microRNA information: hsa-miR-134-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-134-5p | miRbase |
| Accession: | MIMAT0000447 | miRbase |
| Precursor name: | hsa-mir-134 | miRbase |
| Precursor accession: | MI0000474 | miRbase |
| Symbol: | MIR134 | HGNC |
| RefSeq ID: | NR_029698 | GenBank |
| Sequence: | UGUGACUGGUUGACCAGAGGGG |
Reported expression in cancers: hsa-miR-134-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-134-5p | breast cancer | downregulation | "miR 134 in extracellular vesicles reduces triple n ......" | 26416415 | |
| hsa-miR-134-5p | colon cancer | upregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
| hsa-miR-134-5p | colorectal cancer | downregulation | "Decreased Expression of MIR 134 and its Clinical S ......" | 26897940 | qPCR |
| hsa-miR-134-5p | head and neck cancer | upregulation | "Our study investigated the pathogenic implications ......" | 23824713 | Microarray |
| hsa-miR-134-5p | kidney renal cell cancer | downregulation | "The miRNA miR-134 has been found to be downregulat ......" | 25811077 | qPCR |
| hsa-miR-134-5p | lung cancer | upregulation | "Overexpression of miR-134 and miR-487b promoted th ......" | 24258346 | |
| hsa-miR-134-5p | lung cancer | upregulation | "Two lung development related microRNAs miR 134 and ......" | 26642897 | qPCR |
| hsa-miR-134-5p | lung squamous cell cancer | downregulation | "Hsa-miRNA-134 miR-134 has recently been discovered ......" | 27166267 |
Reported cancer pathway affected by hsa-miR-134-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-134-5p | breast cancer | Apoptosis pathway | "MicroRNA 134 modulates resistance to doxorubicin i ......" | 26318721 | MTT assay |
| hsa-miR-134-5p | breast cancer | Apoptosis pathway | "miR 134 in extracellular vesicles reduces triple n ......" | 26416415 | |
| hsa-miR-134-5p | breast cancer | Apoptosis pathway | "Here we firstly identified miR-134 as a target of ......" | 26823765 | |
| hsa-miR-134-5p | colorectal cancer | Apoptosis pathway | "Decreased Expression of MIR 134 and its Clinical S ......" | 26897940 | |
| hsa-miR-134-5p | glioblastoma | Apoptosis pathway | "MiR 134 regulates the proliferation and invasion o ......" | 23467648 | Luciferase |
| hsa-miR-134-5p | glioblastoma | MAPK signaling pathway | "Multiple receptor tyrosine kinases converge on mic ......" | 24440911 | |
| hsa-miR-134-5p | kidney renal cell cancer | cell cycle pathway; Epithelial mesenchymal transition pathway; PI3K/Akt signaling pathway | "miR 134 functions as a tumor suppressor in cell pr ......" | 25811077 | Luciferase; Western blot |
| hsa-miR-134-5p | lung cancer | Apoptosis pathway | "MicroRNA 134 regulates lung cancer cell H69 growth ......" | 26166818 | Flow cytometry; MTT assay; Western blot |
| hsa-miR-134-5p | lung squamous cell cancer | Apoptosis pathway | "Hsa miR 134 suppresses non small cell lung cancer ......" | 27166267 | Colony formation |
| hsa-miR-134-5p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "miR 134 inhibits non small cell lung cancer growth ......" | 27241841 | Luciferase; RNAi |
| hsa-miR-134-5p | ovarian cancer | Apoptosis pathway | "Down regulated expression of miR 134 contributes t ......" | 26363097 | |
| hsa-miR-134-5p | sarcoma | Apoptosis pathway | "Decreased miR 134 expression and its tumor suppres ......" | 26681023 | Flow cytometry; Cell migration assay |
Reported cancer prognosis affected by hsa-miR-134-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-134-5p | breast cancer | malignant trasformation | "In support of these findings in vitro functional s ......" | 24104550 | |
| hsa-miR-134-5p | breast cancer | drug resistance | "We used RNAi-mediated p53 knockdown KD and antagom ......" | 25123132 | RNAi |
| hsa-miR-134-5p | breast cancer | drug resistance | "MicroRNA 134 modulates resistance to doxorubicin i ......" | 26318721 | MTT assay |
| hsa-miR-134-5p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
| hsa-miR-134-5p | colorectal cancer | staging | "We measured the levels of 12 miRNAs miR-134 -146a ......" | 19876917 | |
