microRNA information: hsa-miR-127-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-127-5p | miRbase |
| Accession: | MIMAT0004604 | miRbase |
| Precursor name: | hsa-mir-127 | miRbase |
| Precursor accession: | MI0000472 | miRbase |
| Symbol: | MIR127 | HGNC |
| RefSeq ID: | NR_029696 | GenBank |
| Sequence: | CUGAAGCUCAGAGGGCUCUGAU |
Reported expression in cancers: hsa-miR-127-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-127-5p | breast cancer | downregulation | "Prognostic and biological significance of microRNA ......" | 25477702 | Reverse transcription PCR |
| hsa-miR-127-5p | colon cancer | downregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
| hsa-miR-127-5p | esophageal cancer | downregulation | "Quantitative RT-PCR qRT-PCR was used to compare mi ......" | 27645894 | qPCR |
| hsa-miR-127-5p | gastric cancer | downregulation | "The Tumor Suppressor Roles of miR 433 and miR 127 ......" | 23880861 | |
| hsa-miR-127-5p | liver cancer | downregulation | "In this study we showed that miR-127-5p suppressed ......" | 26708147 | |
| hsa-miR-127-5p | pancreatic cancer | downregulation | "MicroRNA 127 is aberrantly downregulated and acted ......" | 27571739 |
Reported cancer pathway affected by hsa-miR-127-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-127-5p | breast cancer | Apoptosis pathway | "Prognostic and biological significance of microRNA ......" | 25477702 | |
| hsa-miR-127-5p | gastric cancer | cell cycle pathway | "The Tumor Suppressor Roles of miR 433 and miR 127 ......" | 23880861 | |
| hsa-miR-127-5p | pancreatic cancer | cell cycle pathway | "MicroRNA 127 is aberrantly downregulated and acted ......" | 27571739 | Luciferase |
Reported cancer prognosis affected by hsa-miR-127-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-127-5p | B cell lymphoma | poor survival | "Finally eight miRNAs were found to correlate with ......" | 18537969 | |
| hsa-miR-127-5p | breast cancer | poor survival | "To investigate the global expression profile of mi ......" | 18812439 | |
| hsa-miR-127-5p | breast cancer | metastasis | "MicroRNA 127 is downregulated by Tudor SN protein ......" | 24155205 | |
| hsa-miR-127-5p | breast cancer | malignant trasformation; staging; metastasis; poor survival | "Prognostic and biological significance of microRNA ......" | 25477702 | |
| hsa-miR-127-5p | cervical and endocervical cancer | staging; metastasis | "In this study we profiled miRNA expression in 10 e ......" | 18451214 | |
| hsa-miR-127-5p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
| hsa-miR-127-5p | gastric cancer | staging; progression; cell migration | "The Tumor Suppressor Roles of miR 433 and miR 127 ......" | 23880861 | |
| hsa-miR-127-5p | glioblastoma | cell migration | "MicroRNA 127 3p promotes glioblastoma cell migrati ......" | 24604520 | |
| hsa-miR-127-5p | kidney papillary renal cell cancer | staging; poor survival; progression | "In the training stage the expression levels of 12 ......" | 25906110 | |
| hsa-miR-127-5p | liver cancer | staging | "MicroRNA 127 post transcriptionally downregulates ......" | 24854842 | Western blot; Luciferase |
| hsa-miR-127-5p | lung cancer | staging | "Individuals with the highest levels of methylated ......" | 24665010 | |
| hsa-miR-127-5p | lymphoma | differentiation | "Here we investigated the expression of specific mi ......" | 19530237 | |
| hsa-miR-127-5p | lymphoma | differentiation | "Epstein Barr nuclear antigen 1 induces expression ......" | 22941339 | |
| hsa-miR-127-5p | pancreatic cancer | progression | "MicroRNA 127 is aberrantly downregulated and acted ......" | 27571739 | Luciferase |
Reported gene related to hsa-miR-127-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-127-5p | ovarian cancer | BAG5 | "MicroRNA 127 3p acts as a tumor suppressor in epit ......" | 27571744 |
| hsa-miR-127-5p | pancreatic cancer | BAG5 | "Dual-luciferase reporter assay and qRT-PCR were pe ......" | 27571739 |
| hsa-miR-127-5p | glioblastoma | SEPT7 | "MicroRNA 127 3p promotes glioblastoma cell migrati ......" | 24604520 |
| hsa-miR-127-5p | liver cancer | SEPT7 | "MicroRNA 127 post transcriptionally downregulates ......" | 24854842 |
| hsa-miR-127-5p | liver cancer | AFP | "MiR-127 is downregulated in 69.7% of HCC tissues c ......" | 24854842 |
