0.398; TCGA SARC -0.161; TCGA THCA -0.222; TCGA UCEC -0.193 |
hsa-miR-125a-5p | GGCT | 12 cancers: BRCA; CESC; ESCA; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.161; TCGA CESC -0.109; TCGA ESCA -0.252; TCGA KIRP -0.093; TCGA LIHC -0.087; TCGA LUAD -0.195; TCGA LUSC -0.447; TCGA OV -0.298; TCGA PAAD -0.29; TCGA PRAD -0.167; TCGA STAD -0.124; TCGA UCEC -0.337 |
hsa-miR-125a-5p | NME2 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.171; TCGA ESCA -0.421; TCGA KIRC -0.357; TCGA KIRP -0.33; TCGA LIHC -0.105; TCGA LUAD -0.216; TCGA LUSC -0.497; TCGA OV -0.147; TCGA PAAD -0.25; TCGA UCEC -0.155 |
hsa-miR-125a-5p | NOP16 | 11 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.224; TCGA CESC -0.225; TCGA ESCA -0.254; TCGA KIRC -0.443; TCGA LGG -0.101; TCGA LIHC -0.158; TCGA LUAD -0.142; TCGA LUSC -0.369; TCGA OV -0.148; TCGA PAAD -0.266; TCGA UCEC -0.151 |
hsa-miR-125a-5p | PDCL3 | 10 cancers: BRCA; ESCA; KIRC; LGG; LUAD; LUSC; OV; PAAD; SARC; UCEC | miRNAWalker2 validate | TCGA BRCA -0.095; TCGA ESCA -0.151; TCGA KIRC -0.069; TCGA LGG -0.071; TCGA LUAD -0.158; TCGA LUSC -0.243; TCGA OV -0.167; TCGA PAAD -0.101; TCGA SARC -0.138; TCGA UCEC -0.255 |
hsa-miR-125a-5p | RPL35A | 9 cancers: BRCA; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.086; TCGA ESCA -0.185; TCGA KIRC -0.266; TCGA LGG -0.195; TCGA LIHC -0.085; TCGA LUAD -0.113; TCGA LUSC -0.364; TCGA PAAD -0.222; TCGA UCEC -0.138 |
hsa-miR-125a-5p | ZMYND19 | 11 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.257; TCGA CESC -0.17; TCGA ESCA -0.304; TCGA KIRC -0.176; TCGA LGG -0.128; TCGA LIHC -0.132; TCGA LUAD -0.082; TCGA LUSC -0.408; TCGA OV -0.136; TCGA PAAD -0.123; TCGA UCEC -0.226 |
hsa-miR-125a-5p | PPIF | 11 cancers: BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; OV; PAAD; THCA; UCEC | MirTarget; miRanda | TCGA BRCA -0.218; TCGA CESC -0.131; TCGA ESCA -0.201; TCGA HNSC -0.097; TCGA LGG -0.244; TCGA LUAD -0.251; TCGA LUSC -0.363; TCGA OV -0.219; TCGA PAAD -0.233; TCGA THCA -0.236; TCGA UCEC -0.196 |
hsa-miR-125a-5p | NUP210 | 11 cancers: BRCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC | MirTarget; miRanda; miRNATAP | TCGA BRCA -0.14; TCGA HNSC -0.21; TCGA KIRC -0.253; TCGA LIHC -0.106; TCGA LUAD -0.205; TCGA LUSC -0.225; TCGA OV -0.316; TCGA PRAD -0.152; TCGA SARC -0.475; TCGA THCA -0.239; TCGA UCEC -0.274 |
hsa-miR-125a-5p | DUS1L | 10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUSC; OV; STAD; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BRCA -0.301; TCGA CESC -0.105; TCGA ESCA -0.316; TCGA KIRC -0.332; TCGA KIRP -0.297; TCGA LIHC -0.247; TCGA LUSC -0.38; TCGA OV -0.285; TCGA STAD -0.084; TCGA UCEC -0.242 |
hsa-miR-125a-5p | SIRT7 | 11 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; SARC; UCEC | MirTarget; miRanda; miRNATAP | TCGA BRCA -0.22; TCGA CESC -0.156; TCGA ESCA -0.325; TCGA KIRC -0.424; TCGA KIRP -0.341; TCGA LGG -0.086; TCGA LIHC -0.206; TCGA LUSC -0.224; TCGA OV -0.158; TCGA SARC -0.121; TCGA UCEC -0.111 |
hsa-miR-125a-5p | PCSK7 | 11 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; OV; PAAD; SARC; THCA | MirTarget; PITA; miRanda | TCGA BRCA -0.178; TCGA CESC -0.082; TCGA ESCA -0.253; TCGA KIRC -0.28; TCGA KIRP -0.106; TCGA LGG -0.143; TCGA LIHC -0.1; TCGA OV -0.119; TCGA PAAD -0.112; TCGA SARC -0.274; TCGA THCA -0.08 |
hsa-miR-125a-5p | TSEN54 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; SARC; UCEC | MirTarget; miRanda; miRNATAP | TCGA BRCA -0.174; TCGA ESCA -0.274; TCGA KIRC -0.128; TCGA KIRP -0.272; TCGA LGG -0.14; TCGA LIHC -0.139; TCGA LUSC -0.309; TCGA OV -0.156; TCGA SARC -0.105; TCGA UCEC -0.11 |
hsa-miR-125a-5p | PMM2 | 11 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD; THCA; UCEC | MirTarget; miRanda | TCGA BRCA -0.123; TCGA ESCA -0.225; TCGA KIRC -0.525; TCGA KIRP -0.379; TCGA LGG -0.096; TCGA LUSC -0.092; TCGA OV -0.145; TCGA PAAD -0.375; TCGA PRAD -0.106; TCGA THCA -0.127; TCGA UCEC -0.165 |
hsa-miR-125a-5p | BRMS1 | 9 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUSC; OV; UCEC | MirTarget; miRanda | TCGA BRCA -0.227; TCGA CESC -0.088; TCGA ESCA -0.251; TCGA KIRC -0.161; TCGA LGG -0.146; TCGA LIHC -0.131; TCGA LUSC -0.177; TCGA OV -0.139; TCGA UCEC -0.133 |
hsa-miR-125a-5p | ESRRA | 11 cancers: BRCA; CESC; ESCA; LGG; LIHC; LUSC; OV; PAAD; SARC; THCA; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BRCA -0.299; TCGA CESC -0.209; TCGA ESCA -0.242; TCGA LGG -0.096; TCGA LIHC -0.107; TCGA LUSC -0.25; TCGA OV -0.265; TCGA PAAD -0.161; TCGA SARC -0.163; TCGA THCA -0.124; TCGA UCEC -0.164 |
hsa-miR-125a-5p | TIMM17B | 9 cancers: BRCA; ESCA; KIRC; LGG; LIHC; LUSC; OV; SARC; UCEC | MirTarget; miRanda; miRNATAP | TCGA BRCA -0.188; TCGA ESCA -0.155; TCGA KIRC -0.166; TCGA LGG -0.089; TCGA LIHC -0.105; TCGA LUSC -0.172; TCGA OV -0.172; TCGA SARC -0.172; TCGA UCEC -0.11 |
