microRNA information: hsa-miR-145-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-145-3p | miRbase |
| Accession: | MIMAT0004601 | miRbase |
| Precursor name: | hsa-mir-145 | miRbase |
| Precursor accession: | MI0000461 | miRbase |
| Symbol: | MIR145 | HGNC |
| RefSeq ID: | NR_029686 | GenBank |
| Sequence: | GGAUUCCUGGAAAUACUGUUCU |
Reported expression in cancers: hsa-miR-145-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-145-3p | bladder cancer | downregulation | "We identified a subset of 7 miRNAs miR-145 miR-30a ......" | 19378336 | qPCR |
| hsa-miR-145-3p | bladder cancer | downregulation | "We have recently identified down-regulated microRN ......" | 20160723 | |
| hsa-miR-145-3p | bladder cancer | downregulation | "miR-145 was the most down-regulated microRNA of th ......" | 22704449 | |
| hsa-miR-145-3p | bladder cancer | downregulation | "miRNAs downregulated in bladder cancer such as miR ......" | 23712207 | |
| hsa-miR-145-3p | bladder cancer | downregulation | "In many cancers miR-145 acts as a tumor suppressor ......" | 24954107 | qPCR |
| hsa-miR-145-3p | bladder cancer | downregulation | "Analysis of our miRNA expression signature of blad ......" | 27072587 | RNA-Seq |
| hsa-miR-145-3p | breast cancer | downregulation | "In breast cancer miR-145 expression is downregulat ......" | 20818426 | |
| hsa-miR-145-3p | breast cancer | downregulation | "Silencing of microRNA-145 miR-145 may be a definin ......" | 25253741 | RNA-Seq |
| hsa-miR-145-3p | breast cancer | downregulation | "In prostate and breast cancer miR-145 a well-known ......" | 25331590 | |
| hsa-miR-145-3p | breast cancer | downregulation | "MicroRNA-145 miR-145 inhibits growth and increases ......" | 26715279 | qPCR |
| hsa-miR-145-3p | breast cancer | downregulation | "Among such dysregulated miRNAs in cancer miR-145 i ......" | 26733177 | Reverse transcription PCR |
| hsa-miR-145-3p | breast cancer | downregulation | "Although increasing evidence has documented that m ......" | 27364572 | qPCR |
| hsa-miR-145-3p | breast cancer | downregulation | "Loss of microRNA 145 expression is involved in the ......" | 27396353 | qPCR |
| hsa-miR-145-3p | cervical and endocervical cancer | downregulation | "Downregulation of microRNA 145 is associated with ......" | 25560490 | qPCR |
| hsa-miR-145-3p | cervical and endocervical cancer | downregulation | "Down-regulation was reported most consistently for ......" | 25920605 | |
| hsa-miR-145-3p | cervical and endocervical cancer | downregulation | "Molecular identification of miR 145 and miR 9 expr ......" | 27345415 | qPCR |
| hsa-miR-145-3p | colon cancer | downregulation | "miR-145 is reported to be down-regulated in severa ......" | 20098684 | Microarray |
| hsa-miR-145-3p | colon cancer | downregulation | "Putative tumor suppressor miR 145 inhibits colon c ......" | 20737575 | |
| hsa-miR-145-3p | colon cancer | downregulation | "miR-143 and miR-145 are downregulated in colon can ......" | 26824186 | |
| hsa-miR-145-3p | colon cancer | downregulation | "MiR-145 is a tumor-suppressive microRNA that parti ......" | 27626692 | |
| hsa-miR-145-3p | colorectal cancer | downregulation | "Applying real-time RT-PCR we investigated the miR- ......" | 19242066 | qPCR |
| hsa-miR-145-3p | colorectal cancer | downregulation | "Recent studies have reported miR-145 dysregulated ......" | 24642628 | qPCR |
| hsa-miR-145-3p | colorectal cancer | downregulation | "To assess the serum expression of 3 microRNA marke ......" | 25736690 | |
| hsa-miR-145-3p | colorectal cancer | downregulation | "Expression of 16 miRNAs miRNA-9 21 30d 31 106a 127 ......" | 25773836 | qPCR |
| hsa-miR-145-3p | endometrial cancer | downregulation | "Down regulation of miR 145 and miR 143 might be as ......" | 24071015 | Microarray; qPCR |
| hsa-miR-145-3p | esophageal cancer | downregulation | "A comparison of miRNA signatures from ESCC and our ......" | 21351259 | |
| hsa-miR-145-3p | esophageal cancer | downregulation | "Evaluating the miR 302b and miR 145 expression in ......" | 25773691 | |
| hsa-miR-145-3p | gastric cancer | downregulation | "The molecular mechanism of microRNA 145 to suppres ......" | 22370644 | |
| hsa-miR-145-3p | gastric cancer | downregulation | "Here we found that miR-145 miR-133a and miR-133b w ......" | 24613927 | |
| hsa-miR-145-3p | gastric cancer | downregulation | "Expression of miR 143 and miR 145 and their functi ......" | 25656032 | |
| hsa-miR-145-3p | gastric cancer | downregulation | "Previous studies have found that miR-145 is down-r ......" | 26010149 | |
| hsa-miR-145-3p | glioblastoma | upregulation | "Specifically miR-181b miR-153 miR-145 miR-137 and ......" | 22722712 | |
| hsa-miR-145-3p | glioblastoma | downregulation | "Here we found that miR-145 is strongly down-regula ......" | 22869051 | Microarray |
| hsa-miR-145-3p | kidney renal cell cancer | downregulation | "The expression levels of miR-143 and miR-145 were ......" | 24033605 | |
| hsa-miR-145-3p | kidney renal cell cancer | downregulation | "The expression of miR-145 in 45 RCC and adjacent n ......" | 24384875 | qPCR |
| hsa-miR-145-3p | liver cancer | downregulation | "Because understanding the pathogenesis of viral-as ......" | 18307259 | qPCR |
| hsa-miR-145-3p | liver cancer | downregulation | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | qPCR |
| hsa-miR-145-3p | liver cancer | downregulation | "MiR 145 modulates multiple components of the insul ......" | 22431718 | Reverse transcription PCR |
| hsa-miR-145-3p | liver cancer | downregulation | "It has been demonstrated that microRNA-145 miR-145 ......" | 24630966 | |
| hsa-miR-145-3p | liver cancer | downregulation | "In this study we performed real-time PCR in tumor ......" | 26512974 | qPCR |
| hsa-miR-145-3p | liver cancer | downregulation | "In the present study we investigated the role of m ......" | 26615424 | qPCR |
| hsa-miR-145-3p | lung cancer | downregulation | "MiR-145 is downregulated in several human malignan ......" | 21289483 | |
| hsa-miR-145-3p | lung cancer | downregulation | "MiR-145 functions as a protective miRNA identified ......" | 21496429 | Microarray; qPCR |
| hsa-miR-145-3p | lung cancer | downregulation | "MicroRNA-145 MiR-145 is an important regulator of ......" | 24903381 | |
| hsa-miR-145-3p | lung cancer | downregulation | "MiR-145 has been reported to be downregulated in m ......" | 25428378 | |
| hsa-miR-145-3p | lung cancer | downregulation | "Evidence in other cell systems has implicated the ......" | 26309531 | |
| hsa-miR-145-3p | lung squamous cell cancer | downregulation | "However the biological function of miR-145 in non- ......" | 21092188 | Reverse transcription PCR |
| hsa-miR-145-3p | lung squamous cell cancer | downregulation | "Low miR 145 expression level is associated with po ......" | 25661374 | qPCR; in situ hybridization |
| hsa-miR-145-3p | lymphoma | downregulation | "Histone deacetylase inhibitor prevents cell growth ......" | 24577510 | Microarray |
| hsa-miR-145-3p | lymphoma | downregulation | "Prognostic impact of microRNA 145 down regulation ......" | 24745613 | |
| hsa-miR-145-3p | melanoma | downregulation | "Comparative study of anti oncogenic microRNA 145 i ......" | 21836381 | |
| hsa-miR-145-3p | ovarian cancer | downregulation | "The aim of this study was to find specific profile ......" | 23542579 | Microarray; qPCR |
| hsa-miR-145-3p | ovarian cancer | downregulation | "MiR-145 is reported to be significantly down-regul ......" | 23919393 | |
| hsa-miR-145-3p | ovarian cancer | downregulation | "Previous studies have shown that miR-145 is downre ......" | 24157791 | Northern blot; qPCR |
| hsa-miR-145-3p | ovarian cancer | downregulation | "miR 145 targeting high mobility group A2 is a powe ......" | 25444913 | |
| hsa-miR-145-3p | ovarian cancer | downregulation | "Serum microRNA 145 as a novel biomarker in human o ......" | 25722112 | |
| hsa-miR-145-3p | ovarian cancer | downregulation | "The present study aims to investigate the dysregul ......" | 26472353 | |
| hsa-miR-145-3p | pancreatic cancer | downregulation | "Eighty-eight samples of ductal pancreatic adenocar ......" | 22850622 | qPCR |
| hsa-miR-145-3p | prostate cancer | downregulation | "The functional significance of microRNA 145 in pro ......" | 20588276 | Microarray |
| hsa-miR-145-3p | prostate cancer | downregulation | "The down-regulation of miR-145 has been reported i ......" | 21258769 | |
| hsa-miR-145-3p | prostate cancer | downregulation | "MiR-145 is downregulated in various cancers includ ......" | 21349819 | |
