microRNA information: hsa-miR-1468-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-1468-5p | miRbase |
| Accession: | MIMAT0006789 | miRbase |
| Precursor name: | hsa-mir-1468 | miRbase |
| Precursor accession: | MI0003782 | miRbase |
| Symbol: | MIR1468 | HGNC |
| RefSeq ID: | NR_031567 | GenBank |
| Sequence: | CUCCGUUUGCCUGUUUCGCUG |
Reported expression in cancers: hsa-miR-1468-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-1468-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-1468-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-1468-5p | kidney papillary renal cell cancer | staging; poor survival | "In the training stage the expression levels of 12 ......" | 25906110 | |
| hsa-miR-1468-5p | lung cancer | poor survival; recurrence | "In the multivariate Cox regression analysis mir-14 ......" | 27695346 |
Reported gene related to hsa-miR-1468-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-1468-5p | PIK3CD | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; PRAD; THCA | MirTarget | TCGA BLCA -0.224; TCGA CESC -0.153; TCGA COAD -0.293; TCGA ESCA -0.218; TCGA HNSC -0.19; TCGA KIRC -0.2; TCGA LIHC -0.115; TCGA PRAD -0.109; TCGA THCA -0.4 |
hsa-miR-1468-5p | CAPN2 | 11 cancers: BLCA; CESC; HNSC; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.233; TCGA CESC -0.202; TCGA HNSC -0.058; TCGA LGG -0.06; TCGA LIHC -0.099; TCGA LUAD -0.057; TCGA PAAD -0.183; TCGA PRAD -0.071; TCGA SARC -0.103; TCGA THCA -0.166; TCGA STAD -0.145 |
Enriched cancer pathways of putative targets