hsa-miR-125a-5p | SLC26A6 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; PAAD; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BRCA -0.242; TCGA ESCA -0.329; TCGA KIRC -0.246; TCGA KIRP -0.324; TCGA LGG -0.185; TCGA LIHC -0.419; TCGA LUSC -0.273; TCGA OV -0.387; TCGA PAAD -0.362; TCGA UCEC -0.234 |
hsa-miR-125a-5p | PSMG3 | 9 cancers: BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; UCEC | MirTarget; miRanda | TCGA BRCA -0.263; TCGA ESCA -0.214; TCGA KIRC -0.236; TCGA KIRP -0.265; TCGA LIHC -0.14; TCGA LUAD -0.091; TCGA LUSC -0.244; TCGA PAAD -0.196; TCGA UCEC -0.133 |
hsa-miR-125a-5p | NPL | 9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; UCEC | MirTarget; PITA; miRanda | TCGA BRCA -0.222; TCGA CESC -0.585; TCGA HNSC -0.137; TCGA KIRC -0.666; TCGA KIRP -0.377; TCGA LUSC -0.433; TCGA PAAD -0.345; TCGA THCA -0.396; TCGA UCEC -0.185 |
hsa-miR-125a-5p | CLN6 | 10 cancers: BRCA; COAD; ESCA; KIRC; LIHC; LUSC; OV; PAAD; SARC; UCEC | MirTarget; miRanda | TCGA BRCA -0.202; TCGA COAD -0.126; TCGA ESCA -0.33; TCGA KIRC -0.279; TCGA LIHC -0.152; TCGA LUSC -0.151; TCGA OV -0.209; TCGA PAAD -0.176; TCGA SARC -0.12; TCGA UCEC -0.19 |
hsa-miR-125a-5p | SNRPB | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; UCEC | PITA; miRanda | TCGA BRCA -0.229; TCGA ESCA -0.288; TCGA KIRC -0.287; TCGA KIRP -0.129; TCGA LGG -0.086; TCGA LIHC -0.092; TCGA LUAD -0.146; TCGA LUSC -0.284; TCGA PAAD -0.165; TCGA UCEC -0.266 |
hsa-miR-125a-5p | SSR2 | 9 cancers: BRCA; ESCA; KIRC; LGG; LIHC; LUAD; OV; PAAD; THCA | PITA; miRanda | TCGA BRCA -0.091; TCGA ESCA -0.096; TCGA KIRC -0.263; TCGA LGG -0.27; TCGA LIHC -0.129; TCGA LUAD -0.082; TCGA OV -0.123; TCGA PAAD -0.228; TCGA THCA -0.113 |
hsa-miR-125a-5p | HMGB3 | 11 cancers: BRCA; COAD; ESCA; KIRP; LGG; LUAD; LUSC; OV; THCA; STAD; UCEC | PITA; miRNATAP | TCGA BRCA -0.216; TCGA COAD -0.148; TCGA ESCA -0.246; TCGA KIRP -0.386; TCGA LGG -0.285; TCGA LUAD -0.381; TCGA LUSC -0.431; TCGA OV -0.233; TCGA THCA -0.137; TCGA STAD -0.206; TCGA UCEC -0.294 |
hsa-miR-125a-5p | TOMM40 | 9 cancers: BRCA; ESCA; KIRC; LIHC; LUAD; LUSC; OV; STAD; UCEC | PITA; miRanda; mirMAP | TCGA BRCA -0.244; TCGA ESCA -0.275; TCGA KIRC -0.189; TCGA LIHC -0.106; TCGA LUAD -0.131; TCGA LUSC -0.284; TCGA OV -0.19; TCGA STAD -0.11; TCGA UCEC -0.228 |
hsa-miR-125a-5p | PES1 | 9 cancers: BRCA; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; UCEC | PITA; miRanda | TCGA BRCA -0.195; TCGA ESCA -0.123; TCGA KIRC -0.173; TCGA LGG -0.282; TCGA LIHC -0.073; TCGA LUAD -0.059; TCGA LUSC -0.234; TCGA PAAD -0.147; TCGA UCEC -0.141 |
hsa-miR-125a-5p | DPP9 | 10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUSC; SARC; STAD; UCEC | PITA; miRanda | TCGA BRCA -0.148; TCGA CESC -0.151; TCGA ESCA -0.228; TCGA KIRC -0.628; TCGA KIRP -0.174; TCGA LIHC -0.061; TCGA LUSC -0.108; TCGA SARC -0.187; TCGA STAD -0.097; TCGA UCEC -0.148 |
hsa-miR-125a-5p | HNRNPA2B1 | 11 cancers: BRCA; CESC; ESCA; KIRP; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRanda | TCGA BRCA -0.067; TCGA CESC -0.064; TCGA ESCA -0.08; TCGA KIRP -0.084; TCGA LIHC -0.065; TCGA LUAD -0.099; TCGA LUSC -0.171; TCGA OV -0.143; TCGA PRAD -0.071; TCGA STAD -0.132; TCGA UCEC -0.15 |
hsa-miR-125a-5p | IKBKG | 9 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; THCA | miRanda | TCGA BRCA -0.228; TCGA CESC -0.11; TCGA ESCA -0.235; TCGA KIRC -0.278; TCGA KIRP -0.114; TCGA LGG -0.065; TCGA LIHC -0.219; TCGA LUSC -0.12; TCGA THCA -0.053 |
hsa-miR-125a-5p | MYO19 | 15 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.101; TCGA CESC -0.228; TCGA COAD -0.127; TCGA ESCA -0.236; TCGA HNSC -0.091; TCGA LGG -0.185; TCGA LIHC -0.12; TCGA LUAD -0.184; TCGA LUSC -0.468; TCGA OV -0.162; TCGA PRAD -0.08; TCGA SARC -0.2; TCGA THCA -0.07; TCGA STAD -0.183; TCGA UCEC -0.168 |
hsa-miR-125a-5p | RCE1 | 10 cancers: BRCA; CESC; COAD; ESCA; KIRC; LGG; LUSC; OV; PAAD; UCEC | miRanda | TCGA BRCA -0.103; TCGA CESC -0.077; TCGA COAD -0.084; TCGA ESCA -0.22; TCGA KIRC -0.102; TCGA LGG -0.149; TCGA LUSC -0.182; TCGA OV -0.181; TCGA PAAD -0.162; TCGA UCEC -0.111 |
hsa-miR-125a-5p | UBA52 | 9 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUSC; OV; PAAD | miRanda | TCGA BRCA -0.162; TCGA CESC -0.111; TCGA ESCA -0.274; TCGA KIRC -0.267; TCGA LGG -0.093; TCGA LIHC -0.098; TCGA LUSC -0.223; TCGA OV -0.154; TCGA PAAD -0.13 |
hsa-miR-125a-5p | CDKN2A | 9 cancers: BRCA; CESC; KIRC; KIRP; LGG; LIHC; OV; SARC; THCA | miRanda | TCGA BRCA -0.588; TCGA CESC -0.392; TCGA KIRC -2.06; TCGA KIRP -1.008; TCGA LGG -0.37; TCGA LIHC -0.535; TCGA OV -0.439; TCGA SARC -0.782; TCGA THCA -0.238 |
hsa-miR-125a-5p | TMEM134 | 9 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUSC; OV; PAAD | miRanda | TCGA BRCA -0.226; TCGA CESC -0.161; TCGA ESCA -0.151; TCGA KIRC -0.309; TCGA LGG -0.067; TCGA LIHC -0.072; TCGA LUSC -0.169; TCGA OV -0.146; TCGA PAAD -0.223 |
