microRNA information: hsa-miR-150-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-150-3p | miRbase |
| Accession: | MIMAT0004610 | miRbase |
| Precursor name: | hsa-mir-150 | miRbase |
| Precursor accession: | MI0000479 | miRbase |
| Symbol: | MIR150 | HGNC |
| RefSeq ID: | NR_029703 | GenBank |
| Sequence: | CUGGUACAGGCCUGGGGGACAG |
Reported expression in cancers: hsa-miR-150-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-150-3p | B cell lymphoma | deregulation | "A set of 11 miRNAs associated with the differentia ......" | 22936066 | qPCR |
| hsa-miR-150-3p | T cell leukemia | deregulation | "Specifically miR-150 and miR-223 were up-regulated ......" | 19246560 | |
| hsa-miR-150-3p | acute myeloid leukemia | deregulation | "Circulating miR 150 and miR 342 in plasma are nove ......" | 23391324 | Microarray; qPCR |
| hsa-miR-150-3p | colon cancer | downregulation | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | Microarray; qPCR |
| hsa-miR-150-3p | colorectal cancer | downregulation | "The study was divided into two phases: firstly qRT ......" | 25255814 | qPCR; Microarray |
| hsa-miR-150-3p | esophageal cancer | downregulation | "A public microarray database showed that the expre ......" | 23013135 | Microarray; qPCR |
| hsa-miR-150-3p | gastric cancer | upregulation | "In the analysis by real-time PCR-based miRNA array ......" | 22407237 | qPCR; Microarray |
| hsa-miR-150-3p | gastric cancer | upregulation | "From the set of the 29 microRNAs of interest we fo ......" | 27081844 | |
| hsa-miR-150-3p | liver cancer | downregulation | "MicroRNA-150 miR-150 is frequently dysregulated in ......" | 26871477 | |
| hsa-miR-150-3p | lung cancer | upregulation | "In the present study miR-150 was found to be signi ......" | 24456795 | qPCR |
| hsa-miR-150-3p | lung squamous cell cancer | downregulation | "Expression of miR 150 and miR 3940 5p is reduced i ......" | 23228962 | |
| hsa-miR-150-3p | lung squamous cell cancer | upregulation | "The levels of two mature miRNAs miR-143 and miR-15 ......" | 24286416 | qPCR |
| hsa-miR-150-3p | lymphoma | downregulation | "Using quantitative reverse transcription-polymeras ......" | 19177201 | Reverse transcription PCR; Microarray |
| hsa-miR-150-3p | lymphoma | downregulation | "Low expression of miR 150 in pediatric intestinal ......" | 24613688 | qPCR |
| hsa-miR-150-3p | ovarian cancer | upregulation | "We analyzed the miRNA expression profiles of prima ......" | 23554878 | qPCR |
| hsa-miR-150-3p | ovarian cancer | downregulation | "MicroRNA miR-150 has been reported to be dramatica ......" | 25090005 | qPCR |
| hsa-miR-150-3p | pancreatic cancer | downregulation | "Recently we identified miR-150 as a novel tumor su ......" | 24971005 | |
| hsa-miR-150-3p | pancreatic cancer | downregulation | "Limited research investigating the role of oncogen ......" | 25522282 | |
| hsa-miR-150-3p | prostate cancer | upregulation | "miR 150 is a factor of survival in prostate cancer ......" | 25778313 |
Reported cancer pathway affected by hsa-miR-150-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-150-3p | acute myeloid leukemia | Apoptosis pathway | "Eradication of Acute Myeloid Leukemia with FLT3 Li ......" | 27280396 | |
| hsa-miR-150-3p | breast cancer | Apoptosis pathway | "miR 150 promotes human breast cancer growth and ma ......" | 24312495 | |
| hsa-miR-150-3p | cervical and endocervical cancer | Apoptosis pathway; cell cycle pathway | "microRNA 150 promotes cervical cancer cell growth ......" | 26715362 | Western blot; Flow cytometry; Luciferase |