| hsa-miR-145-3p | prostate cancer | downregulation | "MiR-145 is down-regulated in various human cancers ......" | 21360565 | |
| hsa-miR-145-3p | prostate cancer | downregulation | "The loss of the tumour suppressor miR 145 results ......" | 23703249 | |
| hsa-miR-145-3p | sarcoma | deregulation | "MicroRNA expression was profiled in samples of nor ......" | 21693658 | Microarray; RNA-Seq |
| hsa-miR-145-3p | thyroid cancer | downregulation | "The expression and function of miR-145 in thyroid ......" | 24781864 |
Reported cancer pathway affected by hsa-miR-145-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-145-3p | acute myeloid leukemia | Apoptosis pathway | "We integrated miRNA and mRNA expression profiles o ......" | 21455993 | |
| hsa-miR-145-3p | bladder cancer | Apoptosis pathway | "socs7 a target gene of microRNA 145 regulates inte ......" | 23392170 | Luciferase |
| hsa-miR-145-3p | bladder cancer | Apoptosis pathway | "MicroRNA 145 directly targets the insulin like gro ......" | 24999188 | |
| hsa-miR-145-3p | bladder cancer | Apoptosis pathway | "Intravesical administration of exogenous microRNA ......" | 26036261 | Western blot; Wound Healing Assay |
| hsa-miR-145-3p | bladder cancer | Apoptosis pathway | "Identification of a hypoxia regulated miRNA signat ......" | 26196183 | Flow cytometry |
| hsa-miR-145-3p | bladder cancer | Apoptosis pathway | "Regulation of UHRF1 by dual strand tumor suppresso ......" | 27072587 | |
| hsa-miR-145-3p | breast cancer | Apoptosis pathway | "miR 145 inhibits breast cancer cell growth through ......" | 19360360 | |
| hsa-miR-145-3p | breast cancer | Apoptosis pathway | "miR 145 participates with TP53 in a death promotin ......" | 19730444 | |
| hsa-miR-145-3p | breast cancer | Wnt signaling pathway | "Development of microRNA 145 for therapeutic applic ......" | 21723890 | |
| hsa-miR-145-3p | breast cancer | Apoptosis pathway | "MiR 145 regulates epithelial to mesenchymal transi ......" | 23049906 | |
| hsa-miR-145-3p | breast cancer | Apoptosis pathway | "lincRNA RoR and miR 145 regulate invasion in tripl ......" | 25253741 | |
| hsa-miR-145-3p | breast cancer | Apoptosis pathway | "MiR 145 promotes TNF α induced apoptosis by facil ......" | 26733177 | |
| hsa-miR-145-3p | breast cancer | Epithelial mesenchymal transition pathway | "miR 145 suppresses breast cancer cell migration by ......" | 27508031 | Cell migration assay; Wound Healing Assay |
| hsa-miR-145-3p | cervical and endocervical cancer | Apoptosis pathway | "Glucocorticoid regulation of a novel HPV E6 p53 mi ......" | 22287315 | |
| hsa-miR-145-3p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway | "Long non coding RNA MALAT1 modulates radiosensitiv ......" | 26311052 | Flow cytometry; Colony formation; RNA pull-down |
| hsa-miR-145-3p | colon cancer | Apoptosis pathway | "Putative tumor suppressor miR 145 inhibits colon c ......" | 20737575 | Luciferase |
| hsa-miR-145-3p | colon cancer | Apoptosis pathway | "MicroRNA replacement therapy for miR 145 and miR 3 ......" | 21690566 | |
| hsa-miR-145-3p | colon cancer | Apoptosis pathway | "Downregulation of microRNA 1 and microRNA 145 cont ......" | 26459459 | MTT assay |
| hsa-miR-145-3p | colon cancer | cell cycle pathway; Apoptosis pathway | "The miR-145 is dysregulated in many cancers includ ......" | 27482839 | |
| hsa-miR-145-3p | colon cancer | Apoptosis pathway | "Epigenetically regulated miR 145 suppresses colon ......" | 27626692 | |
| hsa-miR-145-3p | colorectal cancer | cell cycle pathway | "Characterization of global microRNA expression rev ......" | 19843336 | |
| hsa-miR-145-3p | colorectal cancer | p53 signaling pathway | "Analysis of the combined action of miR 143 and miR ......" | 23128394 | |
| hsa-miR-145-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "The analysis of microRNAs miR 200C and miR 145 exp ......" | 26335822 | |
| hsa-miR-145-3p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA miR-143 and miR-145 have been identified ......" | 27444415 | Luciferase |
| hsa-miR-145-3p | esophageal cancer | Apoptosis pathway | "Evaluating the miR 302b and miR 145 expression in ......" | 25773691 | |
| hsa-miR-145-3p | esophageal cancer | cell cycle pathway; Apoptosis pathway | "The effect of recombinant lentiviral vector encodi ......" | 26156802 | Flow cytometry |
| hsa-miR-145-3p | gastric cancer | cell cycle pathway | "MiR 145 miR 133a and miR 133b inhibit proliferatio ......" | 24613927 | |
| hsa-miR-145-3p | gastric cancer | Epithelial mesenchymal transition pathway | "MicroRNA 145 5p inhibits gastric cancer invasivene ......" | 27143926 | |
| hsa-miR-145-3p | glioblastoma | PI3K/Akt signaling pathway | "MicroRNA screening predicted that microRNA-145 miR ......" | 26374689 | |
| hsa-miR-145-3p | kidney renal cell cancer | Apoptosis pathway | "miR 145 functions as tumor suppressor and targets ......" | 24384875 | Luciferase |
| hsa-miR-145-3p | kidney renal cell cancer | Apoptosis pathway | "Herein we sought to investigate the impact of gemc ......" | 25833690 | Western blot; MTT assay |
| hsa-miR-145-3p | liver cancer | cell cycle pathway; Apoptosis pathway | "MiR 145 modulates multiple components of the insul ......" | 22431718 | Luciferase |
| hsa-miR-145-3p | liver cancer | PI3K/Akt signaling pathway | "MicroRNA 145 suppresses hepatocellular carcinoma b ......" | 24690171 | Western blot; Luciferase |
| hsa-miR-145-3p | liver cancer | Epithelial mesenchymal transition pathway | "miR 145 regulates chemoresistance in hepatocellula ......" | 26068913 | Luciferase |
| hsa-miR-145-3p | liver cancer | Apoptosis pathway | "MicroRNA 145 and MicroRNA 133a Inhibited Prolifera ......" | 26173501 | Western blot; Luciferase |
| hsa-miR-145-3p | liver cancer | Apoptosis pathway | "Here we demonstrate that in HCC cells carrying wil ......" | 27120784 | |
| hsa-miR-145-3p | lung cancer | Apoptosis pathway | "MiR 145 inhibits cell proliferation of human lung ......" | 21289483 | |
| hsa-miR-145-3p | lung cancer | Epithelial mesenchymal transition pathway | "MiR 145 regulates cancer stem like properties and ......" | 24903381 | |
| hsa-miR-145-3p | lung squamous cell cancer | cell cycle pathway | "Increasing evidence indicates that miR-145 is a tu ......" | 21092188 | |
| hsa-miR-145-3p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "MiR 145 and miR 203 represses TGF β induced epith ......" | 27237033 | Western blot; RNAi; Luciferase |
| hsa-miR-145-3p | melanoma | cell cycle pathway; Apoptosis pathway | "MicroRNA 145 may play an important role in uveal m ......" | 24762580 | Flow cytometry; MTT assay; Luciferase; Western blot |
| hsa-miR-145-3p | ovarian cancer | Apoptosis pathway; cell cycle pathway | "MicroRNA 145 function as a cell growth repressor b ......" | 23919393 | |
| hsa-miR-145-3p | ovarian cancer | Apoptosis pathway | "MiR 145 is downregulated in human ovarian cancer a ......" | 24157791 | Colony formation |
| hsa-miR-145-3p | ovarian cancer | Apoptosis pathway | "miR 145 targeting high mobility group A2 is a powe ......" | 25444913 | Cell migration assay; Western blot; Luciferase |
| hsa-miR-145-3p | ovarian cancer | Apoptosis pathway | "Quercetin induces the apoptosis of human ovarian c ......" | 25937243 | |
| hsa-miR-145-3p | pancreatic cancer | Apoptosis pathway | "ROR functions as a ceRNA to regulate Nanog express ......" | 26636540 | RNAi; Luciferase |
| hsa-miR-145-3p | prostate cancer | cell cycle pathway | "Interestingly 5 of the 7 differentially expressed ......" | 19996289 | |
| hsa-miR-145-3p | prostate cancer | Apoptosis pathway | "The functional significance of microRNA 145 in pro ......" | 20588276 | Flow cytometry |
| hsa-miR-145-3p | prostate cancer | Epithelial mesenchymal transition pathway | "HEF1 promotes epithelial mesenchymal transition an ......" | 23355420 | Luciferase |
| hsa-miR-145-3p | prostate cancer | Apoptosis pathway | "Reciprocal regulation of PCGEM1 and miR 145 promot ......" | 25200485 | Luciferase; Flow cytometry; MTT assay; Transwell assay |
| hsa-miR-145-3p | prostate cancer | Epithelial mesenchymal transition pathway | "Double negative feedback loop between ZEB2 and miR ......" | 25296715 | |
| hsa-miR-145-3p | prostate cancer | cell cycle pathway | "Tumor suppressive microRNA 145 induces growth arre ......" | 25645686 | |
| hsa-miR-145-3p | prostate cancer | Apoptosis pathway | "microRNA 145 Mediates the Inhibitory Effect of Adi ......" | 27465939 | |