hsa-miR-125a-5p | MPDU1 | 9 cancers: BRCA; COAD; ESCA; KIRP; LGG; LUSC; OV; PAAD; UCEC | miRanda | TCGA BRCA -0.07; TCGA COAD -0.144; TCGA ESCA -0.232; TCGA KIRP -0.163; TCGA LGG -0.199; TCGA LUSC -0.086; TCGA OV -0.144; TCGA PAAD -0.136; TCGA UCEC -0.169 |
hsa-miR-125a-5p | MEMO1 | 12 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRanda | TCGA BRCA -0.121; TCGA CESC -0.252; TCGA COAD -0.098; TCGA ESCA -0.172; TCGA KIRC -0.105; TCGA LUAD -0.162; TCGA LUSC -0.263; TCGA OV -0.23; TCGA PAAD -0.14; TCGA PRAD -0.12; TCGA STAD -0.085; TCGA UCEC -0.197 |
hsa-miR-125a-5p | PPP1CA | 9 cancers: BRCA; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRanda; miRNATAP | TCGA BRCA -0.2; TCGA ESCA -0.308; TCGA KIRC -0.158; TCGA LIHC -0.072; TCGA LUAD -0.07; TCGA LUSC -0.148; TCGA OV -0.159; TCGA PAAD -0.193; TCGA UCEC -0.132 |
hsa-miR-125a-5p | RPS6KB2 | 11 cancers: BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; UCEC | miRanda | TCGA BRCA -0.276; TCGA CESC -0.17; TCGA COAD -0.086; TCGA ESCA -0.225; TCGA KIRC -0.395; TCGA LGG -0.08; TCGA LIHC -0.116; TCGA LUAD -0.06; TCGA LUSC -0.127; TCGA OV -0.191; TCGA UCEC -0.124 |
hsa-miR-125a-5p | MEN1 | 9 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; OV | miRanda | TCGA BRCA -0.12; TCGA COAD -0.081; TCGA ESCA -0.147; TCGA KIRC -0.077; TCGA KIRP -0.104; TCGA LGG -0.061; TCGA LIHC -0.142; TCGA LUSC -0.182; TCGA OV -0.173 |
hsa-miR-125a-5p | TRABD | 11 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.371; TCGA CESC -0.079; TCGA ESCA -0.247; TCGA KIRC -0.509; TCGA KIRP -0.216; TCGA LGG -0.193; TCGA LUSC -0.153; TCGA OV -0.202; TCGA PAAD -0.21; TCGA STAD -0.135; TCGA UCEC -0.103 |
hsa-miR-125a-5p | PSMD13 | 11 cancers: BRCA; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.12; TCGA ESCA -0.171; TCGA KIRC -0.177; TCGA LGG -0.055; TCGA LIHC -0.07; TCGA LUAD -0.078; TCGA LUSC -0.072; TCGA OV -0.146; TCGA PAAD -0.18; TCGA STAD -0.06; TCGA UCEC -0.227 |
hsa-miR-125a-5p | NR2C2AP | 11 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; SARC; UCEC | miRanda | TCGA BRCA -0.163; TCGA CESC -0.13; TCGA ESCA -0.278; TCGA KIRC -0.374; TCGA KIRP -0.26; TCGA LGG -0.158; TCGA LIHC -0.149; TCGA LUSC -0.372; TCGA PAAD -0.177; TCGA SARC -0.148; TCGA UCEC -0.238 |
hsa-miR-125a-5p | MRPS7 | 9 cancers: BRCA; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; OV; UCEC | miRanda | TCGA BRCA -0.07; TCGA COAD -0.09; TCGA ESCA -0.146; TCGA KIRP -0.17; TCGA LIHC -0.142; TCGA LUAD -0.11; TCGA LUSC -0.26; TCGA OV -0.212; TCGA UCEC -0.184 |
hsa-miR-125a-5p | FAM96A | 10 cancers: BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC | miRanda | TCGA BRCA -0.06; TCGA COAD -0.11; TCGA ESCA -0.199; TCGA LGG -0.05; TCGA LIHC -0.098; TCGA LUAD -0.113; TCGA LUSC -0.165; TCGA OV -0.132; TCGA PRAD -0.094; TCGA UCEC -0.25 |
hsa-miR-125a-5p | MRPL11 | 11 cancers: BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRanda | TCGA BRCA -0.154; TCGA COAD -0.16; TCGA ESCA -0.141; TCGA KIRC -0.131; TCGA LGG -0.118; TCGA LIHC -0.146; TCGA LUAD -0.15; TCGA LUSC -0.228; TCGA OV -0.179; TCGA PAAD -0.171; TCGA UCEC -0.151 |
hsa-miR-125a-5p | SMUG1 | 9 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV | miRanda | TCGA BRCA -0.065; TCGA ESCA -0.113; TCGA KIRC -0.206; TCGA KIRP -0.111; TCGA LGG -0.141; TCGA LIHC -0.121; TCGA LUAD -0.118; TCGA LUSC -0.222; TCGA OV -0.113 |
hsa-miR-125a-5p | HAX1 | 9 cancers: BRCA; CESC; ESCA; KIRC; LIHC; LUAD; LUSC; SARC; UCEC | miRanda | TCGA BRCA -0.069; TCGA CESC -0.097; TCGA ESCA -0.128; TCGA KIRC -0.149; TCGA LIHC -0.17; TCGA LUAD -0.143; TCGA LUSC -0.156; TCGA SARC -0.085; TCGA UCEC -0.15 |
hsa-miR-125a-5p | EME1 | 12 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRanda | TCGA BRCA -0.231; TCGA CESC -0.134; TCGA ESCA -0.211; TCGA KIRC -0.912; TCGA KIRP -0.556; TCGA LGG -0.328; TCGA LIHC -0.317; TCGA LUAD -0.432; TCGA LUSC -0.746; TCGA OV -0.43; TCGA PAAD -0.499; TCGA UCEC -0.199 |
hsa-miR-125a-5p | RTKN2 | 10 cancers: BRCA; CESC; COAD; LGG; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.113; TCGA CESC -0.21; TCGA COAD -0.147; TCGA LGG -0.543; TCGA OV -0.241; TCGA PAAD -0.31; TCGA PRAD -0.227; TCGA THCA -0.499; TCGA STAD -0.42; TCGA UCEC -0.297 |
hsa-miR-125a-5p | ARHGAP27 | 11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.175; TCGA CESC -0.143; TCGA ESCA -0.381; TCGA HNSC -0.137; TCGA KIRC -0.456; TCGA KIRP -0.467; TCGA LUSC -0.128; TCGA OV -0.131; TCGA PAAD -0.396; TCGA STAD -0.124; TCGA UCEC -0.14 |
hsa-miR-125a-5p | MRPL9 | 9 cancers: BRCA; CESC; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; UCEC | miRanda | TCGA BRCA -0.148; TCGA CESC -0.07; TCGA ESCA -0.191; TCGA KIRC -0.142; TCGA LIHC -0.105; TCGA LUAD -0.162; TCGA LUSC -0.218; TCGA PAAD -0.105; TCGA UCEC -0.159 |