| hsa-miR-134-5p | colorectal cancer | tumorigenesis; worse prognosis; staging; metastasis; poor survival; tumor size | "Decreased Expression of MIR 134 and its Clinical S ......" | 26897940 | |
| hsa-miR-134-5p | gastric cancer | malignant trasformation | "Among these five miRNAs i.e hsa-miR-508-5p hsa-miR ......" | 24422944 | |
| hsa-miR-134-5p | glioblastoma | progression; differentiation | "MiR 134 regulates the proliferation and invasion o ......" | 23467648 | Luciferase |
| hsa-miR-134-5p | glioblastoma | poor survival | "Multiple receptor tyrosine kinases converge on mic ......" | 24440911 | |
| hsa-miR-134-5p | head and neck cancer | metastasis; tumorigenesis; worse prognosis; poor survival | "miR 134 induces oncogenicity and metastasis in hea ......" | 23824713 | |
| hsa-miR-134-5p | kidney papillary renal cell cancer | staging; poor survival | "In the training stage the expression levels of 12 ......" | 25906110 | |
| hsa-miR-134-5p | kidney renal cell cancer | metastasis | "miR 134 functions as a tumor suppressor in cell pr ......" | 25811077 | Luciferase; Western blot |
| hsa-miR-134-5p | liver cancer | tumorigenesis | "Hepatocyte nuclear factor 4α reverses malignancy ......" | 23775631 | |
| hsa-miR-134-5p | liver cancer | metastasis; cell migration | "Genome wide screening identified that miR 134 acts ......" | 24498348 | Cell migration assay; Wound Healing Assay |
| hsa-miR-134-5p | lung cancer | drug resistance | "miRNA array and real-time quantitative reverse tra ......" | 24258346 | |
| hsa-miR-134-5p | lung cancer | malignant trasformation | "Diagnostic Value of Circulating Extracellular miR ......" | 24851110 | |
| hsa-miR-134-5p | lung squamous cell cancer | drug resistance; poor survival | "To better understand the molecular mechanisms of m ......" | 20371173 | |
| hsa-miR-134-5p | melanoma | metastasis; poor survival; immune resistance | "High intensity focused ultrasound enhances anti tu ......" | 26485753 | |
| hsa-miR-134-5p | melanoma | metastasis | "Based on chromosomal 3 aberration UM n = 86 were g ......" | 26812476 | |
| hsa-miR-134-5p | ovarian cancer | tumorigenesis; drug resistance | "Hybrid polymerase chain reaction to identify novel ......" | 26137169 | Luciferase; Western blot |
| hsa-miR-134-5p | ovarian cancer | drug resistance; progression; poor survival | "Down regulated expression of miR 134 contributes t ......" | 26363097 | |
| hsa-miR-134-5p | ovarian cancer | drug resistance | "Evidence for miR 17 92 and miR 134 gene cluster re ......" | 27383301 | |
| hsa-miR-134-5p | ovarian cancer | poor survival | "The Fra 1 miR 134 SDS22 feedback loop amplifies ER ......" | 27685628 | |
| hsa-miR-134-5p | sarcoma | tumorigenesis; staging; metastasis; tumor size; poor survival | "Decreased miR 134 expression and its tumor suppres ......" | 26681023 | Flow cytometry; Cell migration assay |
Reported gene related to hsa-miR-134-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-134-5p | glioblastoma | KRAS | "Multiple receptor tyrosine kinases converge on mic ......" | 24440911 |
| hsa-miR-134-5p | kidney renal cell cancer | KRAS | "miR 134 functions as a tumor suppressor in cell pr ......" | 25811077 |
| hsa-miR-134-5p | liver cancer | KRAS | "As a representative miRNA in this cluster miR-134 ......" | 23775631 |
| hsa-miR-134-5p | breast cancer | BCL2 | "C/EBPα overexpression promoted miR-134 expression ......" | 26823765 |
| hsa-miR-134-5p | lung squamous cell cancer | BCL2 | "In addition miR-134 induced apoptosis as indicated ......" | 27166267 |
| hsa-miR-134-5p | glioblastoma | EGFR | "We show that the RTKs MET EGFR and PDGFR regulate ......" | 24440911 |
| hsa-miR-134-5p | lung squamous cell cancer | EGFR | "Luciferase assays confirmed that EGFR is a direct ......" | 27241841 |
| hsa-miR-134-5p | lung cancer | SCLC1 | "Our study investigated the pathogenic implications ......" | 26166818 |
| hsa-miR-134-5p | lung squamous cell cancer | SCLC1 | "Our results support for the first time a substanti ......" | 20371173 |