| hsa-miR-150-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "Wnt/β catenin pathway transactivates microRNA 150 ......" | 27285761 | |
| hsa-miR-150-3p | esophageal cancer | Epithelial mesenchymal transition pathway | "MiR 150 is associated with poor prognosis in esoph ......" | 23013135 | |
| hsa-miR-150-3p | glioblastoma | cell cycle pathway | "An unbiased functional microRNA screen identified ......" | 27399532 | |
| hsa-miR-150-3p | liver cancer | cell cycle pathway; Apoptosis pathway | "microRNA 150 inhibits human CD133 positive liver c ......" | 22025269 | Western blot |
| hsa-miR-150-3p | liver cancer | Epithelial mesenchymal transition pathway | "MicroRNA 150 suppresses cell proliferation and met ......" | 26871477 | |
| hsa-miR-150-3p | lung cancer | Apoptosis pathway | "miR 150 promotes the proliferation of lung cancer ......" | 23747308 | |
| hsa-miR-150-3p | lung cancer | Apoptosis pathway | "Jumonji domain containing 2A predicts prognosis an ......" | 26498874 | Western blot; MTT assay |
| hsa-miR-150-3p | lung squamous cell cancer | Apoptosis pathway | "Down regulation of miR 150 induces cell proliferat ......" | 24532468 | |
| hsa-miR-150-3p | lymphoma | Apoptosis pathway | "The role of microRNA 150 as a tumor suppressor in ......" | 21502955 | |
| hsa-miR-150-3p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "We examined expression of miR-150 in ovarian cance ......" | 25986891 | Cell proliferation assay; Cell Proliferation Assay; Western blot |
| hsa-miR-150-3p | pancreatic cancer | Apoptosis pathway | "MiR 150 5p inhibits the proliferation and promoted ......" | 24246865 | |
| hsa-miR-150-3p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "A decrease in miR 150 regulates the malignancy of ......" | 25522282 | |
| hsa-miR-150-3p | sarcoma | Apoptosis pathway | "MicroRNA 150 Inhibits Cell Invasion and Migration ......" | 26361218 | Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-150-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-150-3p | B cell lymphoma | staging; differentiation; progression; poor survival | "A set of 11 miRNAs associated with the differentia ......" | 22936066 | |
| hsa-miR-150-3p | B cell lymphoma | malignant trasformation | "In this review we discuss miRNAs with essential fu ......" | 25541152 | |
| hsa-miR-150-3p | acute myeloid leukemia | progression | "Eradication of Acute Myeloid Leukemia with FLT3 Li ......" | 27280396 | |
| hsa-miR-150-3p | breast cancer | malignant trasformation | "miR 150 promotes human breast cancer growth and ma ......" | 24312495 | |
| hsa-miR-150-3p | breast cancer | drug resistance | "New miRNA-based drugs are also promising therapy f ......" | 26199650 | |
| hsa-miR-150-3p | cervical and endocervical cancer | poor survival; metastasis; progression | "microRNA 150 promotes cervical cancer cell growth ......" | 26715362 | Western blot; Flow cytometry; Luciferase |
| hsa-miR-150-3p | colon cancer | staging | "Microarray analyses of miRNAs in exosome-enriched ......" | 24705249 | |
| hsa-miR-150-3p | colorectal cancer | worse prognosis; poor survival; drug resistance; tumorigenesis | "miR 150 as a potential biomarker associated with p ......" | 22052060 | |
| hsa-miR-150-3p | colorectal cancer | cell migration | "MiR 150 5p suppresses colorectal cancer cell migra ......" | 25124610 | |
| hsa-miR-150-3p | colorectal cancer | progression | "miR 150 functions as a tumour suppressor in human ......" | 25230975 | |