hsa-miR-125a-5p | MRPL15 | 9 cancers: BRCA; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC | miRanda | TCGA BRCA -0.089; TCGA ESCA -0.222; TCGA LIHC -0.067; TCGA LUAD -0.241; TCGA LUSC -0.245; TCGA PAAD -0.244; TCGA PRAD -0.088; TCGA THCA -0.126; TCGA UCEC -0.267 |
hsa-miR-125a-5p | POLG | 9 cancers: BRCA; ESCA; KIRC; LGG; LUSC; PAAD; SARC; THCA; UCEC | miRanda | TCGA BRCA -0.08; TCGA ESCA -0.112; TCGA KIRC -0.303; TCGA LGG -0.079; TCGA LUSC -0.102; TCGA PAAD -0.182; TCGA SARC -0.161; TCGA THCA -0.091; TCGA UCEC -0.117 |
hsa-miR-125a-5p | NME2P1 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD | miRanda | TCGA BRCA -0.195; TCGA ESCA -0.433; TCGA KIRC -0.327; TCGA KIRP -0.498; TCGA LGG -0.157; TCGA LIHC -0.184; TCGA LUAD -0.329; TCGA LUSC -0.51; TCGA OV -0.183; TCGA PAAD -0.332 |
hsa-miR-125a-5p | TYSND1 | 10 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUSC; OV; STAD; UCEC | miRanda; miRNATAP | TCGA BRCA -0.056; TCGA CESC -0.131; TCGA ESCA -0.218; TCGA KIRC -0.152; TCGA LGG -0.375; TCGA LIHC -0.084; TCGA LUSC -0.311; TCGA OV -0.155; TCGA STAD -0.092; TCGA UCEC -0.093 |
hsa-miR-125a-5p | NCLN | 11 cancers: BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUSC; OV; STAD; UCEC | miRanda; mirMAP | TCGA BRCA -0.289; TCGA CESC -0.134; TCGA COAD -0.094; TCGA ESCA -0.313; TCGA KIRC -0.346; TCGA LGG -0.064; TCGA LIHC -0.145; TCGA LUSC -0.208; TCGA OV -0.158; TCGA STAD -0.122; TCGA UCEC -0.146 |
hsa-miR-125a-5p | TSFM | 9 cancers: BRCA; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; OV; UCEC | miRanda | TCGA BRCA -0.091; TCGA COAD -0.098; TCGA ESCA -0.166; TCGA KIRP -0.188; TCGA LIHC -0.104; TCGA LUAD -0.126; TCGA LUSC -0.217; TCGA OV -0.141; TCGA UCEC -0.226 |
hsa-miR-125a-5p | PLCB3 | 11 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; PAAD; SARC; STAD; UCEC | miRanda | TCGA BRCA -0.184; TCGA CESC -0.148; TCGA ESCA -0.391; TCGA KIRC -0.181; TCGA KIRP -0.095; TCGA LGG -0.268; TCGA LUSC -0.166; TCGA PAAD -0.361; TCGA SARC -0.139; TCGA STAD -0.157; TCGA UCEC -0.085 |
hsa-miR-125a-5p | WDR18 | 10 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; UCEC | miRanda | TCGA BRCA -0.265; TCGA COAD -0.112; TCGA ESCA -0.262; TCGA KIRC -0.2; TCGA KIRP -0.131; TCGA LGG -0.181; TCGA LIHC -0.106; TCGA LUSC -0.287; TCGA OV -0.159; TCGA UCEC -0.09 |
hsa-miR-125a-5p | XRCC3 | 11 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUSC; OV; STAD; UCEC | miRanda; mirMAP | TCGA BRCA -0.249; TCGA CESC -0.13; TCGA COAD -0.227; TCGA ESCA -0.163; TCGA KIRC -0.435; TCGA KIRP -0.179; TCGA LIHC -0.148; TCGA LUSC -0.357; TCGA OV -0.165; TCGA STAD -0.109; TCGA UCEC -0.168 |
hsa-miR-125a-5p | BIK | 10 cancers: BRCA; COAD; ESCA; KIRP; LUAD; LUSC; OV; PAAD; THCA; STAD | miRanda | TCGA BRCA -0.137; TCGA COAD -0.207; TCGA ESCA -0.642; TCGA KIRP -0.392; TCGA LUAD -0.166; TCGA LUSC -0.691; TCGA OV -0.29; TCGA PAAD -0.477; TCGA THCA -0.264; TCGA STAD -0.299 |
hsa-miR-125a-5p | HMBS | 12 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.192; TCGA ESCA -0.338; TCGA KIRC -0.209; TCGA KIRP -0.194; TCGA LGG -0.215; TCGA LIHC -0.165; TCGA LUAD -0.153; TCGA LUSC -0.347; TCGA OV -0.284; TCGA PAAD -0.258; TCGA STAD -0.109; TCGA UCEC -0.172 |
hsa-miR-125a-5p | PITPNC1 | 9 cancers: BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.092; TCGA ESCA -0.178; TCGA KIRC -0.175; TCGA KIRP -0.166; TCGA LIHC -0.105; TCGA LUAD -0.192; TCGA THCA -0.183; TCGA STAD -0.107; TCGA UCEC -0.159 |
hsa-miR-125a-5p | CARM1 | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC | miRanda | TCGA BRCA -0.161; TCGA CESC -0.131; TCGA COAD -0.078; TCGA ESCA -0.221; TCGA HNSC -0.09; TCGA KIRC -0.091; TCGA LIHC -0.059; TCGA LUAD -0.061; TCGA LUSC -0.323 |
hsa-miR-125a-5p | FRAT2 | 9 cancers: BRCA; ESCA; KIRP; LGG; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.123; TCGA ESCA -0.347; TCGA KIRP -0.113; TCGA LGG -0.085; TCGA LUSC -0.299; TCGA OV -0.193; TCGA PAAD -0.394; TCGA STAD -0.113; TCGA UCEC -0.182 |
hsa-miR-125a-5p | TBC1D7 | 10 cancers: BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRanda | TCGA BRCA -0.147; TCGA COAD -0.133; TCGA ESCA -0.18; TCGA LGG -0.189; TCGA LIHC -0.102; TCGA LUAD -0.125; TCGA LUSC -0.182; TCGA OV -0.233; TCGA PAAD -0.237; TCGA UCEC -0.184 |
hsa-miR-125a-5p | COMMD4 | 9 cancers: BRCA; ESCA; KIRC; LGG; LIHC; LUSC; OV; SARC; UCEC | miRanda | TCGA BRCA -0.178; TCGA ESCA -0.209; TCGA KIRC -0.192; TCGA LGG -0.105; TCGA LIHC -0.214; TCGA LUSC -0.149; TCGA OV -0.185; TCGA SARC -0.131; TCGA UCEC -0.221 |
hsa-miR-125a-5p | NDUFA7 | 10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUSC; OV; SARC; UCEC | miRanda | TCGA BRCA -0.135; TCGA CESC -0.127; TCGA ESCA -0.331; TCGA KIRC -0.216; TCGA KIRP -0.114; TCGA LIHC -0.219; TCGA LUSC -0.272; TCGA OV -0.257; TCGA SARC -0.205; TCGA UCEC -0.203 |
hsa-miR-125a-5p | BCL2L12 | 9 cancers: BRCA; ESCA; KIRC; KIRP; LIHC; LUSC; PAAD; THCA; UCEC | miRanda; miRNATAP | TCGA BRCA -0.341; TCGA ESCA -0.191; TCGA KIRC -0.344; TCGA KIRP -0.279; TCGA LIHC -0.112; TCGA LUSC -0.124; TCGA PAAD -0.512; TCGA THCA -0.065; TCGA UCEC -0.192 |
