microRNA information: hsa-miR-1307-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1307-3p | miRbase |
| Accession: | MIMAT0005951 | miRbase |
| Precursor name: | hsa-mir-1307 | miRbase |
| Precursor accession: | MI0006444 | miRbase |
| Symbol: | MIR1307 | HGNC |
| RefSeq ID: | NR_031707 | GenBank |
| Sequence: | ACUCGGCGUGGCGUCGGUCGUG |
Reported expression in cancers: hsa-miR-1307-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-1307-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-1307-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1307-3p | liver cancer | malignant trasformation | "Using gene expression microarrays and high-through ......" | 26646011 | |
| hsa-miR-1307-3p | ovarian cancer | differentiation | "The clinicopathological significance of miR 1307 i ......" | 25887170 | Luciferase |
Reported gene related to hsa-miR-1307-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|
Expression profile in cancer corhorts:
