microRNA information: hsa-miR-144-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-144-3p | miRbase |
Accession: | MIMAT0000436 | miRbase |
Precursor name: | hsa-mir-144 | miRbase |
Precursor accession: | MI0000460 | miRbase |
Symbol: | MIR144 | HGNC |
RefSeq ID: | NR_029685 | GenBank |
Sequence: | UACAGUAUAGAUGAUGUACU |
Reported expression in cancers: hsa-miR-144-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-144-3p | bladder cancer | downregulation | "Tumour suppressive microRNA 144 5p directly target ......" | 26057453 | RNA-Seq |
hsa-miR-144-3p | breast cancer | deregulation | "Next-generation sequencing evaluated miR expressio ......" | 26124344 | RNA-Seq; Reverse transcription PCR |
hsa-miR-144-3p | colorectal cancer | downregulation | "Quantitative RT-PCR was used to evaluate the clini ......" | 22983984 | qPCR |
hsa-miR-144-3p | esophageal cancer | upregulation | "By Agilent microarray six deregulated miRNAs from ......" | 23560033 | Microarray; qPCR |
hsa-miR-144-3p | esophageal cancer | upregulation | "Potential diagnostic implications of miR 144 overe ......" | 27748283 | qPCR |
hsa-miR-144-3p | gastric cancer | downregulation | "MicroRNA 144 inhibits the metastasis of gastric ca ......" | 25927670 | |
hsa-miR-144-3p | glioblastoma | upregulation | "We demonstrated that the miR-144-3p level was sign ......" | 26250785 | |
hsa-miR-144-3p | kidney renal cell cancer | downregulation | "Here miRNA microarray analysis was performed to sc ......" | 27717821 | Microarray |
hsa-miR-144-3p | liver cancer | deregulation | "The aim of this study was to investigate the role ......" | 27536132 | |
hsa-miR-144-3p | lung cancer | downregulation | "Among them miR-144 was one of the most significant ......" | 26395400 | |
hsa-miR-144-3p | melanoma | downregulation | "However the role of miR-144 in uveal melanoma meta ......" | 25961751 | |
hsa-miR-144-3p | prostate cancer | upregulation | "In PC patients after cisplatin treatment low miR-1 ......" | 26566625 | |
hsa-miR-144-3p | sarcoma | downregulation | "In the present study miR-144 was markedly downregu ......" | 25912304 | |
hsa-miR-144-3p | thyroid cancer | downregulation | "Most miRNAs were down-regulated and especially miR ......" | 22049245 | qPCR; Microarray |
hsa-miR-144-3p | thyroid cancer | downregulation | "In the present study we found that the expression ......" | 24968735 |
Reported cancer pathway affected by hsa-miR-144-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-144-3p | bladder cancer | Wnt signaling pathway | "miR 144 downregulation increases bladder cancer ce ......" | 23815091 | |
hsa-miR-144-3p | colorectal cancer | mTOR signaling pathway | "Downregulation of miR 144 is associated with color ......" | 22983984 | |
hsa-miR-144-3p | glioblastoma | Apoptosis pathway | "miR 144 3p exerts anti tumor effects in glioblasto ......" | 26250785 | |
hsa-miR-144-3p | kidney renal cell cancer | Epithelial mesenchymal transition pathway | "miR 144 3p serves as a tumor suppressor for renal ......" | 27717821 | |
hsa-miR-144-3p | liver cancer | Apoptosis pathway | "HepG2 cells transfected with versican 3'-UTR displ ......" | 23180826 | Colony formation |
hsa-miR-144-3p | liver cancer | Apoptosis pathway | "miR 144 suppresses the proliferation and metastasi ......" | 25073510 | |
hsa-miR-144-3p | liver cancer | cell cycle pathway; Epithelial mesenchymal transition pathway | "MiR 144 suppresses cell proliferation migration an ......" | 27536132 | |
hsa-miR-144-3p | lung cancer | Apoptosis pathway | "MiR 144 inhibits proliferation and induces apoptos ......" | 25660220 | Western blot; Flow cytometry; Luciferase; Colony formation |
hsa-miR-144-3p | lung cancer | Epithelial mesenchymal transition pathway | "Down regulation of microRNA 144 in air pollution r ......" | 26395400 | |
hsa-miR-144-3p | lung squamous cell cancer | Apoptosis pathway | "Roles of Mir 144 ZFX pathway in growth regulation ......" | 24066116 | |
hsa-miR-144-3p | sarcoma | Apoptosis pathway | "MicroRNA 144 inhibits the proliferation apoptosis ......" | 25854173 | Western blot; MTT assay; Transwell assay; Flow cytometry |
Reported cancer prognosis affected by hsa-miR-144-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-144-3p | breast cancer | drug resistance; progression; tumorigenesis | "MicroRNA 144 affects radiotherapy sensitivity by p ......" | 26252024 | Western blot |
hsa-miR-144-3p | colorectal cancer | progression; metastasis; malignant trasformation; worse prognosis; recurrence; poor survival | "Downregulation of miR 144 is associated with color ......" | 22983984 | |
hsa-miR-144-3p | colorectal cancer | staging; drug resistance | "To explore the potential molecular biomarkers pred ......" | 24460313 | |
hsa-miR-144-3p | esophageal cancer | malignant trasformation | "Potential diagnostic implications of miR 144 overe ......" | 27748283 | |
hsa-miR-144-3p | gastric cancer | staging; worse prognosis | "Clinical significance of miR 144 ZFX axis in disse ......" | 22955854 | Western blot; Luciferase |
hsa-miR-144-3p | gastric cancer | metastasis; cell migration; progression | "MicroRNA 144 inhibits the metastasis of gastric ca ......" | 25927670 | |
hsa-miR-144-3p | gastric cancer | malignant trasformation | "Forty cases of carcinoma tissue and para-carcinoma ......" | 27261864 | Western blot |
hsa-miR-144-3p | glioblastoma | poor survival | "miR 144 3p exerts anti tumor effects in glioblasto ......" | 26250785 | |
hsa-miR-144-3p | kidney renal cell cancer | metastasis; progression; poor survival | "miR 144 3p serves as a tumor suppressor for renal ......" | 27717821 | |
hsa-miR-144-3p | liver cancer | poor survival | "HepG2 cells transfected with versican 3'-UTR displ ......" | 23180826 | Colony formation |
hsa-miR-144-3p | liver cancer | metastasis; progression; motility | "miR 144 suppresses the proliferation and metastasi ......" | 25073510 | |
hsa-miR-144-3p | liver cancer | metastasis; drug resistance | "MiR 144 suppresses cell proliferation migration an ......" | 27536132 | |
hsa-miR-144-3p | lung squamous cell cancer | malignant trasformation | "Roles of Mir 144 ZFX pathway in growth regulation ......" | 24066116 | |
hsa-miR-144-3p | lung squamous cell cancer | metastasis | "The differentially expressed microRNAs associated ......" | 25628919 | |
hsa-miR-144-3p | lung squamous cell cancer | metastasis | "Regulation of activating protein 4 associated meta ......" | 26254097 | Luciferase |
hsa-miR-144-3p | melanoma | metastasis | "MiR 144 Inhibits Uveal Melanoma Cell Proliferation ......" | 25961751 | Luciferase |
hsa-miR-144-3p | prostate cancer | poor survival | "VEGF activated miR 144 regulates autophagic surviv ......" | 26566625 | Luciferase |
hsa-miR-144-3p | sarcoma | differentiation | "In order to investigate the involvement of miRNAs ......" | 23133552 | |
hsa-miR-144-3p | sarcoma | metastasis; malignant trasformation | "The downregulation of miR 144 is associated with t ......" | 25318625 | |
hsa-miR-144-3p | sarcoma | metastasis; staging; tumor size | "MicroRNA 144 inhibits the proliferation apoptosis ......" | 25854173 | Western blot; MTT assay; Transwell assay; Flow cytometry |
hsa-miR-144-3p | sarcoma | metastasis; worse prognosis; progression | "MicroRNA 144 suppresses osteosarcoma growth and me ......" | 25912304 | |
hsa-miR-144-3p | thyroid cancer | tumorigenesis | "Down regulation of miR 144 promotes thyroid cancer ......" | 24968735 |
Reported gene related to hsa-miR-144-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-144-3p | gastric cancer | MET | "The results of qRT-PCR and western-blot proved tha ......" | 27261864 |
hsa-miR-144-3p | gastric cancer | MET | "The met proto-oncogene MET which is often amplifie ......" | 25927670 |
hsa-miR-144-3p | glioblastoma | MET | "miR 144 3p exerts anti tumor effects in glioblasto ......" | 26250785 |
hsa-miR-144-3p | melanoma | MET | "MiR 144 Inhibits Uveal Melanoma Cell Proliferation ......" | 25961751 |
hsa-miR-144-3p | breast cancer | PTEN | "miR-144 activated AKT by downregulation of PTEN in ......" | 26252024 |
hsa-miR-144-3p | glioblastoma | PTEN | "In addition our results showed no difference in ma ......" | 26250785 |
hsa-miR-144-3p | lung cancer | SLC2A1 | "Downregulating microRNA 144 mediates a metabolic s ......" | 27313692 |
hsa-miR-144-3p | ovarian cancer | SLC2A1 | "MicroRNA 144 mediates metabolic shift in ovarian c ......" | 26662316 |
hsa-miR-144-3p | lung cancer | ZEB1 | "MiR-144 interacted with the oncogene Zeb1 at 2 sit ......" | 26395400 |
hsa-miR-144-3p | thyroid cancer | ZEB1 | "Down regulation of miR 144 promotes thyroid cancer ......" | 24968735 |
hsa-miR-144-3p | gastric cancer | ZFX | "Clinical significance of miR 144 ZFX axis in disse ......" | 22955854 |
hsa-miR-144-3p | lung squamous cell cancer | ZFX | "Roles of Mir 144 ZFX pathway in growth regulation ......" | 24066116 |
hsa-miR-144-3p | lung cancer | AIR | "Down regulation of microRNA 144 in air pollution r ......" | 26395400 |
hsa-miR-144-3p | B cell lymphoma | BCL6 | "In the current study we screened the microRNA expr ......" | 26865454 |
hsa-miR-144-3p | prostate cancer | BECN1 | "Bioinformatics analysis showed that miR-144 target ......" | 26566625 |
hsa-miR-144-3p | lung cancer | C12ORF5 | "MiR 144 inhibits proliferation and induces apoptos ......" | 25660220 |
hsa-miR-144-3p | breast cancer | CDH1 | "In addition the overexpression of miR-144 inhibite ......" | 26252024 |
hsa-miR-144-3p | sarcoma | COIL | "MicroRNA 144 acts as a tumor suppressor by targeti ......" | 26081423 |
hsa-miR-144-3p | liver cancer | E2F3 | "miR 144 suppresses the proliferation and metastasi ......" | 25073510 |
hsa-miR-144-3p | bladder cancer | EZH2 | "miR 144 downregulation increases bladder cancer ce ......" | 23815091 |
hsa-miR-144-3p | sarcoma | EZR | "MiR-144 levels and Ezrin messenger RNA mRNA levels ......" | 25854173 |
hsa-miR-144-3p | glioblastoma | GLI1 | "Thirteen miRNAs including miR-125b-1 were downregu ......" | 24688313 |
hsa-miR-144-3p | thyroid cancer | KRT1 | "Moreover our results showed that restoration of mi ......" | 24968735 |
hsa-miR-144-3p | kidney renal cell cancer | MAP3K8 | "miR 144 3p serves as a tumor suppressor for renal ......" | 27717821 |
hsa-miR-144-3p | colorectal cancer | MTOR | "Downregulation of miR 144 is associated with color ......" | 22983984 |
hsa-miR-144-3p | colorectal cancer | NOTCH1 | "Nanoparticle based delivery of siDCAMKL 1 increase ......" | 21929751 |
hsa-miR-144-3p | gastric cancer | NOVA2 | "Quantitative reverse-transcriptase RT-PCR analysis ......" | 22955854 |
hsa-miR-144-3p | esophageal cancer | PURA | "Bioinformatically predicted target PUR-aplha PURA ......" | 27748283 |
hsa-miR-144-3p | lung squamous cell cancer | REPIN1 | "Here we showed that in the specimens from the NSCL ......" | 26254097 |
hsa-miR-144-3p | colorectal cancer | RICTOR | "Among many genes consisting of the mTOR pathway on ......" | 22983984 |
hsa-miR-144-3p | sarcoma | ROCK1 | "Furthermore we identified Rho-associated kinases 1 ......" | 25912304 |
hsa-miR-144-3p | sarcoma | ROCK2 | "Furthermore we identified Rho-associated kinases 1 ......" | 25912304 |
hsa-miR-144-3p | liver cancer | SMAD4 | "MiR 144 suppresses cell proliferation migration an ......" | 27536132 |
hsa-miR-144-3p | breast cancer | SNAI1 | "In addition the overexpression of miR-144 inhibite ......" | 26252024 |
hsa-miR-144-3p | sarcoma | TAGLN | "The downregulation of miR 144 is associated with t ......" | 25318625 |
hsa-miR-144-3p | liver cancer | TCF3 | "E2F transcription factor 3 E2F3 was identified as ......" | 25073510 |
hsa-miR-144-3p | prostate cancer | VEGFA | "VEGF activated miR 144 regulates autophagic surviv ......" | 26566625 |
hsa-miR-144-3p | thyroid cancer | ZEB2 | "Down regulation of miR 144 promotes thyroid cancer ......" | 24968735 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-144-3p | MXRA5 | 9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; THCA | MirTarget; miRNATAP | TCGA BLCA -0.201; TCGA COAD -0.275; TCGA ESCA -0.257; TCGA KIRC -0.215; TCGA KIRP -0.121; TCGA LUAD -0.128; TCGA LUSC -0.197; TCGA PAAD -0.185; TCGA THCA -0.061 |
hsa-miR-144-3p | PRRX1 | 10 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.287; TCGA COAD -0.279; TCGA ESCA -0.228; TCGA HNSC -0.104; TCGA LGG -0.062; TCGA LIHC -0.247; TCGA LUAD -0.058; TCGA LUSC -0.103; TCGA STAD -0.286; TCGA UCEC -0.186 |
hsa-miR-144-3p | HTRA3 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.336; TCGA CESC -0.089; TCGA COAD -0.279; TCGA ESCA -0.244; TCGA HNSC -0.23; TCGA LIHC -0.183; TCGA LUAD -0.148; TCGA LUSC -0.134; TCGA PAAD -0.149; TCGA STAD -0.191; TCGA UCEC -0.214 |
hsa-miR-144-3p | ETV1 | 9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.196; TCGA COAD -0.143; TCGA ESCA -0.157; TCGA KIRC -0.11; TCGA KIRP -0.096; TCGA LGG -0.095; TCGA THCA -0.168; TCGA STAD -0.188; TCGA UCEC -0.086 |
hsa-miR-144-3p | FBXO32 | 10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.192; TCGA COAD -0.157; TCGA ESCA -0.163; TCGA HNSC -0.054; TCGA LIHC -0.124; TCGA LUAD -0.115; TCGA LUSC -0.202; TCGA THCA -0.149; TCGA STAD -0.312; TCGA UCEC -0.113 |
hsa-miR-144-3p | VCAN | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; STAD; UCEC | miRNATAP | TCGA BLCA -0.271; TCGA COAD -0.283; TCGA ESCA -0.21; TCGA HNSC -0.116; TCGA KIRP -0.187; TCGA LGG -0.086; TCGA LIHC -0.172; TCGA LUAD -0.113; TCGA LUSC -0.131; TCGA STAD -0.216; TCGA UCEC -0.116 |
hsa-miR-144-3p | COL10A1 | 10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.549; TCGA COAD -0.581; TCGA ESCA -0.505; TCGA HNSC -0.395; TCGA LIHC -0.24; TCGA LUAD -0.342; TCGA LUSC -0.407; TCGA PAAD -0.253; TCGA STAD -0.665; TCGA UCEC -0.201 |
Enriched cancer pathways of putative targets