| hsa-miR-145-3p | sarcoma | cell cycle pathway; Apoptosis pathway | "MicroRNA expression profiles distinguish liposarco ......" | 24375455 |
Reported cancer prognosis affected by hsa-miR-145-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-145-3p | bladder cancer | progression | "We investigate microRNAs miRNAs regulating PAI-1 i ......" | 22108519 | Luciferase |
| hsa-miR-145-3p | bladder cancer | staging | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
| hsa-miR-145-3p | bladder cancer | staging; recurrence; tumorigenesis | "Expression profile of microrna 145 in urothelial b ......" | 23489501 | |
| hsa-miR-145-3p | bladder cancer | motility | "miR 1 and miR 145 act as tumor suppressor microRNA ......" | 24966896 | Colony formation |
| hsa-miR-145-3p | bladder cancer | poor survival | "Uncovering the clinical utility of miR 143 miR 145 ......" | 25804644 | |
| hsa-miR-145-3p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
| hsa-miR-145-3p | bladder cancer | cell migration; poor survival; motility | "Intravesical administration of exogenous microRNA ......" | 26036261 | Western blot; Wound Healing Assay |
| hsa-miR-145-3p | bladder cancer | drug resistance | "Identification of a hypoxia regulated miRNA signat ......" | 26196183 | Flow cytometry |
| hsa-miR-145-3p | bladder cancer | drug resistance | "Double negative feedback loop between long non cod ......" | 26318860 | |
| hsa-miR-145-3p | bladder cancer | cell migration | "Long non coding RNA urothelial cancer associated 1 ......" | 26544536 | |
| hsa-miR-145-3p | bladder cancer | drug resistance; worse prognosis | "miR 145 sensitizes gallbladder cancer to cisplatin ......" | 26852750 | |
| hsa-miR-145-3p | breast cancer | motility | "miR 145 dependent targeting of junctional adhesion ......" | 20818426 | Luciferase |
| hsa-miR-145-3p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
| hsa-miR-145-3p | breast cancer | motility; poor survival | "Development of microRNA 145 for therapeutic applic ......" | 21723890 | |
| hsa-miR-145-3p | breast cancer | staging | "MiR 145 regulates epithelial to mesenchymal transi ......" | 23049906 | |
| hsa-miR-145-3p | breast cancer | staging | "Global miRNA analysis was performed on serum from ......" | 24694649 | |
| hsa-miR-145-3p | breast cancer | metastasis; tumor size | "Stem-loop real-time RT-PCR was used to detect the ......" | 25047098 | |
| hsa-miR-145-3p | breast cancer | drug resistance | "We created a doxorubicin-resistant MCF-7 MCF-/Adr ......" | 25451164 | MTT assay |
| hsa-miR-145-3p | breast cancer | drug resistance | "New miRNA-based drugs are also promising therapy f ......" | 26199650 | |
| hsa-miR-145-3p | breast cancer | progression; cell migration | "MicroRNA 145 inhibits growth and migration of brea ......" | 26715279 | Transwell assay; Western blot |
| hsa-miR-145-3p | breast cancer | worse prognosis; staging; metastasis; tumor size | "Loss of microRNA 145 expression is involved in the ......" | 27396353 | |
| hsa-miR-145-3p | breast cancer | staging | "We report for the first time an extremely high pre ......" | 27404381 | |
| hsa-miR-145-3p | breast cancer | progression | "We identified eight microRNAs miR-10a miR-10b miR- ......" | 27433802 | |
| hsa-miR-145-3p | breast cancer | drug resistance | "miR 145 sensitizes breast cancer to doxorubicin by ......" | 27487127 | |
| hsa-miR-145-3p | breast cancer | cell migration | "miR 145 suppresses breast cancer cell migration by ......" | 27508031 | Cell migration assay; Wound Healing Assay |
| hsa-miR-145-3p | cervical and endocervical cancer | tumorigenesis | "All cell lines examined contained no detectable mi ......" | 18596939 | |
| hsa-miR-145-3p | cervical and endocervical cancer | drug resistance; motility | "Glucocorticoid regulation of a novel HPV E6 p53 mi ......" | 22287315 | |
| hsa-miR-145-3p | cervical and endocervical cancer | progression; worse prognosis; metastasis; poor survival | "Downregulation of microRNA 145 is associated with ......" | 25560490 | |
| hsa-miR-145-3p | cervical and endocervical cancer | staging; differentiation; tumor size; drug resistance | "MicroRNA 145 contributes to enhancing radiosensiti ......" | 25666710 | |
| hsa-miR-145-3p | cervical and endocervical cancer | drug resistance | "Long non coding RNA MALAT1 modulates radiosensitiv ......" | 26311052 | Flow cytometry; Colony formation; RNA pull-down |
| hsa-miR-145-3p | cervical and endocervical cancer | staging; metastasis; poor survival | "Molecular identification of miR 145 and miR 9 expr ......" | 27345415 | |
| hsa-miR-145-3p | colon cancer | tumorigenesis | "To further investigate the in vivo biological sign ......" | 18172508 | |
| hsa-miR-145-3p | colon cancer | staging; recurrence | "Here we used microarrays to profile the expression ......" | 18676867 | |
| hsa-miR-145-3p | colon cancer | tumorigenesis | "Both miR-143 and miR-145 have been shown to posses ......" | 22897626 | |
| hsa-miR-145-3p | colon cancer | metastasis | "Differential expression of microRNAs in twenty pai ......" | 25421775 | |
| hsa-miR-145-3p | colon cancer | differentiation; progression; drug resistance | "miR 21 and miR 145 cooperation in regulation of co ......" | 25928322 | Western blot |
| hsa-miR-145-3p | colon cancer | poor survival | "Downregulation of microRNA 1 and microRNA 145 cont ......" | 26459459 | MTT assay |
| hsa-miR-145-3p | colon cancer | staging | "The aim of this study was to examine the expressio ......" | 26465597 | |
| hsa-miR-145-3p | colon cancer | cell migration | "To investigate the targeted inhibition of prolifer ......" | 26973415 | Western blot; Wound Healing Assay |
| hsa-miR-145-3p | colon cancer | progression; metastasis; tumorigenesis; worse prognosis | "Long Non Coding RNA lincRNA ROR Promotes the Progr ......" | 27071407 | |
| hsa-miR-145-3p | colon cancer | cell migration; staging | "The miR-145 is dysregulated in many cancers includ ......" | 27482839 | |
| hsa-miR-145-3p | colon cancer | metastasis; malignant trasformation; progression | "Epigenetically regulated miR 145 suppresses colon ......" | 27626692 | |
| hsa-miR-145-3p | colorectal cancer | progression | "Applying real-time RT-PCR we investigated the miR- ......" | 19242066 | |
| hsa-miR-145-3p | colorectal cancer | differentiation | "Characterization of global microRNA expression rev ......" | 19843336 | |
| hsa-miR-145-3p | colorectal cancer | drug resistance; differentiation | "Analysis of the combined action of miR 143 and miR ......" | 23128394 | |
| hsa-miR-145-3p | colorectal cancer | drug resistance; differentiation | "Peroxisome proliferator activated receptor γ medi ......" | 24631504 | |
| hsa-miR-145-3p | colorectal cancer | metastasis; motility | "MicroRNA 145 inhibits tumour growth and metastasis ......" | 24642628 | Luciferase |
| hsa-miR-145-3p | colorectal cancer | metastasis | "Up regulation of microRNA 145 associates with lymp ......" | 25019299 | |
| hsa-miR-145-3p | colorectal cancer | malignant trasformation | "To assess the serum expression of 3 microRNA marke ......" | 25736690 | |
| hsa-miR-145-3p | colorectal cancer | drug resistance | "Tumor suppressor miR 145 reverses drug resistance ......" | 25913620 | Western blot; Luciferase |
| hsa-miR-145-3p | colorectal cancer | cell migration | "MicroRNA 145 suppresses cell migration and invasio ......" | 25973017 | Luciferase |
| hsa-miR-145-3p | colorectal cancer | staging | "Using individual RT-qPCR verification in 175 stage ......" | 26250939 | |
| hsa-miR-145-3p | colorectal cancer | progression | "To identify the sequential alterations of miRNAs a ......" | 26692142 | |
| hsa-miR-145-3p | colorectal cancer | cell migration | "miR 145 suppresses colorectal cancer cell migratio ......" | 27572146 | Luciferase |
| hsa-miR-145-3p | endometrial cancer | worse prognosis; poor survival | "Down regulation of miR 145 and miR 143 might be as ......" | 24071015 | |
| hsa-miR-145-3p | endometrial cancer | differentiation | "Linc RNA RoR acts as a "sponge" against mediation ......" | 24589415 | Flow cytometry; Colony formation |
| hsa-miR-145-3p | esophageal cancer | poor survival | "Using 98 formalin-fixed paraffin-embedded samples ......" | 21248297 | |
| hsa-miR-145-3p | esophageal cancer | metastasis; worse prognosis | "The cluster of miR 143 and miR 145 affects the ris ......" | 22457808 | Luciferase; Western blot |
| hsa-miR-145-3p | esophageal cancer | poor survival | "miRNAs were labeled and hybridized to the Illumina ......" | 22939244 | |