hsa-miR-125a-5p | RPL36A | 10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV | miRanda | TCGA BRCA -0.123; TCGA CESC -0.372; TCGA ESCA -0.242; TCGA KIRC -0.669; TCGA KIRP -0.327; TCGA LGG -0.269; TCGA LIHC -0.128; TCGA LUAD -0.166; TCGA LUSC -0.379; TCGA OV -0.164 |
hsa-miR-125a-5p | DDX49 | 10 cancers: BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUSC; OV; STAD; UCEC | miRanda | TCGA BRCA -0.214; TCGA CESC -0.12; TCGA ESCA -0.212; TCGA KIRC -0.24; TCGA LGG -0.149; TCGA LIHC -0.136; TCGA LUSC -0.279; TCGA OV -0.202; TCGA STAD -0.079; TCGA UCEC -0.086 |
hsa-miR-125a-5p | AIFM1 | 9 cancers: BRCA; ESCA; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD | miRanda | TCGA BRCA -0.069; TCGA ESCA -0.119; TCGA LIHC -0.144; TCGA LUAD -0.081; TCGA LUSC -0.254; TCGA OV -0.212; TCGA PAAD -0.115; TCGA THCA -0.082; TCGA STAD -0.121 |
hsa-miR-125a-5p | PPIA | 10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD | miRanda | TCGA BRCA -0.057; TCGA CESC -0.138; TCGA ESCA -0.322; TCGA KIRC -0.172; TCGA KIRP -0.199; TCGA LIHC -0.128; TCGA LUAD -0.138; TCGA LUSC -0.214; TCGA OV -0.187; TCGA PAAD -0.236 |
hsa-miR-125a-5p | F12 | 11 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; UCEC | miRanda | TCGA BRCA -0.541; TCGA CESC -0.397; TCGA ESCA -0.601; TCGA KIRC -1.212; TCGA KIRP -0.776; TCGA LGG -0.369; TCGA LIHC -0.414; TCGA LUAD -0.27; TCGA LUSC -0.765; TCGA OV -0.381; TCGA UCEC -0.342 |
hsa-miR-125a-5p | KIF18B | 16 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.41; TCGA CESC -0.197; TCGA COAD -0.129; TCGA ESCA -0.475; TCGA HNSC -0.102; TCGA KIRC -1.485; TCGA KIRP -0.526; TCGA LGG -0.817; TCGA LIHC -0.274; TCGA LUAD -0.59; TCGA LUSC -0.876; TCGA OV -0.465; TCGA PAAD -0.765; TCGA THCA -0.294; TCGA STAD -0.312; TCGA UCEC -0.306 |
hsa-miR-125a-5p | TMEM177 | 9 cancers: BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD | miRanda | TCGA BRCA -0.123; TCGA COAD -0.156; TCGA ESCA -0.167; TCGA LGG -0.085; TCGA LIHC -0.173; TCGA LUAD -0.121; TCGA LUSC -0.37; TCGA OV -0.148; TCGA PAAD -0.181 |
hsa-miR-125a-5p | PTCD1 | 11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; UCEC | mirMAP | TCGA BRCA -0.172; TCGA CESC -0.188; TCGA ESCA -0.18; TCGA HNSC -0.064; TCGA KIRC -0.113; TCGA KIRP -0.243; TCGA LIHC -0.158; TCGA LUAD -0.099; TCGA LUSC -0.257; TCGA OV -0.118; TCGA UCEC -0.076 |
hsa-miR-125a-5p | MOGS | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; PAAD; UCEC | mirMAP | TCGA BRCA -0.204; TCGA ESCA -0.105; TCGA KIRC -0.291; TCGA KIRP -0.24; TCGA LGG -0.133; TCGA LIHC -0.113; TCGA LUSC -0.179; TCGA OV -0.104; TCGA PAAD -0.091; TCGA UCEC -0.083 |
hsa-miR-125a-5p | SDC1 | 9 cancers: BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; UCEC | mirMAP | TCGA BRCA -0.257; TCGA CESC -0.472; TCGA ESCA -0.442; TCGA HNSC -0.125; TCGA LGG -0.233; TCGA LIHC -0.243; TCGA LUSC -0.288; TCGA PAAD -0.708; TCGA UCEC -0.269 |
hsa-miR-125a-5p | SLC27A4 | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; THCA; UCEC | mirMAP; miRNATAP | TCGA BRCA -0.12; TCGA CESC -0.277; TCGA COAD -0.11; TCGA ESCA -0.437; TCGA HNSC -0.16; TCGA LUAD -0.071; TCGA LUSC -0.324; TCGA OV -0.169; TCGA THCA -0.162; TCGA UCEC -0.205 |
hsa-miR-125a-5p | GMPPB | 9 cancers: BRCA; ESCA; KIRC; LIHC; OV; PAAD; SARC; THCA; UCEC | mirMAP | TCGA BRCA -0.19; TCGA ESCA -0.197; TCGA KIRC -0.188; TCGA LIHC -0.077; TCGA OV -0.213; TCGA PAAD -0.101; TCGA SARC -0.217; TCGA THCA -0.174; TCGA UCEC -0.109 |
hsa-miR-125a-5p | PFDN6 | 11 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; UCEC | mirMAP | TCGA BRCA -0.246; TCGA ESCA -0.346; TCGA KIRC -0.207; TCGA KIRP -0.159; TCGA LGG -0.078; TCGA LIHC -0.242; TCGA LUAD -0.123; TCGA LUSC -0.192; TCGA OV -0.192; TCGA SARC -0.114; TCGA UCEC -0.214 |
hsa-miR-125a-5p | ARID3A | 10 cancers: BRCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; THCA; UCEC | miRNATAP | TCGA BRCA -0.171; TCGA CESC -0.348; TCGA HNSC -0.113; TCGA KIRC -0.197; TCGA LGG -0.157; TCGA LUAD -0.157; TCGA LUSC -0.251; TCGA PRAD -0.096; TCGA THCA -0.106; TCGA UCEC -0.25 |
hsa-miR-125a-5p | PTBP1 | 11 cancers: BRCA; CESC; COAD; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | RAID | TCGA BRCA -0.077; TCGA CESC -0.073; TCGA COAD -0.125; TCGA KIRC -0.095; TCGA LGG -0.117; TCGA LIHC -0.06; TCGA LUAD -0.093; TCGA LUSC -0.191; TCGA PAAD -0.084; TCGA STAD -0.132; TCGA UCEC -0.08 |
hsa-miR-125a-5p | FERMT1 | 9 cancers: CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; THCA; STAD | miRNAWalker2 validate | TCGA CESC -0.854; TCGA ESCA -0.633; TCGA HNSC -0.219; TCGA LGG -1.032; TCGA LUAD -0.22; TCGA LUSC -0.737; TCGA PAAD -0.989; TCGA THCA -0.605; TCGA STAD -0.323 |