| hsa-miR-134-5p | head and neck cancer | WWOX | "miR 134 induces oncogenicity and metastasis in hea ......" | 23824713 |
| hsa-miR-134-5p | lung cancer | WWOX | "MicroRNA 134 regulates lung cancer cell H69 growth ......" | 26166818 |
| hsa-miR-134-5p | breast cancer | ABCC1 | "MicroRNA 134 modulates resistance to doxorubicin i ......" | 26318721 |
| hsa-miR-134-5p | breast cancer | ABCC3 | "MicroRNA-134 modulates resistance to doxorubicin i ......" | 26318721 |
| hsa-miR-134-5p | lung squamous cell cancer | CASP3 | "In addition miR-134 induced apoptosis as indicated ......" | 27166267 |
| hsa-miR-134-5p | lung squamous cell cancer | CCND1 | "Hsa miR 134 suppresses non small cell lung cancer ......" | 27166267 |
| hsa-miR-134-5p | breast cancer | CREB1 | "C/EBPα overexpression promoted miR-134 expression ......" | 26823765 |
| hsa-miR-134-5p | lung squamous cell cancer | EGF | "miR 134 inhibits non small cell lung cancer growth ......" | 27241841 |
| hsa-miR-134-5p | ovarian cancer | FOSL1 | "The Fra 1 miR 134 SDS22 feedback loop amplifies ER ......" | 27685628 |
| hsa-miR-134-5p | lung squamous cell cancer | FOXM1 | "miR 134 inhibits epithelial to mesenchymal transit ......" | 23010597 |
| hsa-miR-134-5p | ovarian cancer | H2AFX | "In addition miR-134 augmented H2AX S139 phosphoryl ......" | 27685628 |
| hsa-miR-134-5p | liver cancer | ITGA9 | "Genome wide screening identified that miR 134 acts ......" | 24498348 |
| hsa-miR-134-5p | glioblastoma | KLF4 | "We also uncover the molecular pathways through whi ......" | 24440911 |
| hsa-miR-134-5p | ovarian cancer | MAPK8 | "In addition miR-134 augmented H2AX S139 phosphoryl ......" | 27685628 |
| hsa-miR-134-5p | lung squamous cell cancer | MMP7 | "Moreover miR-134 inhibited cellular migration and ......" | 27166267 |
| hsa-miR-134-5p | lung squamous cell cancer | MMP9 | "Moreover miR-134 inhibited cellular migration and ......" | 27166267 |
| hsa-miR-134-5p | glioblastoma | NANOG | "MiR 134 regulates the proliferation and invasion o ......" | 23467648 |
| hsa-miR-134-5p | ovarian cancer | PAK2 | "Further Pak2 was identified as a direct target of ......" | 26363097 |
| hsa-miR-134-5p | glioblastoma | PDGFRB | "We show that the RTKs MET EGFR and PDGFR regulate ......" | 24440911 |
| hsa-miR-134-5p | endometrial cancer | POGLUT1 | "MicroRNA 134 suppresses endometrial cancer stem ce ......" | 25528443 |
| hsa-miR-134-5p | ovarian cancer | PPP1R7 | "The Fra 1 miR 134 SDS22 feedback loop amplifies ER ......" | 27685628 |
| hsa-miR-134-5p | ovarian cancer | PRPF6 | "By conducting a luciferase reporter assay miR-134 ......" | 26137169 |
| hsa-miR-134-5p | glioblastoma | STAT5B | "Multiple receptor tyrosine kinases converge on mic ......" | 24440911 |
| hsa-miR-134-5p | ovarian cancer | VIM | "By conducting a luciferase reporter assay miR-134 ......" | 26137169 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-134-5p | GOLGA6L10 | 9 cancers: BLCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD | MirTarget | TCGA BLCA -0.25; TCGA HNSC -0.126; TCGA KIRC -0.209; TCGA KIRP -0.241; TCGA LGG -0.117; TCGA LUAD -0.169; TCGA LUSC -0.167; TCGA PAAD -0.164; TCGA PRAD -0.185 |
hsa-miR-134-5p | PAN3 | 10 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.091; TCGA COAD -0.147; TCGA ESCA -0.109; TCGA KIRC -0.062; TCGA KIRP -0.073; TCGA LGG -0.053; TCGA LUAD -0.058; TCGA LUSC -0.066; TCGA PRAD -0.07; TCGA STAD -0.143 |
hsa-miR-134-5p | ZMAT5 | 10 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; OV; PAAD; PRAD; THCA | MirTarget | TCGA BLCA -0.064; TCGA BRCA -0.163; TCGA HNSC -0.086; TCGA KIRP -0.07; TCGA LGG -0.082; TCGA LIHC -0.068; TCGA OV -0.092; TCGA PAAD -0.084; TCGA PRAD -0.098; TCGA THCA -0.058 |
hsa-miR-134-5p | CDNF | 11 cancers: BRCA; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.059; TCGA ESCA -0.361; TCGA KIRP -0.05; TCGA LGG -0.092; TCGA LIHC -0.067; TCGA LUAD -0.117; TCGA LUSC -0.125; TCGA OV -0.145; TCGA SARC -0.056; TCGA THCA -0.072; TCGA STAD -0.156 |
Enriched cancer pathways of putative targets