| hsa-miR-145-3p | esophageal cancer | poor survival | "A large number of miRNAs were differentially expre ......" | 23477513 | |
| hsa-miR-145-3p | esophageal cancer | progression; worse prognosis; poor survival | "We measured the serum levels of miR-21 miR-145 miR ......" | 23838916 | |
| hsa-miR-145-3p | esophageal cancer | differentiation | "Evaluating the miR 302b and miR 145 expression in ......" | 25773691 | |
| hsa-miR-145-3p | esophageal cancer | progression | "The effect of recombinant lentiviral vector encodi ......" | 26156802 | Flow cytometry |
| hsa-miR-145-3p | esophageal cancer | metastasis | "Targeting oncogenic PLCE1 by miR 145 impairs tumor ......" | 26657507 | |
| hsa-miR-145-3p | gastric cancer | metastasis | "Differential expression of miRNAs was studied usin ......" | 20726036 | |
| hsa-miR-145-3p | gastric cancer | metastasis | "The molecular mechanism of microRNA 145 to suppres ......" | 22370644 | Western blot; Luciferase |
| hsa-miR-145-3p | gastric cancer | metastasis | "In gastric cancer specimens and cell lines miRNA-1 ......" | 23233482 | Luciferase |
| hsa-miR-145-3p | gastric cancer | progression | "MiR 145 miR 133a and miR 133b inhibit proliferatio ......" | 24613927 | |
| hsa-miR-145-3p | gastric cancer | staging; worse prognosis; progression | "MicroRNA 145 is a potential prognostic factor of s ......" | 25051317 | |
| hsa-miR-145-3p | gastric cancer | metastasis; cell migration; progression | "Expression of miR 143 and miR 145 and their functi ......" | 25656032 | Transwell assay |
| hsa-miR-145-3p | gastric cancer | worse prognosis | "miR 145 mediates the antiproliferative and gene re ......" | 25762621 | Colony formation |
| hsa-miR-145-3p | gastric cancer | cell migration | "Reverse Correlation between MicroRNA 145 and FSCN1 ......" | 26010149 | |
| hsa-miR-145-3p | gastric cancer | worse prognosis | "Downregulation of miR 145 5p correlates with poor ......" | 27460730 | |
| hsa-miR-145-3p | glioblastoma | drug resistance; staging | "The SOX2 response program in glioblastoma multifor ......" | 21211035 | Colony formation |
| hsa-miR-145-3p | glioblastoma | malignant trasformation; tumorigenesis; differentiation | "In this study our miRNA/mRNA-microarray and RT-PCR ......" | 22098779 | |
| hsa-miR-145-3p | glioblastoma | progression; poor survival | "NEDD9 a novel target of miR 145 increases the inva ......" | 22869051 | |
| hsa-miR-145-3p | glioblastoma | poor survival | "MicroRNA screening predicted that microRNA-145 miR ......" | 26374689 | |
| hsa-miR-145-3p | kidney renal cell cancer | poor survival | "Global miRNA expression profiles were obtained by ......" | 22492545 | |
| hsa-miR-145-3p | kidney renal cell cancer | progression | "MiR-145 mimic in preclinical RCC orthotopic xenogr ......" | 26304926 | |
| hsa-miR-145-3p | liver cancer | malignant trasformation; worse prognosis | "Because understanding the pathogenesis of viral-as ......" | 18307259 | |
| hsa-miR-145-3p | liver cancer | tumorigenesis; poor survival | "MiR 145 modulates multiple components of the insul ......" | 22431718 | Luciferase |
| hsa-miR-145-3p | liver cancer | tumorigenesis | "MiR 145 functions as a tumor suppressor by directl ......" | 23499894 | |
| hsa-miR-145-3p | liver cancer | drug resistance | "miR 145 regulates chemoresistance in hepatocellula ......" | 26068913 | Luciferase |
| hsa-miR-145-3p | liver cancer | malignant trasformation; progression | "MicroRNA 145 and MicroRNA 133a Inhibited Prolifera ......" | 26173501 | Western blot; Luciferase |
| hsa-miR-145-3p | liver cancer | motility; progression; cell migration; metastasis | "MiR 145 suppresses cell proliferation and motility ......" | 26615424 | Transwell assay; Western blot |
| hsa-miR-145-3p | liver cancer | staging | "We first evaluated a training cohort of 192 HCC pa ......" | 26657296 | |
| hsa-miR-145-3p | lung cancer | malignant trasformation | "Using quantitative reverse transcriptase PCR analy ......" | 23462458 | |
| hsa-miR-145-3p | lung cancer | metastasis | "Downregulation of miR 145 contributes to lung aden ......" | 24026105 | |
| hsa-miR-145-3p | lung cancer | tumorigenesis; metastasis | "MiR 145 regulates cancer stem like properties and ......" | 24903381 | |
| hsa-miR-145-3p | lung cancer | metastasis; staging | "MiR 145 acts as a metastasis suppressor by targeti ......" | 25428378 | |
| hsa-miR-145-3p | lung cancer | metastasis | "MicroRNA 145 inhibits lung cancer cell metastasis; ......" | 25483817 | Western blot; Luciferase |
| hsa-miR-145-3p | lung cancer | motility; malignant trasformation | "MicroRNA 145 inhibits migration and invasion by do ......" | 26309531 | |
| hsa-miR-145-3p | lung cancer | progression | "DNA methylation mediated silencing of microRNA 145 ......" | 26582602 | |
| hsa-miR-145-3p | lung squamous cell cancer | malignant trasformation | "Increasing evidence indicates that miR-145 is a tu ......" | 21092188 | |
| hsa-miR-145-3p | lung squamous cell cancer | worse prognosis | "Low miR 145 and high miR 367 are associated with u ......" | 22835608 | |
| hsa-miR-145-3p | lung squamous cell cancer | staging | "In order to find novel noninvasive biomarkers with ......" | 25421010 | |
| hsa-miR-145-3p | lung squamous cell cancer | worse prognosis; differentiation; staging; poor survival; drug resistance | "Low miR 145 expression level is associated with po ......" | 25661374 | |
| hsa-miR-145-3p | lung squamous cell cancer | metastasis | "Expression levels of microRNA 145 and microRNA 10b ......" | 26909466 | |
| hsa-miR-145-3p | lung squamous cell cancer | cell migration | "MiR 145 and miR 203 represses TGF β induced epith ......" | 27237033 | Western blot; RNAi; Luciferase |
| hsa-miR-145-3p | lymphoma | poor survival; worse prognosis | "Prognostic impact of microRNA 145 down regulation ......" | 24745613 | |
| hsa-miR-145-3p | melanoma | malignant trasformation; progression; tumorigenesis | "Comparative study of anti oncogenic microRNA 145 i ......" | 21836381 | |
| hsa-miR-145-3p | melanoma | cell migration | "miR 145 overexpression suppresses the migration an ......" | 23404256 | |
| hsa-miR-145-3p | melanoma | metastasis | "Six microRNAs miR-9 miR-145 miR-150 miR-155 miR-20 ......" | 23863473 | |
| hsa-miR-145-3p | ovarian cancer | poor survival | "The Cox proportional hazards model and the log-ran ......" | 21345725 | |
| hsa-miR-145-3p | ovarian cancer | drug resistance | "miR 145 sensitizes ovarian cancer cells to paclita ......" | 24510775 | |
| hsa-miR-145-3p | ovarian cancer | metastasis | "miR 145 inhibits tumor growth and metastasis by ta ......" | 25333261 | |
| hsa-miR-145-3p | ovarian cancer | staging; metastasis; poor survival; recurrence; cell migration; worse prognosis | "miR 145 targeting high mobility group A2 is a powe ......" | 25444913 | Cell migration assay; Western blot; Luciferase |
| hsa-miR-145-3p | ovarian cancer | poor survival | "The authors used quantitative polymerase chain rea ......" | 25556270 | Western blot |
| hsa-miR-145-3p | ovarian cancer | worse prognosis; malignant trasformation; poor survival | "Serum microRNA 145 as a novel biomarker in human o ......" | 25722112 | |
| hsa-miR-145-3p | ovarian cancer | metastasis | "We show that p70S6K phosphorylates and inhibits th ......" | 27191261 | |
| hsa-miR-145-3p | pancreatic cancer | staging; progression | "MicroRNA 145 targets MUC13 and suppresses growth a ......" | 25277192 | |
| hsa-miR-145-3p | pancreatic cancer | worse prognosis | "ROR functions as a ceRNA to regulate Nanog express ......" | 26636540 | RNAi; Luciferase |
| hsa-miR-145-3p | pancreatic cancer | cell migration | "Restitution of Tumor Suppressor MicroRNA 145 Using ......" | 27507554 | Colony formation |
| hsa-miR-145-3p | prostate cancer | progression | "The putative tumor suppressor miR145 is transcript ......" | 20332243 | |
| hsa-miR-145-3p | prostate cancer | recurrence | "Using the Cox regression test the risk of recurren ......" | 21255804 | |
| hsa-miR-145-3p | prostate cancer | drug resistance | "MicroRNA 145 is regulated by DNA methylation and p ......" | 21349819 | |
| hsa-miR-145-3p | prostate cancer | metastasis | "Next generation sequencing technology was applied ......" | 21980368 | |
| hsa-miR-145-3p | prostate cancer | metastasis; progression | "miR 143 and miR 145 inhibit stem cell characterist ......" | 22948942 | Colony formation |
| hsa-miR-145-3p | prostate cancer | metastasis | "HEF1 promotes epithelial mesenchymal transition an ......" | 23355420 | Luciferase |