hsa-miR-125a-5p | HK2 | 12 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate; miRTarBase; miRanda | TCGA CESC -0.487; TCGA COAD -0.268; TCGA ESCA -0.241; TCGA HNSC -0.299; TCGA KIRC -1.126; TCGA KIRP -0.722; TCGA LUAD -0.244; TCGA LUSC -0.4; TCGA PAAD -0.739; TCGA PRAD -0.329; TCGA STAD -0.253; TCGA UCEC -0.168 |
hsa-miR-125a-5p | LYPLA1 | 12 cancers: CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.23; TCGA COAD -0.162; TCGA ESCA -0.181; TCGA HNSC -0.123; TCGA LIHC -0.069; TCGA LUAD -0.23; TCGA LUSC -0.239; TCGA OV -0.221; TCGA PRAD -0.249; TCGA THCA -0.147; TCGA STAD -0.218; TCGA UCEC -0.355 |
hsa-miR-125a-5p | RALBP1 | 9 cancers: CESC; HNSC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA CESC -0.163; TCGA HNSC -0.134; TCGA LUAD -0.111; TCGA LUSC -0.12; TCGA OV -0.132; TCGA PRAD -0.089; TCGA SARC -0.112; TCGA THCA -0.093; TCGA STAD -0.081 |
hsa-miR-125a-5p | SP1 | 9 cancers: CESC; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD | miRNAWalker2 validate | TCGA CESC -0.074; TCGA HNSC -0.165; TCGA KIRP -0.166; TCGA LGG -0.07; TCGA LUAD -0.079; TCGA LUSC -0.058; TCGA PAAD -0.144; TCGA PRAD -0.11; TCGA STAD -0.09 |
hsa-miR-125a-5p | TDG | 12 cancers: CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; miRanda | TCGA CESC -0.162; TCGA HNSC -0.107; TCGA KIRC -0.111; TCGA KIRP -0.112; TCGA LGG -0.121; TCGA LUAD -0.24; TCGA LUSC -0.326; TCGA OV -0.204; TCGA PRAD -0.134; TCGA THCA -0.051; TCGA STAD -0.118; TCGA UCEC -0.138 |
hsa-miR-125a-5p | ZDHHC9 | 11 cancers: CESC; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA CESC -0.095; TCGA ESCA -0.241; TCGA HNSC -0.108; TCGA LGG -0.141; TCGA LIHC -0.137; TCGA LUSC -0.108; TCGA PAAD -0.454; TCGA PRAD -0.155; TCGA THCA -0.132; TCGA STAD -0.175; TCGA UCEC -0.099 |
hsa-miR-125a-5p | DSG2 | 10 cancers: CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD | MirTarget; miRanda | TCGA CESC -0.184; TCGA COAD -0.156; TCGA ESCA -0.227; TCGA HNSC -0.192; TCGA LUAD -0.308; TCGA LUSC -0.417; TCGA OV -0.252; TCGA PAAD -0.264; TCGA PRAD -0.167; TCGA STAD -0.216 |
hsa-miR-125a-5p | LRRC8B | 12 cancers: CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRanda; miRNATAP | TCGA CESC -0.102; TCGA COAD -0.11; TCGA ESCA -0.128; TCGA HNSC -0.271; TCGA LUAD -0.118; TCGA LUSC -0.123; TCGA OV -0.126; TCGA PRAD -0.243; TCGA SARC -0.34; TCGA THCA -0.052; TCGA STAD -0.21; TCGA UCEC -0.16 |
hsa-miR-125a-5p | TRIAP1 | 12 cancers: CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA CESC -0.068; TCGA COAD -0.096; TCGA ESCA -0.163; TCGA KIRC -0.181; TCGA KIRP -0.184; TCGA LGG -0.182; TCGA LIHC -0.125; TCGA LUAD -0.136; TCGA LUSC -0.153; TCGA PAAD -0.142; TCGA STAD -0.116; TCGA UCEC -0.228 |
hsa-miR-125a-5p | MLX | 14 cancers: CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA CESC -0.148; TCGA ESCA -0.255; TCGA HNSC -0.06; TCGA KIRP -0.105; TCGA LGG -0.053; TCGA LIHC -0.163; TCGA LUAD -0.075; TCGA LUSC -0.186; TCGA OV -0.107; TCGA PAAD -0.125; TCGA PRAD -0.079; TCGA SARC -0.064; TCGA STAD -0.114; TCGA UCEC -0.222 |
hsa-miR-125a-5p | CORO2A | 9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; PRAD | MirTarget; miRanda | TCGA CESC -0.162; TCGA ESCA -0.289; TCGA HNSC -0.177; TCGA KIRC -0.659; TCGA KIRP -0.666; TCGA LUSC -0.322; TCGA OV -0.188; TCGA PAAD -0.642; TCGA PRAD -0.122 |
hsa-miR-125a-5p | HMGCR | 10 cancers: CESC; COAD; HNSC; LGG; LIHC; LUAD; OV; THCA; STAD; UCEC | PITA; miRanda | TCGA CESC -0.158; TCGA COAD -0.18; TCGA HNSC -0.238; TCGA LGG -0.293; TCGA LIHC -0.144; TCGA LUAD -0.101; TCGA OV -0.186; TCGA THCA -0.122; TCGA STAD -0.19; TCGA UCEC -0.24 |
hsa-miR-125a-5p | PPP2R1B | 11 cancers: CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | PITA; miRanda | TCGA CESC -0.115; TCGA COAD -0.098; TCGA HNSC -0.084; TCGA LIHC -0.094; TCGA LUAD -0.195; TCGA LUSC -0.224; TCGA OV -0.264; TCGA PRAD -0.085; TCGA THCA -0.092; TCGA STAD -0.11; TCGA UCEC -0.189 |
hsa-miR-125a-5p | NCBP2 | 10 cancers: CESC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRanda | TCGA CESC -0.085; TCGA KIRP -0.077; TCGA LGG -0.075; TCGA LUAD -0.109; TCGA LUSC -0.313; TCGA OV -0.124; TCGA PAAD -0.094; TCGA PRAD -0.068; TCGA STAD -0.091; TCGA UCEC -0.146 |
hsa-miR-125a-5p | NKIRAS2 | 10 cancers: CESC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRanda | TCGA CESC -0.071; TCGA KIRC -0.149; TCGA KIRP -0.296; TCGA LGG -0.285; TCGA LIHC -0.09; TCGA LUAD -0.09; TCGA LUSC -0.235; TCGA OV -0.12; TCGA PAAD -0.105; TCGA UCEC -0.087 |
hsa-miR-125a-5p | BCL2L13 | 9 cancers: CESC; HNSC; LGG; LUAD; LUSC; PRAD; SARC; THCA; UCEC | miRanda; mirMAP | TCGA CESC -0.135; TCGA HNSC -0.104; TCGA LGG -0.107; TCGA LUAD -0.112; TCGA LUSC -0.117; TCGA PRAD -0.074; TCGA SARC -0.228; TCGA THCA -0.06; TCGA UCEC -0.097 |
hsa-miR-125a-5p | IL22RA1 | 9 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; SARC | miRanda | TCGA CESC -0.373; TCGA ESCA -0.456; TCGA HNSC -0.18; TCGA KIRC -1.142; TCGA KIRP -0.948; TCGA LUSC -0.307; TCGA OV -0.343; TCGA PAAD -0.916; TCGA SARC -0.583 |