| hsa-miR-127-5p | breast cancer | BCL6 | "Functional analyses showed that upregulation of mi ......" | 25477702 |
| hsa-miR-127-5p | liver cancer | BLVRB | "Furthermore BLVRB blockade inhibited the phosphory ......" | 26708147 |
| hsa-miR-127-5p | breast cancer | CXCL12 | "Analyses of miRNA expression profiles identified n ......" | 21343399 |
| hsa-miR-127-5p | esophageal cancer | FMNL3 | "MicroRNA 127 is a tumor suppressor in human esopha ......" | 27645894 |
| hsa-miR-127-5p | gastric cancer | KRAS | "Furthermore the ectopic expression of miR-433 and ......" | 23880861 |
| hsa-miR-127-5p | gastric cancer | MAPK4 | "Furthermore the ectopic expression of miR-433 and ......" | 23880861 |
| hsa-miR-127-5p | bladder cancer | PIK3R1 | "Integrated gene network analysis and text mining r ......" | 24004856 |
| hsa-miR-127-5p | lymphoma | PRDM1 | "In addition we found evidence that hsa-miR-127 is ......" | 19530237 |
| hsa-miR-127-5p | thyroid cancer | RET | "Significantly lower miR-127 levels were observed i ......" | 22747440 |
| hsa-miR-127-5p | lymphoma | RFXANK | "Here we investigated the expression of specific mi ......" | 19530237 |
| hsa-miR-127-5p | sarcoma | SETD8 | "MicroRNA 127 3p inhibits proliferation and invasio ......" | 26707641 |
| hsa-miR-127-5p | glioblastoma | SKI | "Next generation sequencing analysis of miRNAs: MiR ......" | 24517116 |
| hsa-miR-127-5p | breast cancer | SND1 | "MicroRNA 127 is downregulated by Tudor SN protein ......" | 24155205 |
| hsa-miR-127-5p | lymphoma | XBP1 | "In addition we found evidence that hsa-miR-127 is ......" | 19530237 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-127-5p | ARGLU1 | 10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; STAD | MirTarget | TCGA BLCA -0.075; TCGA BRCA -0.077; TCGA ESCA -0.208; TCGA KIRC -0.234; TCGA KIRP -0.185; TCGA LGG -0.066; TCGA LUAD -0.064; TCGA LUSC -0.165; TCGA PAAD -0.134; TCGA STAD -0.149 |
hsa-miR-127-5p | ECHDC2 | 11 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.098; TCGA BRCA -0.195; TCGA ESCA -0.316; TCGA KIRC -0.11; TCGA LIHC -0.084; TCGA LUAD -0.097; TCGA LUSC -0.211; TCGA OV -0.084; TCGA SARC -0.12; TCGA THCA -0.057; TCGA STAD -0.258 |
hsa-miR-127-5p | TOB1 | 10 cancers: BLCA; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | PITA; miRNATAP | TCGA BLCA -0.115; TCGA ESCA -0.273; TCGA HNSC -0.061; TCGA LIHC -0.085; TCGA LUAD -0.147; TCGA LUSC -0.101; TCGA PRAD -0.113; TCGA SARC -0.111; TCGA STAD -0.143; TCGA UCEC -0.065 |
hsa-miR-127-5p | MDM4 | 9 cancers: BLCA; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; STAD | mirMAP | TCGA BLCA -0.093; TCGA ESCA -0.129; TCGA KIRC -0.159; TCGA KIRP -0.114; TCGA LGG -0.092; TCGA LUAD -0.07; TCGA LUSC -0.078; TCGA PAAD -0.092; TCGA STAD -0.199 |
hsa-miR-127-5p | CELF6 | 9 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LIHC; LUSC; SARC; THCA | miRNATAP | TCGA BLCA -0.13; TCGA BRCA -0.181; TCGA ESCA -0.281; TCGA KIRC -0.313; TCGA KIRP -0.211; TCGA LIHC -0.274; TCGA LUSC -0.181; TCGA SARC -0.083; TCGA THCA -0.051 |
hsa-miR-127-5p | ASB16 | 9 cancers: BLCA; BRCA; ESCA; KIRP; LGG; LUSC; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.158; TCGA BRCA -0.197; TCGA ESCA -0.129; TCGA KIRP -0.073; TCGA LGG -0.065; TCGA LUSC -0.144; TCGA SARC -0.228; TCGA THCA -0.08; TCGA STAD -0.182 |
hsa-miR-127-5p | NEDD4L | 9 cancers: BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD | mirMAP | TCGA BRCA -0.061; TCGA COAD -0.153; TCGA ESCA -0.192; TCGA HNSC -0.081; TCGA LIHC -0.122; TCGA LUAD -0.165; TCGA LUSC -0.218; TCGA PRAD -0.128; TCGA STAD -0.091 |
hsa-miR-127-5p | MRPS25 | 10 cancers: BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; UCEC | mirMAP | TCGA BRCA -0.068; TCGA ESCA -0.226; TCGA HNSC -0.066; TCGA KIRP -0.088; TCGA LIHC -0.057; TCGA LUAD -0.092; TCGA LUSC -0.127; TCGA OV -0.085; TCGA PAAD -0.109; TCGA UCEC -0.083 |
hsa-miR-127-5p | EFCAB2 | 10 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; SARC; THCA | mirMAP | TCGA BRCA -0.056; TCGA COAD -0.173; TCGA ESCA -0.18; TCGA KIRC -0.112; TCGA KIRP -0.072; TCGA LGG -0.079; TCGA LIHC -0.051; TCGA LUSC -0.221; TCGA SARC -0.055; TCGA THCA -0.074 |
Enriched cancer pathways of putative targets