| hsa-miR-145-3p | prostate cancer | poor survival; staging; recurrence; progression | "The loss of the tumour suppressor miR 145 results ......" | 23703249 | |
| hsa-miR-145-3p | prostate cancer | cell migration | "Restoration of miR-143 or miR-145 in PCa cell line ......" | 24284362 | Luciferase |
| hsa-miR-145-3p | prostate cancer | drug resistance | "To solve this problem we inserted miRNA response e ......" | 24292881 | Luciferase |
| hsa-miR-145-3p | prostate cancer | staging; malignant trasformation | "Comparative microRNA profiling of prostate carcino ......" | 24337069 | |
| hsa-miR-145-3p | prostate cancer | metastasis | "We identify that TGFβ1-related miR-143 miR-145 mi ......" | 24763824 | |
| hsa-miR-145-3p | prostate cancer | metastasis | "Effects of miR 145 on the migration and invasion o ......" | 24846918 | |
| hsa-miR-145-3p | prostate cancer | cell migration | "Reciprocal regulation of PCGEM1 and miR 145 promot ......" | 25200485 | Luciferase; Flow cytometry; MTT assay; Transwell assay |
| hsa-miR-145-3p | prostate cancer | metastasis; progression | "Double negative feedback loop between ZEB2 and miR ......" | 25296715 | |
| hsa-miR-145-3p | prostate cancer | tumorigenesis | "Tumor suppressive microRNA 145 induces growth arre ......" | 25645686 | |
| hsa-miR-145-3p | prostate cancer | drug resistance | "A feedback regulation between miR 145 and DNA meth ......" | 25749421 | |
| hsa-miR-145-3p | prostate cancer | worse prognosis; progression; metastasis; poor survival; drug resistance | "miR 145 suppress the androgen receptor in prostate ......" | 25969144 | |
| hsa-miR-145-3p | prostate cancer | poor survival | "Here we report the polyarginine peptide R11-labele ......" | 26054847 | |
| hsa-miR-145-3p | prostate cancer | poor survival; worse prognosis | "Prognostic role of microRNA 145 in prostate cancer ......" | 26473147 | |
| hsa-miR-145-3p | prostate cancer | drug resistance; poor survival | "MicroRNA 145 Modulates Tumor Sensitivity to Radiat ......" | 26632856 | |
| hsa-miR-145-3p | retinoblastoma | progression | "MiR 145 suppressed human retinoblastoma cell proli ......" | 26823772 | |
| hsa-miR-145-3p | sarcoma | differentiation | "EWS FLI 1 modulates miRNA145 and SOX2 expression t ......" | 20382729 | |
| hsa-miR-145-3p | sarcoma | malignant trasformation | "Hsa mir 145 is the top EWS FLI1 repressed microRNA ......" | 21217773 | RNAi |
| hsa-miR-145-3p | sarcoma | metastasis; tumorigenesis | "MicroRNA 145 targets vascular endothelial growth f ......" | 22472569 | Luciferase |
| hsa-miR-145-3p | sarcoma | progression | "MicroRNA expression profiles distinguish liposarco ......" | 24375455 | |
| hsa-miR-145-3p | sarcoma | progression | "MiR 145 inhibits osteosarcoma cells proliferation ......" | 24801908 | |
| hsa-miR-145-3p | thyroid cancer | metastasis; differentiation; malignant trasformation | "miR 145 suppresses thyroid cancer growth and metas ......" | 24781864 |
Reported gene related to hsa-miR-145-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-145-3p | bladder cancer | FSCN1 | "miR 145 and miR 133a function as tumour suppressor ......" | 20160723 |
| hsa-miR-145-3p | bladder cancer | FSCN1 | "Long non coding RNA urothelial cancer associated 1 ......" | 26544536 |
| hsa-miR-145-3p | breast cancer | FSCN1 | "miR 145 dependent targeting of junctional adhesion ......" | 20818426 |
| hsa-miR-145-3p | colorectal cancer | FSCN1 | "MicroRNA 145 inhibits tumour growth and metastasis ......" | 24642628 |
| hsa-miR-145-3p | esophageal cancer | FSCN1 | "miR 145 miR 133a and miR 133b: Tumor suppressive m ......" | 21351259 |
| hsa-miR-145-3p | esophageal cancer | FSCN1 | "The protein level of FSCN1 showed no significant l ......" | 22457808 |
| hsa-miR-145-3p | gastric cancer | FSCN1 | "Reverse Correlation between MicroRNA 145 and FSCN1 ......" | 26010149 |
| hsa-miR-145-3p | liver cancer | FSCN1 | "MicroRNA 145 and MicroRNA 133a Inhibited Prolifera ......" | 26173501 |
| hsa-miR-145-3p | lung cancer | FSCN1 | "MicroRNA 145 inhibits migration and invasion by do ......" | 26309531 |
| hsa-miR-145-3p | lung squamous cell cancer | FSCN1 | "MicroRNA 145 inhibits migration and invasion via i ......" | 26238532 |
| hsa-miR-145-3p | melanoma | FSCN1 | "Surprisingly we discovered that miR-145 in melanom ......" | 23404256 |
| hsa-miR-145-3p | prostate cancer | FSCN1 | "Restoration of miR 145 expression suppresses cell ......" | 21258769 |
| hsa-miR-145-3p | breast cancer | TP53 | "miR 145 participates with TP53 in a death promotin ......" | 19730444 |
| hsa-miR-145-3p | cervical and endocervical cancer | TP53 | "Glucocorticoid regulation of a novel HPV E6 p53 mi ......" | 22287315 |
| hsa-miR-145-3p | colorectal cancer | TP53 | "Major mediators of the oncosuppression by miR-143 ......" | 23128394 |
| hsa-miR-145-3p | liver cancer | TP53 | "Here we demonstrate that in HCC cells carrying wil ......" | 27120784 |
| hsa-miR-145-3p | lung squamous cell cancer | TP53 | "miR-145 regulates SOX2 and OCT4 translation and p5 ......" | 22835608 |
| hsa-miR-145-3p | ovarian cancer | TP53 | "Using miRNA profiling analysis we found that miR-1 ......" | 25333261 |
| hsa-miR-145-3p | prostate cancer | TP53 | "MicroRNA 145 is regulated by DNA methylation and p ......" | 21349819 |
| hsa-miR-145-3p | prostate cancer | TP53 | "miR-145 is a well-documented tumour suppressor and ......" | 23703249 |
| hsa-miR-145-3p | prostate cancer | TP53 | "The putative tumor suppressor miR145 is transcript ......" | 20332243 |
| hsa-miR-145-3p | breast cancer | MYC | "We found a reverse-correlation between the express ......" | 21723890 |
| hsa-miR-145-3p | colon cancer | MYC | "The ectopic expression of miR-145 inhibited the gr ......" | 23499891 |
| hsa-miR-145-3p | colon cancer | MYC | "miR-145 delivery reduced tumor proliferation and i ......" | 21690566 |
| hsa-miR-145-3p | colon cancer | MYC | "Consequently the increased miR-145 induced G1 cell ......" | 27482839 |
| hsa-miR-145-3p | esophageal cancer | MYC | "miR 145 inhibits proliferation and invasion of eso ......" | 24356567 |
| hsa-miR-145-3p | lung squamous cell cancer | MYC | "In colon cancer cells c-Myc is a confirmed direct ......" | 21092188 |
| hsa-miR-145-3p | melanoma | MYC | "The ectopic expression of miR-145 showed a signifi ......" | 21836381 |
| hsa-miR-145-3p | ovarian cancer | MYC | "MicroRNA 145 function as a cell growth repressor b ......" | 23919393 |
| hsa-miR-145-3p | glioblastoma | SOX2 | "We also show that miR-145 and SOX2 form a double n ......" | 21211035 |
| hsa-miR-145-3p | glioblastoma | SOX2 | "In this study our miRNA/mRNA-microarray and RT-PCR ......" | 22098779 |
| hsa-miR-145-3p | lung squamous cell cancer | SOX2 | "miR-145 regulates SOX2 and OCT4 translation and p5 ......" | 22835608 |
| hsa-miR-145-3p | prostate cancer | SOX2 | "Overexpression of miR 145 5p inhibits proliferatio ......" | 25951106 |
| hsa-miR-145-3p | sarcoma | SOX2 | "Finally we provide evidence that EWS-FLI-1 and miR ......" | 20382729 |
| hsa-miR-145-3p | glioblastoma | NEDD9 | "NEDD9 a novel target of miR 145 increases the inva ......" | 22869051 |
| hsa-miR-145-3p | kidney renal cell cancer | NEDD9 | "miR 145 functions as tumor suppressor and targets ......" | 24384875 |
| hsa-miR-145-3p | pancreatic cancer | NEDD9 | "MicroRNA 145 suppresses cell proliferation invasio ......" | 25646678 |
| hsa-miR-145-3p | prostate cancer | NEDD9 | "HEF1 promotes epithelial mesenchymal transition an ......" | 23355420 |
| hsa-miR-145-3p | breast cancer | ROCK1 | "MicroRNA 145 inhibits growth and migration of brea ......" | 26715279 |
| hsa-miR-145-3p | liver cancer | ROCK1 | "MiR 145 suppresses cell proliferation and motility ......" | 26615424 |
| hsa-miR-145-3p | sarcoma | ROCK1 | "microRNA 145 inhibits osteosarcoma cell proliferat ......" | 24789502 |
| hsa-miR-145-3p | sarcoma | ROCK1 | "MiR 145 inhibits osteosarcoma cells proliferation ......" | 24801908 |
| hsa-miR-145-3p | breast cancer | CDH1 | "Over-expression of miR-145 mimics enhanced protein ......" | 23049906 |
| hsa-miR-145-3p | lung cancer | CDH1 | "Over-expression of miR-145 mimics enhanced protein ......" | 26309531 |
| hsa-miR-145-3p | thyroid cancer | CDH1 | "Overexpression of miR-145 in thyroid cancer cell l ......" | 24781864 |
| hsa-miR-145-3p | colon cancer | EGFR | "EGFR signals downregulate tumor suppressors miR 14 ......" | 21653642 |
| hsa-miR-145-3p | lung cancer | EGFR | "MiR 145 inhibits cell proliferation of human lung ......" | 21289483 |
| hsa-miR-145-3p | lung cancer | EGFR | "Our results also show that restoration of tumour s ......" | 19493678 |