hsa-miR-125a-5p | ZCCHC8 | 9 cancers: CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD | miRanda | TCGA CESC -0.117; TCGA COAD -0.068; TCGA ESCA -0.098; TCGA HNSC -0.089; TCGA LGG -0.142; TCGA LUAD -0.092; TCGA LUSC -0.137; TCGA PRAD -0.055; TCGA STAD -0.135 |
hsa-miR-125a-5p | ESCO1 | 9 cancers: CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA CESC -0.066; TCGA COAD -0.111; TCGA HNSC -0.063; TCGA LGG -0.102; TCGA LUAD -0.104; TCGA LUSC -0.262; TCGA OV -0.263; TCGA STAD -0.151; TCGA UCEC -0.168 |
hsa-miR-125a-5p | MREG | 9 cancers: CESC; COAD; HNSC; LIHC; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA CESC -0.288; TCGA COAD -0.135; TCGA HNSC -0.162; TCGA LIHC -0.08; TCGA LUSC -0.15; TCGA OV -0.228; TCGA PAAD -0.184; TCGA STAD -0.282; TCGA UCEC -0.185 |
hsa-miR-125a-5p | YWHAZ | 10 cancers: CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | miRanda | TCGA CESC -0.201; TCGA ESCA -0.296; TCGA HNSC -0.132; TCGA LUAD -0.237; TCGA LUSC -0.264; TCGA PAAD -0.237; TCGA PRAD -0.155; TCGA SARC -0.103; TCGA STAD -0.121; TCGA UCEC -0.186 |
hsa-miR-125a-5p | MRPL30 | 12 cancers: CESC; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | miRanda | TCGA CESC -0.079; TCGA COAD -0.146; TCGA ESCA -0.134; TCGA LGG -0.16; TCGA LIHC -0.055; TCGA LUAD -0.162; TCGA LUSC -0.267; TCGA OV -0.105; TCGA PAAD -0.105; TCGA PRAD -0.073; TCGA STAD -0.139; TCGA UCEC -0.111 |
hsa-miR-125a-5p | GTF3C3 | 9 cancers: CESC; HNSC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD | miRanda | TCGA CESC -0.155; TCGA HNSC -0.116; TCGA LGG -0.148; TCGA LUAD -0.147; TCGA LUSC -0.194; TCGA OV -0.139; TCGA PRAD -0.11; TCGA THCA -0.08; TCGA STAD -0.138 |
hsa-miR-125a-5p | TAF12 | 10 cancers: CESC; ESCA; KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; UCEC | miRanda | TCGA CESC -0.167; TCGA ESCA -0.162; TCGA KIRC -0.104; TCGA KIRP -0.084; TCGA LIHC -0.101; TCGA LUAD -0.072; TCGA OV -0.167; TCGA PAAD -0.132; TCGA PRAD -0.116; TCGA UCEC -0.139 |
hsa-miR-125a-5p | VDAC1 | 11 cancers: CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; UCEC | miRanda | TCGA CESC -0.092; TCGA ESCA -0.253; TCGA HNSC -0.071; TCGA KIRC -0.132; TCGA LIHC -0.066; TCGA LUAD -0.205; TCGA LUSC -0.249; TCGA OV -0.218; TCGA PAAD -0.245; TCGA PRAD -0.102; TCGA UCEC -0.24 |
hsa-miR-125a-5p | TRMT6 | 10 cancers: CESC; ESCA; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD; UCEC | miRanda | TCGA CESC -0.146; TCGA ESCA -0.123; TCGA LGG -0.054; TCGA LIHC -0.073; TCGA LUAD -0.159; TCGA LUSC -0.208; TCGA OV -0.14; TCGA THCA -0.104; TCGA STAD -0.112; TCGA UCEC -0.224 |
hsa-miR-125a-5p | CCDC47 | 11 cancers: CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRanda | TCGA CESC -0.093; TCGA ESCA -0.184; TCGA HNSC -0.164; TCGA LGG -0.072; TCGA LIHC -0.096; TCGA LUAD -0.123; TCGA LUSC -0.252; TCGA OV -0.122; TCGA PRAD -0.078; TCGA STAD -0.096; TCGA UCEC -0.181 |
hsa-miR-125a-5p | PSMD7 | 9 cancers: CESC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; THCA; UCEC | miRanda; miRNATAP | TCGA CESC -0.098; TCGA KIRC -0.113; TCGA KIRP -0.076; TCGA LUAD -0.111; TCGA LUSC -0.161; TCGA OV -0.11; TCGA PAAD -0.202; TCGA THCA -0.124; TCGA UCEC -0.269 |
hsa-miR-125a-5p | NAA25 | 11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC | miRanda | TCGA CESC -0.183; TCGA ESCA -0.091; TCGA HNSC -0.108; TCGA KIRC -0.123; TCGA KIRP -0.094; TCGA LGG -0.051; TCGA LUAD -0.211; TCGA LUSC -0.271; TCGA PRAD -0.082; TCGA STAD -0.207; TCGA UCEC -0.141 |
hsa-miR-125a-5p | FEM1A | 9 cancers: CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; STAD; UCEC | miRanda | TCGA CESC -0.18; TCGA COAD -0.082; TCGA ESCA -0.129; TCGA HNSC -0.098; TCGA LGG -0.135; TCGA LIHC -0.099; TCGA LUSC -0.158; TCGA STAD -0.072; TCGA UCEC -0.111 |
hsa-miR-125a-5p | GBP2 | 10 cancers: CESC; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; SARC; THCA; UCEC | miRanda | TCGA CESC -0.311; TCGA HNSC -0.124; TCGA KIRC -0.801; TCGA KIRP -0.184; TCGA LIHC -0.206; TCGA LUAD -0.108; TCGA PAAD -0.498; TCGA SARC -0.993; TCGA THCA -0.276; TCGA UCEC -0.207 |
hsa-miR-125a-5p | CLDN12 | 11 cancers: COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA COAD -0.143; TCGA ESCA -0.363; TCGA HNSC -0.08; TCGA KIRP -0.308; TCGA LIHC -0.119; TCGA LUAD -0.241; TCGA LUSC -0.1; TCGA PAAD -0.186; TCGA PRAD -0.15; TCGA THCA -0.056; TCGA STAD -0.213 |
hsa-miR-125a-5p | COIL | 9 cancers: COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; UCEC | miRNAWalker2 validate | TCGA COAD -0.093; TCGA ESCA -0.089; TCGA HNSC -0.083; TCGA LGG -0.076; TCGA LIHC -0.074; TCGA LUAD -0.135; TCGA LUSC -0.263; TCGA OV -0.128; TCGA UCEC -0.09 |
hsa-miR-125a-5p | RFC5 | 11 cancers: COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget; miRanda | TCGA COAD -0.156; TCGA ESCA -0.17; TCGA HNSC -0.111; TCGA KIRP -0.127; TCGA LIHC -0.1; TCGA LUAD -0.288; TCGA LUSC -0.394; TCGA OV -0.194; TCGA PRAD -0.068; TCGA STAD -0.174; TCGA UCEC -0.197 |