| hsa-miR-145-3p | breast cancer | ERBB2 | "The expression of miR-145 in patients with breast ......" | 27396353 |
| hsa-miR-145-3p | pancreatic cancer | ERBB2 | "Additionally intratumoral injections of miR-145 in ......" | 25277192 |
| hsa-miR-145-3p | pancreatic cancer | ERBB2 | "miR-145 re-expression resulted in downregulation o ......" | 27507554 |
| hsa-miR-145-3p | liver cancer | IRS1 | "Luciferase reporter assay further verified direct ......" | 22431718 |
| hsa-miR-145-3p | liver cancer | IRS1 | "MicroRNA 145 suppresses hepatocellular carcinoma b ......" | 24690171 |
| hsa-miR-145-3p | melanoma | IRS1 | "IRS-1 was identified as a potential target of miR- ......" | 24762580 |
| hsa-miR-145-3p | breast cancer | LINC-ROR | "lincRNA RoR and miR 145 regulate invasion in tripl ......" | 25253741 |
| hsa-miR-145-3p | colon cancer | LINC-ROR | "Long Non Coding RNA lincRNA ROR Promotes the Progr ......" | 27071407 |
| hsa-miR-145-3p | endometrial cancer | LINC-ROR | "After construction of adenovirus vectors carrying ......" | 24589415 |
| hsa-miR-145-3p | bladder cancer | VEGFA | "The ectopic expression of miR-1 and miR-145 in NOZ ......" | 24966896 |
| hsa-miR-145-3p | sarcoma | VEGFA | "Furthermore the results showed that vascular endot ......" | 22472569 |
| hsa-miR-145-3p | thyroid cancer | VEGFA | "Overexpression of miR-145 in thyroid cancer cell l ......" | 24781864 |
| hsa-miR-145-3p | bladder cancer | ZEB2 | "ZEB2 was identified as a down-stream target of miR ......" | 26318860 |
| hsa-miR-145-3p | gastric cancer | ZEB2 | "MicroRNA 145 5p inhibits gastric cancer invasivene ......" | 27143926 |
| hsa-miR-145-3p | prostate cancer | ZEB2 | "Double negative feedback loop between ZEB2 and miR ......" | 25296715 |
| hsa-miR-145-3p | kidney renal cell cancer | ADAM17 | "MicroRNA 145 targets the metalloprotease ADAM17 an ......" | 23441135 |
| hsa-miR-145-3p | liver cancer | ADAM17 | "MicroRNA 145 inhibits cell proliferation by direct ......" | 25174729 |
| hsa-miR-145-3p | kidney renal cell cancer | ANGPT2 | "miR 145 functions as tumor suppressor and targets ......" | 24384875 |
| hsa-miR-145-3p | pancreatic cancer | ANGPT2 | "MiR 145 functions as a tumor suppressor via regula ......" | 27570490 |
| hsa-miR-145-3p | gastric cancer | CDH2 | "N-cadherin CDH2 was proved to be a direct target o ......" | 22370644 |
| hsa-miR-145-3p | gastric cancer | CDH2 | "MicroRNA 145 5p inhibits gastric cancer invasivene ......" | 27143926 |
| hsa-miR-145-3p | endometrial cancer | DICER1 | "After construction of adenovirus vectors carrying ......" | 24589415 |
| hsa-miR-145-3p | ovarian cancer | DICER1 | "We show that p70S6K phosphorylates and inhibits th ......" | 27191261 |
| hsa-miR-145-3p | endometrial cancer | DNMT3B | "In univariate analysis the combination of DNMT3B o ......" | 24071015 |
| hsa-miR-145-3p | prostate cancer | DNMT3B | "It was found that miR-145 upregulates while DNMT3b ......" | 25749421 |
| hsa-miR-145-3p | lung cancer | EGF | "We previously reported that restoration of hsa-miR ......" | 21289483 |
| hsa-miR-145-3p | lung cancer | EGF | "Restoration of tumour suppressor hsa miR 145 inhib ......" | 19493678 |
| hsa-miR-145-3p | colorectal cancer | ERG | "miR 145 suppresses colorectal cancer cell migratio ......" | 27572146 |
| hsa-miR-145-3p | prostate cancer | ERG | "The proto oncogene ERG is a target of microRNA miR ......" | 23480797 |
| hsa-miR-145-3p | breast cancer | ESR1 | "The expression of miR-145 in patients with breast ......" | 27396353 |
| hsa-miR-145-3p | breast cancer | ESR1 | "miR 145 participates with TP53 in a death promotin ......" | 19730444 |
| hsa-miR-145-3p | breast cancer | F11R | "Our data identify JAM-A and fascin as novel target ......" | 20818426 |
| hsa-miR-145-3p | glioblastoma | F11R | "MicroRNA screening predicted that microRNA-145 miR ......" | 26374689 |
| hsa-miR-145-3p | breast cancer | FN1 | "Over-expression of miR-145 mimics enhanced protein ......" | 23049906 |
| hsa-miR-145-3p | lung cancer | FN1 | "Over-expression of miR-145 mimics enhanced protein ......" | 26309531 |
| hsa-miR-145-3p | liver cancer | INSR | "Multiple in silico algorithms predicted that miR-1 ......" | 22431718 |
| hsa-miR-145-3p | melanoma | INSR | "MicroRNA 145 may play an important role in uveal m ......" | 24762580 |
| hsa-miR-145-3p | lung cancer | MTDH | "MiR 145 acts as a metastasis suppressor by targeti ......" | 25428378 |
| hsa-miR-145-3p | ovarian cancer | MTDH | "miR 145 inhibits tumor growth and metastasis by ta ......" | 25333261 |
| hsa-miR-145-3p | pancreatic cancer | MUC13 | "MicroRNA 145 targets MUC13 and suppresses growth a ......" | 25277192 |
| hsa-miR-145-3p | pancreatic cancer | MUC13 | "miR-145 re-expression resulted in downregulation o ......" | 27507554 |
| hsa-miR-145-3p | glioblastoma | NANOG | "Real-time polymerase chain reaction was used to an ......" | 24531649 |
| hsa-miR-145-3p | pancreatic cancer | NANOG | "ROR functions as a ceRNA to regulate Nanog express ......" | 26636540 |
| hsa-miR-145-3p | colorectal cancer | SOX9 | "Ectopic expression of miR-145 in turn regulates SO ......" | 24631504 |
| hsa-miR-145-3p | sarcoma | SOX9 | "The epigenetic regulation of SOX9 by miR 145 in hu ......" | 25145279 |
| hsa-miR-145-3p | retinoblastoma | ADAM19 | "MiR 145 suppressed human retinoblastoma cell proli ......" | 26823772 |
| hsa-miR-145-3p | cervical and endocervical cancer | AGO2 | "By performing RNA-binding protein immunoprecipitat ......" | 26311052 |
| hsa-miR-145-3p | prostate cancer | AIFM1 | "Artificial overexpression of miR145 by using adeno ......" | 20332243 |
| hsa-miR-145-3p | thyroid cancer | AKT3 | "miR 145 suppresses thyroid cancer growth and metas ......" | 24781864 |
| hsa-miR-145-3p | prostate cancer | AR | "miR 145 suppress the androgen receptor in prostate ......" | 25969144 |
| hsa-miR-145-3p | breast cancer | ARF6 | "lincRNA RoR and miR 145 regulate invasion in tripl ......" | 25253741 |
| hsa-miR-145-3p | bladder cancer | AXL | "The ectopic expression of miR-1 and miR-145 in NOZ ......" | 24966896 |
| hsa-miR-145-3p | prostate cancer | BCL2L1 | "ASC miR-145 knockdown CM also reduced the expressi ......" | 27465939 |
| hsa-miR-145-3p | breast cancer | BIRC2 | "The cellular inhibitor of apoptosis cIAP1 which is ......" | 26733177 |
| hsa-miR-145-3p | melanoma | BLM | "Therefore in this study we examined the expression ......" | 23404256 |
| hsa-miR-145-3p | prostate cancer | BNIP3 | "Artificial overexpression of miR145 by using adeno ......" | 20332243 |
| hsa-miR-145-3p | lung cancer | CAMK1D | "Loss of miR-143/145 in vivo led to derepression of ......" | 26586766 |
| hsa-miR-145-3p | ovarian cancer | CASP3 | "The results revealed that the expression levels of ......" | 25937243 |
| hsa-miR-145-3p | colon cancer | CD44 | "This was associated with decreased expression of C ......" | 25928322 |
| hsa-miR-145-3p | lung squamous cell cancer | CDK4 | "Furthermore we found that CDK4 was regulated by mi ......" | 21092188 |
| hsa-miR-145-3p | ovarian cancer | CDK6 | "miR 145 sensitizes ovarian cancer cells to paclita ......" | 24510775 |
| hsa-miR-145-3p | gastric cancer | CTNND1 | "Luciferase assay western blot analysis and in vivo ......" | 25470111 |
| hsa-miR-145-3p | liver cancer | CUL5 | "Downregulation of MicroRNA 145 Caused by Hepatitis ......" | 26512974 |
| hsa-miR-145-3p | prostate cancer | DAB2 | "Effects of miR 145 on the migration and invasion o ......" | 24846918 |
| hsa-miR-145-3p | gastric cancer | E2F3 | "miR 145 mediates the antiproliferative and gene re ......" | 25762621 |
| hsa-miR-145-3p | breast cancer | ERBB3 | "miR 143 and miR 145 synergistically regulate ERBB3 ......" | 25248370 |
| hsa-miR-145-3p | gastric cancer | ETS1 | "In gastric cancer specimens and cell lines miRNA-1 ......" | 23233482 |
| hsa-miR-145-3p | sarcoma | ETV5 | "We hypothesized that the expression of miR-145 is ......" | 25145279 |
| hsa-miR-145-3p | colon cancer | FLI1 | "In this study the authors identified the Friend le ......" | 20737575 |
| hsa-miR-145-3p | colon cancer | GJA1 | "The miR-145 transfer to SW480 up-regulates their C ......" | 27058413 |
| hsa-miR-145-3p | liver cancer | HDAC2 | "MiR 145 functions as a tumor suppressor by directl ......" | 23499894 |
| hsa-miR-145-3p | kidney renal cell cancer | HK2 | "Luciferase reporter assays showed that both miR-14 ......" | 24033605 |
| hsa-miR-145-3p | cervical and endocervical cancer | HLTF | "We show that miR-145 targets the DNA damage repair ......" | 25666710 |
| hsa-miR-145-3p | ovarian cancer | HMGA2 | "This study addressed the hypothesis that miR-145 s ......" | 25444913 |
| hsa-miR-145-3p | acute myeloid leukemia | HOXA9 | "From result it was observed mir-145 has highest af ......" | 26175662 |
| hsa-miR-145-3p | colorectal cancer | IGF1R | "MiR 143 and MiR 145 regulate IGF1R to suppress cel ......" | 25474488 |
| hsa-miR-145-3p | bladder cancer | ILK | "We newly elucidated that miR-143 targeted akt and ......" | 23104321 |
| hsa-miR-145-3p | liver cancer | IRS2 | "Multiple in silico algorithms predicted that miR-1 ......" | 22431718 |
| hsa-miR-145-3p | colon cancer | KRAS | "Stable miR-143 or miR-145 overexpression increased ......" | 26824186 |
| hsa-miR-145-3p | colon cancer | KRT20 | "This was associated with decreased expression of C ......" | 25928322 |
| hsa-miR-145-3p | colon cancer | LASP1 | "Epigenetically regulated miR 145 suppresses colon ......" | 27626692 |
| hsa-miR-145-3p | lung cancer | LCT | "The molecular mechanism of down-regulated microRNA ......" | 26582602 |
| hsa-miR-145-3p | cervical and endocervical cancer | MALAT1 | "Long non coding RNA MALAT1 modulates radiosensitiv ......" | 26311052 |
| hsa-miR-145-3p | colon cancer | MAPK7 | "miR-145 delivery reduced tumor proliferation and i ......" | 21690566 |
| hsa-miR-145-3p | breast cancer | MBOAT4 | "To test our RNA extraction efficiency we spiked-in ......" | 19454029 |
| hsa-miR-145-3p | breast cancer | MMP11 | "MicroRNA 145 functions as a tumor suppressor by ta ......" | 27364572 |
| hsa-miR-145-3p | gastric cancer | MMP2 | "Although not a direct target of miR-145 matrix met ......" | 22370644 |
| hsa-miR-145-3p | gastric cancer | MMP9 | "Although not a direct target of miR-145 matrix met ......" | 22370644 |
| hsa-miR-145-3p | ovarian cancer | MUC1 | "MiR 145 is downregulated in human ovarian cancer a ......" | 24157791 |
| hsa-miR-145-3p | prostate cancer | MYO6 | "A computational search indicated the 3'-untranslat ......" | 20353999 |
| hsa-miR-145-3p | bladder cancer | NMI | "We have shown that miR-145 is a novel robust and d ......" | 26196183 |
| hsa-miR-145-3p | colon cancer | NRAS | "miR-145 expression was significantly downregulated ......" | 26973415 |
| hsa-miR-145-3p | lung cancer | NUDT1 | "MiR 145 inhibits cell proliferation of human lung ......" | 21289483 |
| hsa-miR-145-3p | bladder cancer | PAK1 | "miR 145 inhibits invasion of bladder cancer cells ......" | 24954107 |
| hsa-miR-145-3p | colon cancer | PAK4 | "We further demonstrated that miR-145 directly targ ......" | 23499891 |
| hsa-miR-145-3p | prostate cancer | PCGEM1 | "Reciprocal regulation of PCGEM1 and miR 145 promot ......" | 25200485 |
| hsa-miR-145-3p | colon cancer | PDLIM5 | "We also provided experimental evidences which incl ......" | 27626692 |
| hsa-miR-145-3p | esophageal cancer | PLCE1 | "Targeting oncogenic PLCE1 by miR 145 impairs tumor ......" | 26657507 |
| hsa-miR-145-3p | liver cancer | POU5F1P4 | "Pseudogene OCT4 pg4 functions as a natural micro R ......" | 23615404 |
| hsa-miR-145-3p | endometrial cancer | POU5F1P5 | "OCT4 expression can be modulated by miR-145 and th ......" | 25634023 |
| hsa-miR-145-3p | colorectal cancer | PPARA | "PPARγ regulates the expression of miR-145 by dire ......" | 24631504 |
| hsa-miR-145-3p | pancreatic cancer | PSMA5 | "Physico-chemical characterization dynamic light sc ......" | 27507554 |
| hsa-miR-145-3p | bladder cancer | PTCRA | "miR-145 was under-expressed in 73.3% and 86.7% of ......" | 23489501 |
| hsa-miR-145-3p | colorectal cancer | PXN | "MicroRNA 145 suppresses cell migration and invasio ......" | 25973017 |
| hsa-miR-145-3p | breast cancer | RAB27A | "MiR-145 exhibited an inhibitory role in cell invas ......" | 27364572 |
| hsa-miR-145-3p | breast cancer | RAB6A | "MicroRNA 145 functions as a tumor suppressor by ta ......" | 27364572 |
| hsa-miR-145-3p | colorectal cancer | RAD18 | "Tumor suppressor miR 145 reverses drug resistance ......" | 25913620 |
| hsa-miR-145-3p | ovarian cancer | RPS6KB1 | "MiR 145 is downregulated in human ovarian cancer a ......" | 24157791 |
| hsa-miR-145-3p | breast cancer | RTKN | "miR 145 inhibits breast cancer cell growth through ......" | 19360360 |
| hsa-miR-145-3p | prostate cancer | SENP1 | "Tumor suppressive microRNA 145 induces growth arre ......" | 25645686 |
| hsa-miR-145-3p | bladder cancer | SERPINE1 | "Mature miR-143 and miR-145 are coordinately expres ......" | 22108519 |
| hsa-miR-145-3p | lung squamous cell cancer | SMAD3 | "MiR 145 and miR 203 represses TGF β induced epith ......" | 27237033 |
| hsa-miR-145-3p | prostate cancer | SNORD48 | "Following polyadenylation and reverse transcriptio ......" | 23703249 |
| hsa-miR-145-3p | bladder cancer | SOCS7 | "socs7 a target gene of microRNA 145 regulates inte ......" | 23392170 |
| hsa-miR-145-3p | ovarian cancer | SP1 | "miR 145 sensitizes ovarian cancer cells to paclita ......" | 24510775 |
| hsa-miR-145-3p | glioblastoma | SRGAP1 | "Herein we investigated the correlation between miR ......" | 26026080 |
| hsa-miR-145-3p | glioblastoma | SRY | "Real-time polymerase chain reaction was used to an ......" | 24531649 |
| hsa-miR-145-3p | colon cancer | STAT1 | "MicroRNA 145 targets YES and STAT1 in colon cancer ......" | 20098684 |
| hsa-miR-145-3p | bladder cancer | STAT3 | "socs7 a target gene of microRNA 145 regulates inte ......" | 23392170 |
| hsa-miR-145-3p | prostate cancer | SWAP70 | "SWAP70 actin binding protein function as an oncoge ......" | 21360565 |
| hsa-miR-145-3p | bladder cancer | TLR3 | "The apoptosis did not depend on Toll-like receptor ......" | 23392170 |
| hsa-miR-145-3p | breast cancer | TNF | "MiR 145 promotes TNF α induced apoptosis by facil ......" | 26733177 |
| hsa-miR-145-3p | prostate cancer | TNFSF10 | "One of the genes significantly upregulated by miR- ......" | 20588276 |
| hsa-miR-145-3p | pancreatic cancer | TNMD | "Physico-chemical characterization dynamic light sc ......" | 27507554 |
| hsa-miR-145-3p | pancreatic cancer | TRIB3 | "In particular ROR may act as a ceRNA effectively b ......" | 26636540 |
| hsa-miR-145-3p | ovarian cancer | TRIM2 | "MicroRNA 145 targets TRIM2 and exerts tumor suppre ......" | 26472353 |
| hsa-miR-145-3p | lung squamous cell cancer | TTR | "We analysed the expression of the miR-302-367 clus ......" | 22835608 |
| hsa-miR-145-3p | bladder cancer | TUG1 | "Double negative feedback loop between long non cod ......" | 26318860 |
| hsa-miR-145-3p | bladder cancer | UHRF1 | "Taken together our present data demonstrated that ......" | 27072587 |
| hsa-miR-145-3p | colon cancer | YES1 | "MicroRNA 145 targets YES and STAT1 in colon cancer ......" | 20098684 |
| hsa-miR-145-3p | prostate cancer | ZEB2-AS1 | "Importantly the expression level of ZEB2 as reveal ......" | 25296715 |
| hsa-miR-145-3p | ovarian cancer | ZFP36 | "We show that p70S6K phosphorylates and inhibits th ......" | 27191261 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-145-3p | RAD52 | 9 cancers: BLCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD | MirTarget | TCGA BLCA -0.086; TCGA COAD -0.176; TCGA KIRC -0.088; TCGA KIRP -0.186; TCGA LGG -0.182; TCGA LIHC -0.058; TCGA LUAD -0.115; TCGA LUSC -0.215; TCGA PRAD -0.077 |
hsa-miR-145-3p | R3HDM1 | 11 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.054; TCGA BRCA -0.097; TCGA COAD -0.104; TCGA ESCA -0.098; TCGA LIHC -0.112; TCGA LUAD -0.251; TCGA LUSC -0.299; TCGA OV -0.067; TCGA PRAD -0.145; TCGA STAD -0.168; TCGA UCEC -0.08 |
hsa-miR-145-3p | PSMA1 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.079; TCGA BRCA -0.11; TCGA CESC -0.074; TCGA COAD -0.125; TCGA ESCA -0.094; TCGA HNSC -0.133; TCGA KIRC -0.084; TCGA LIHC -0.071; TCGA LUAD -0.146; TCGA LUSC -0.166; TCGA OV -0.057; TCGA PRAD -0.16; TCGA THCA -0.076; TCGA STAD -0.113; TCGA UCEC -0.069 |
hsa-miR-145-3p | EAF1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.071; TCGA BRCA -0.066; TCGA CESC -0.107; TCGA COAD -0.126; TCGA ESCA -0.177; TCGA KIRC -0.068; TCGA LUAD -0.092; TCGA OV -0.065; TCGA PAAD -0.109; TCGA PRAD -0.146; TCGA STAD -0.163; TCGA UCEC -0.078 |
hsa-miR-145-3p | CCNC | 9 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.055; TCGA CESC -0.07; TCGA COAD -0.171; TCGA ESCA -0.101; TCGA LUAD -0.091; TCGA LUSC -0.104; TCGA SARC -0.074; TCGA STAD -0.144; TCGA UCEC -0.121 |
hsa-miR-145-3p | HK2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.213; TCGA BRCA -0.067; TCGA CESC -0.242; TCGA COAD -0.27; TCGA ESCA -0.197; TCGA HNSC -0.202; TCGA KIRP -0.329; TCGA LGG -0.18; TCGA LUAD -0.187; TCGA LUSC -0.231; TCGA PRAD -0.263; TCGA SARC -0.313; TCGA STAD -0.444; TCGA UCEC -0.255 |