hsa-miR-125a-5p | CASP2 | 11 cancers: COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; THCA; STAD | MirTarget; PITA | TCGA COAD -0.072; TCGA HNSC -0.083; TCGA KIRC -0.094; TCGA KIRP -0.302; TCGA LGG -0.159; TCGA LUAD -0.097; TCGA LUSC -0.135; TCGA OV -0.11; TCGA PAAD -0.091; TCGA THCA -0.091; TCGA STAD -0.216 |
hsa-miR-125a-5p | SLC39A9 | 9 cancers: COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; PITA; miRanda | TCGA COAD -0.158; TCGA ESCA -0.117; TCGA HNSC -0.102; TCGA LGG -0.096; TCGA LUAD -0.061; TCGA LUSC -0.092; TCGA PRAD -0.112; TCGA STAD -0.099; TCGA UCEC -0.095 |
hsa-miR-125a-5p | NT5DC1 | 9 cancers: COAD; ESCA; HNSC; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget; miRanda | TCGA COAD -0.183; TCGA ESCA -0.119; TCGA HNSC -0.056; TCGA OV -0.153; TCGA PAAD -0.096; TCGA SARC -0.211; TCGA THCA -0.089; TCGA STAD -0.157; TCGA UCEC -0.174 |
hsa-miR-125a-5p | TMEM123 | 9 cancers: COAD; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRanda | TCGA COAD -0.095; TCGA LUAD -0.114; TCGA LUSC -0.151; TCGA PAAD -0.187; TCGA PRAD -0.157; TCGA SARC -0.29; TCGA THCA -0.148; TCGA STAD -0.155; TCGA UCEC -0.16 |
hsa-miR-125a-5p | E2F3 | 9 cancers: COAD; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | PITA; miRanda; miRNATAP | TCGA COAD -0.089; TCGA KIRC -0.27; TCGA LGG -0.182; TCGA LUAD -0.231; TCGA LUSC -0.199; TCGA PAAD -0.236; TCGA PRAD -0.165; TCGA STAD -0.126; TCGA UCEC -0.117 |
hsa-miR-125a-5p | XPNPEP3 | 9 cancers: COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD | miRanda | TCGA COAD -0.112; TCGA HNSC -0.088; TCGA LGG -0.171; TCGA LUAD -0.092; TCGA LUSC -0.208; TCGA OV -0.199; TCGA PRAD -0.072; TCGA THCA -0.129; TCGA STAD -0.081 |
hsa-miR-125a-5p | GPR160 | 9 cancers: COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; THCA; UCEC | miRanda | TCGA COAD -0.218; TCGA ESCA -0.372; TCGA HNSC -0.229; TCGA LUSC -0.283; TCGA OV -0.411; TCGA PAAD -0.327; TCGA PRAD -0.323; TCGA THCA -0.167; TCGA UCEC -0.374 |
hsa-miR-125a-5p | CASP6 | 10 cancers: COAD; KIRC; KIRP; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA COAD -0.134; TCGA KIRC -0.15; TCGA KIRP -0.183; TCGA LUAD -0.117; TCGA OV -0.145; TCGA PAAD -0.343; TCGA PRAD -0.083; TCGA THCA -0.056; TCGA STAD -0.106; TCGA UCEC -0.171 |
hsa-miR-125a-5p | TXNDC16 | 9 cancers: COAD; HNSC; LGG; LIHC; OV; PRAD; THCA; STAD; UCEC | miRanda | TCGA COAD -0.205; TCGA HNSC -0.134; TCGA LGG -0.155; TCGA LIHC -0.077; TCGA OV -0.166; TCGA PRAD -0.139; TCGA THCA -0.203; TCGA STAD -0.173; TCGA UCEC -0.112 |
hsa-miR-125a-5p | FANCI | 15 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | miRanda | TCGA COAD -0.171; TCGA ESCA -0.246; TCGA HNSC -0.091; TCGA KIRC -0.512; TCGA KIRP -0.168; TCGA LGG -0.343; TCGA LIHC -0.181; TCGA LUAD -0.417; TCGA LUSC -0.546; TCGA OV -0.367; TCGA PAAD -0.389; TCGA PRAD -0.103; TCGA SARC -0.219; TCGA STAD -0.179; TCGA UCEC -0.316 |
hsa-miR-125a-5p | CCT2 | 10 cancers: COAD; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA COAD -0.109; TCGA LGG -0.117; TCGA LUAD -0.252; TCGA LUSC -0.2; TCGA OV -0.176; TCGA PAAD -0.121; TCGA PRAD -0.087; TCGA THCA -0.089; TCGA STAD -0.112; TCGA UCEC -0.166 |
hsa-miR-125a-5p | COX11 | 9 cancers: COAD; ESCA; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | miRanda | TCGA COAD -0.15; TCGA ESCA -0.102; TCGA LIHC -0.102; TCGA LUAD -0.114; TCGA LUSC -0.212; TCGA OV -0.154; TCGA SARC -0.09; TCGA STAD -0.119; TCGA UCEC -0.178 |
hsa-miR-125a-5p | PRRC1 | 9 cancers: ESCA; HNSC; LGG; LIHC; LUAD; PRAD; THCA; STAD; UCEC | MirTarget; miRanda | TCGA ESCA -0.076; TCGA HNSC -0.096; TCGA LGG -0.185; TCGA LIHC -0.06; TCGA LUAD -0.105; TCGA PRAD -0.161; TCGA THCA -0.061; TCGA STAD -0.096; TCGA UCEC -0.093 |
hsa-miR-125a-5p | SMARCD2 | 10 cancers: ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA ESCA -0.208; TCGA KIRC -0.103; TCGA KIRP -0.281; TCGA LIHC -0.122; TCGA LUAD -0.05; TCGA LUSC -0.26; TCGA OV -0.121; TCGA PAAD -0.204; TCGA STAD -0.088; TCGA UCEC -0.115 |
hsa-miR-125a-5p | ZNHIT3 | 10 cancers: ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC | miRanda | TCGA ESCA -0.152; TCGA KIRC -0.092; TCGA KIRP -0.181; TCGA LGG -0.08; TCGA LIHC -0.125; TCGA LUAD -0.099; TCGA LUSC -0.277; TCGA SARC -0.135; TCGA STAD -0.106; TCGA UCEC -0.17 |
hsa-miR-125a-5p | RFT1 | 9 cancers: ESCA; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; UCEC | mirMAP | TCGA ESCA -0.121; TCGA KIRP -0.099; TCGA LIHC -0.134; TCGA LUAD -0.084; TCGA LUSC -0.133; TCGA OV -0.152; TCGA PAAD -0.092; TCGA PRAD -0.051; TCGA UCEC -0.063 |
hsa-miR-125a-5p | NUPL2 | 10 cancers: KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRanda | TCGA KIRC -0.087; TCGA KIRP -0.12; TCGA LGG -0.207; TCGA LIHC -0.093; TCGA LUAD -0.099; TCGA LUSC -0.171; TCGA OV -0.119; TCGA PRAD -0.067; TCGA STAD -0.123; TCGA UCEC -0.089 |
Enriched cancer pathways of putative targets