hsa-miR-145-3p | KDM3A | 10 cancers: BLCA; CESC; COAD; KIRP; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.15; TCGA CESC -0.093; TCGA COAD -0.146; TCGA KIRP -0.085; TCGA LIHC -0.106; TCGA LUAD -0.158; TCGA LUSC -0.24; TCGA PRAD -0.052; TCGA STAD -0.082; TCGA UCEC -0.066 |
hsa-miR-145-3p | NUFIP2 | 10 cancers: BLCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.091; TCGA CESC -0.072; TCGA COAD -0.096; TCGA ESCA -0.08; TCGA KIRP -0.051; TCGA LUAD -0.132; TCGA LUSC -0.147; TCGA PRAD -0.118; TCGA STAD -0.172; TCGA UCEC -0.091 |
hsa-miR-145-3p | TUFT1 | 11 cancers: BLCA; BRCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.117; TCGA BRCA -0.272; TCGA HNSC -0.109; TCGA KIRC -0.265; TCGA LIHC -0.115; TCGA LUAD -0.184; TCGA LUSC -0.359; TCGA PRAD -0.195; TCGA THCA -0.06; TCGA STAD -0.131; TCGA UCEC -0.221 |
hsa-miR-145-3p | ELOVL6 | 10 cancers: BLCA; COAD; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.2; TCGA COAD -0.258; TCGA KIRC -0.45; TCGA KIRP -0.057; TCGA LUAD -0.284; TCGA LUSC -0.29; TCGA PRAD -0.309; TCGA SARC -0.187; TCGA THCA -0.314; TCGA UCEC -0.13 |
hsa-miR-145-3p | CTPS2 | 11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.109; TCGA BRCA -0.174; TCGA ESCA -0.099; TCGA KIRC -0.128; TCGA KIRP -0.062; TCGA LGG -0.105; TCGA LUAD -0.13; TCGA LUSC -0.192; TCGA PRAD -0.132; TCGA STAD -0.16; TCGA UCEC -0.074 |
hsa-miR-145-3p | ZNF687 | 14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.115; TCGA BRCA -0.247; TCGA CESC -0.065; TCGA HNSC -0.069; TCGA KIRC -0.072; TCGA LGG -0.062; TCGA LIHC -0.138; TCGA LUAD -0.183; TCGA LUSC -0.257; TCGA PAAD -0.111; TCGA PRAD -0.087; TCGA THCA -0.087; TCGA STAD -0.097; TCGA UCEC -0.118 |
hsa-miR-145-3p | SOX12 | 10 cancers: BLCA; BRCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.082; TCGA BRCA -0.446; TCGA KIRP -0.138; TCGA LGG -0.161; TCGA LIHC -0.218; TCGA LUAD -0.222; TCGA LUSC -0.371; TCGA PAAD -0.202; TCGA PRAD -0.285; TCGA UCEC -0.137 |
hsa-miR-145-3p | MED28 | 14 cancers: BLCA; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.086; TCGA COAD -0.126; TCGA HNSC -0.069; TCGA KIRC -0.052; TCGA LGG -0.054; TCGA LIHC -0.058; TCGA LUAD -0.163; TCGA LUSC -0.082; TCGA OV -0.13; TCGA PAAD -0.067; TCGA PRAD -0.126; TCGA THCA -0.141; TCGA STAD -0.056; TCGA UCEC -0.069 |
hsa-miR-145-3p | UHRF1BP1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.082; TCGA BRCA -0.073; TCGA CESC -0.068; TCGA COAD -0.078; TCGA ESCA -0.078; TCGA KIRC -0.109; TCGA LUAD -0.198; TCGA LUSC -0.089; TCGA PRAD -0.183; TCGA THCA -0.071; TCGA STAD -0.155; TCGA UCEC -0.099 |
hsa-miR-145-3p | SCD | 10 cancers: BLCA; CESC; HNSC; LIHC; LUAD; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.139; TCGA CESC -0.304; TCGA HNSC -0.248; TCGA LIHC -0.224; TCGA LUAD -0.151; TCGA PAAD -0.223; TCGA SARC -0.206; TCGA THCA -0.608; TCGA STAD -0.334; TCGA UCEC -0.201 |
hsa-miR-145-3p | ONECUT2 | 12 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.439; TCGA ESCA -0.712; TCGA HNSC -0.462; TCGA KIRC -0.45; TCGA KIRP -0.528; TCGA LGG -0.136; TCGA LIHC -0.314; TCGA LUAD -0.284; TCGA LUSC -0.819; TCGA PRAD -1.099; TCGA STAD -0.293; TCGA UCEC -0.335 |
hsa-miR-145-3p | WDR55 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.058; TCGA BRCA -0.109; TCGA CESC -0.086; TCGA COAD -0.095; TCGA ESCA -0.114; TCGA LIHC -0.063; TCGA LUAD -0.06; TCGA PRAD -0.096; TCGA THCA -0.206; TCGA STAD -0.083; TCGA UCEC -0.057 |
hsa-miR-145-3p | RAB11FIP4 | 11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.176; TCGA BRCA -0.362; TCGA CESC -0.138; TCGA ESCA -0.214; TCGA KIRC -0.258; TCGA LIHC -0.131; TCGA PRAD -0.139; TCGA SARC -0.26; TCGA THCA -0.147; TCGA STAD -0.212; TCGA UCEC -0.294 |
hsa-miR-145-3p | ANKRD52 | 9 cancers: BLCA; BRCA; CESC; KIRP; LIHC; LUAD; LUSC; PRAD; STAD | mirMAP; miRNATAP | TCGA BLCA -0.06; TCGA BRCA -0.068; TCGA CESC -0.068; TCGA KIRP -0.072; TCGA LIHC -0.147; TCGA LUAD -0.163; TCGA LUSC -0.175; TCGA PRAD -0.141; TCGA STAD -0.088 |
hsa-miR-145-3p | ZNF621 | 9 cancers: BLCA; COAD; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; STAD | mirMAP | TCGA BLCA -0.094; TCGA COAD -0.073; TCGA KIRC -0.154; TCGA KIRP -0.153; TCGA LGG -0.11; TCGA LIHC -0.061; TCGA LUSC -0.074; TCGA PRAD -0.117; TCGA STAD -0.094 |
hsa-miR-145-3p | LMNB2 | 14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.1; TCGA BRCA -0.348; TCGA COAD -0.116; TCGA ESCA -0.204; TCGA HNSC -0.21; TCGA KIRP -0.061; TCGA LIHC -0.1; TCGA LUAD -0.313; TCGA LUSC -0.439; TCGA PRAD -0.235; TCGA SARC -0.155; TCGA THCA -0.126; TCGA STAD -0.303; TCGA UCEC -0.114 |
hsa-miR-145-3p | SMG7 | 10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.092; TCGA BRCA -0.155; TCGA ESCA -0.084; TCGA HNSC -0.094; TCGA LIHC -0.074; TCGA LUAD -0.125; TCGA LUSC -0.225; TCGA PRAD -0.112; TCGA STAD -0.181; TCGA UCEC -0.101 |
hsa-miR-145-3p | OGT | 10 cancers: BLCA; COAD; KIRC; LGG; LIHC; LUSC; OV; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.215; TCGA COAD -0.192; TCGA KIRC -0.152; TCGA LGG -0.053; TCGA LIHC -0.098; TCGA LUSC -0.136; TCGA OV -0.076; TCGA PRAD -0.411; TCGA THCA -0.11; TCGA STAD -0.213 |
hsa-miR-145-3p | BMS1 | 10 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.059; TCGA COAD -0.066; TCGA ESCA -0.089; TCGA HNSC -0.069; TCGA LUAD -0.14; TCGA LUSC -0.145; TCGA PRAD -0.073; TCGA SARC -0.084; TCGA STAD -0.202; TCGA UCEC -0.091 |
hsa-miR-145-3p | CCDC117 | 9 cancers: BRCA; COAD; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BRCA -0.09; TCGA COAD -0.057; TCGA LIHC -0.101; TCGA LUAD -0.095; TCGA LUSC -0.16; TCGA OV -0.078; TCGA PRAD -0.091; TCGA STAD -0.121; TCGA UCEC -0.086 |
hsa-miR-145-3p | TBL1XR1 | 11 cancers: BRCA; COAD; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.082; TCGA COAD -0.086; TCGA KIRC -0.085; TCGA KIRP -0.063; TCGA LUAD -0.134; TCGA LUSC -0.301; TCGA PRAD -0.219; TCGA SARC -0.06; TCGA THCA -0.063; TCGA STAD -0.205; TCGA UCEC -0.129 |
hsa-miR-145-3p | SET | 13 cancers: BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.102; TCGA COAD -0.114; TCGA ESCA -0.141; TCGA HNSC -0.123; TCGA LGG -0.05; TCGA LIHC -0.062; TCGA LUAD -0.167; TCGA LUSC -0.258; TCGA PAAD -0.083; TCGA PRAD -0.231; TCGA THCA -0.077; TCGA STAD -0.178; TCGA UCEC -0.08 |
hsa-miR-145-3p | RAP2C | 10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BRCA -0.119; TCGA COAD -0.101; TCGA ESCA -0.061; TCGA HNSC -0.064; TCGA KIRC -0.123; TCGA LUAD -0.09; TCGA LUSC -0.105; TCGA SARC -0.139; TCGA THCA -0.073; TCGA STAD -0.124 |
hsa-miR-145-3p | LPCAT3 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; OV; PAAD; PRAD; SARC; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.119; TCGA ESCA -0.098; TCGA KIRC -0.149; TCGA KIRP -0.071; TCGA LGG -0.097; TCGA OV -0.096; TCGA PAAD -0.143; TCGA PRAD -0.124; TCGA SARC -0.082; TCGA UCEC -0.142 |
hsa-miR-145-3p | NLN | 11 cancers: BRCA; ESCA; KIRC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.081; TCGA ESCA -0.091; TCGA KIRC -0.135; TCGA LUAD -0.262; TCGA LUSC -0.38; TCGA OV -0.087; TCGA PRAD -0.246; TCGA SARC -0.092; TCGA THCA -0.284; TCGA STAD -0.211; TCGA UCEC -0.15 |
hsa-miR-145-3p | SORD | 9 cancers: BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; STAD | mirMAP | TCGA BRCA -0.388; TCGA COAD -0.207; TCGA ESCA -0.278; TCGA HNSC -0.141; TCGA LGG -0.176; TCGA LUAD -0.136; TCGA LUSC -0.327; TCGA OV -0.073; TCGA STAD -0.262 |
hsa-miR-145-3p | SLC35E3 | 9 cancers: BRCA; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BRCA -0.087; TCGA KIRC -0.12; TCGA LIHC -0.118; TCGA LUAD -0.134; TCGA LUSC -0.096; TCGA PAAD -0.12; TCGA SARC -0.187; TCGA STAD -0.067; TCGA UCEC -0.074 |
hsa-miR-145-3p | CENPP | 11 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.31; TCGA COAD -0.13; TCGA HNSC -0.216; TCGA LIHC -0.233; TCGA LUAD -0.192; TCGA LUSC -0.333; TCGA PRAD -0.208; TCGA SARC -0.071; TCGA THCA -0.133; TCGA STAD -0.104; TCGA UCEC -0.075 |
hsa-miR-145-3p | HNRNPU | 11 cancers: BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.133; TCGA COAD -0.065; TCGA ESCA -0.088; TCGA HNSC -0.087; TCGA LGG -0.058; TCGA LIHC -0.096; TCGA LUAD -0.133; TCGA LUSC -0.177; TCGA PRAD -0.149; TCGA STAD -0.197; TCGA UCEC -0.102 |
hsa-miR-145-3p | CS | 10 cancers: COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA COAD -0.131; TCGA ESCA -0.063; TCGA KIRC -0.123; TCGA LIHC -0.082; TCGA LUAD -0.181; TCGA LUSC -0.147; TCGA PRAD -0.167; TCGA THCA -0.067; TCGA STAD -0.081; TCGA UCEC -0.052 |
Enriched cancer pathways of putative targets