| hsa-miR-150-3p | colorectal cancer | progression; staging | "Circulating miRNAs miR 34a and miR 150 associated ......" | 25924769 | |
| hsa-miR-150-3p | colorectal cancer | drug resistance | "Wnt/β catenin pathway transactivates microRNA 150 ......" | 27285761 | |
| hsa-miR-150-3p | esophageal cancer | worse prognosis; staging; metastasis; malignant trasformation | "MiR 150 is associated with poor prognosis in esoph ......" | 23013135 | |
| hsa-miR-150-3p | gastric cancer | tumorigenesis | "MiR 150 promotes gastric cancer proliferation by n ......" | 20067763 | Luciferase |
| hsa-miR-150-3p | glioblastoma | drug resistance | "An unbiased functional microRNA screen identified ......" | 27399532 | |
| hsa-miR-150-3p | liver cancer | poor survival | "microRNA 150 inhibits human CD133 positive liver c ......" | 22025269 | Western blot |
| hsa-miR-150-3p | liver cancer | worse prognosis; recurrence; poor survival | "This study was conducted to detect the application ......" | 26215970 | |
| hsa-miR-150-3p | liver cancer | metastasis; progression; tumorigenesis; worse prognosis | "MicroRNA 150 suppresses cell proliferation and met ......" | 26871477 | |
| hsa-miR-150-3p | lung cancer | worse prognosis | "Jumonji domain containing 2A predicts prognosis an ......" | 26498874 | Western blot; MTT assay |
| hsa-miR-150-3p | lung squamous cell cancer | staging; tumorigenesis; differentiation | "Expression of miR 150 and miR 3940 5p is reduced i ......" | 23228962 | |
| hsa-miR-150-3p | lung squamous cell cancer | metastasis | "Altered miR 143 and miR 150 expressions in periphe ......" | 24286416 | |
| hsa-miR-150-3p | lung squamous cell cancer | progression | "Down regulation of miR 150 induces cell proliferat ......" | 24532468 | |
| hsa-miR-150-3p | lung squamous cell cancer | worse prognosis; staging; metastasis | "Increased expression of microRNA 150 is associated ......" | 25755784 | |
| hsa-miR-150-3p | lymphoma | malignant trasformation | "The role of microRNA 150 as a tumor suppressor in ......" | 21502955 | |
| hsa-miR-150-3p | lymphoma | differentiation; staging | "Re expression of microRNA 150 induces EBV positive ......" | 23521217 | |
| hsa-miR-150-3p | lymphoma | staging; metastasis; cell migration | "MicroRNA 150 inhibits tumor invasion and metastasi ......" | 24385540 | |
| hsa-miR-150-3p | melanoma | metastasis | "Six microRNAs miR-9 miR-145 miR-150 miR-155 miR-20 ......" | 23863473 | |
| hsa-miR-150-3p | melanoma | staging; poor survival; recurrence | "We recently reported our array-based discovery of ......" | 25155861 | |
| hsa-miR-150-3p | ovarian cancer | metastasis; poor survival | "We analyzed the miRNA expression profiles of prima ......" | 23554878 | |
| hsa-miR-150-3p | ovarian cancer | metastasis; worse prognosis; staging; progression; poor survival | "MicroRNA 150 predicts a favorable prognosis in pat ......" | 25090005 | Luciferase |
| hsa-miR-150-3p | pancreatic cancer | malignant trasformation | "MicroRNA 150 directly targets MUC4 and suppresses ......" | 21983127 | |
| hsa-miR-150-3p | pancreatic cancer | tumorigenesis; poor survival; progression | "A decrease in miR 150 regulates the malignancy of ......" | 25522282 | |
| hsa-miR-150-3p | pancreatic cancer | worse prognosis; poor survival | "The aim of this study was to investigate microRNAs ......" | 25906450 | |
| hsa-miR-150-3p | pancreatic cancer | staging | "At 25 weeks the miRNA microarray analysis revealed ......" | 26516699 | |
| hsa-miR-150-3p | pancreatic cancer | cell migration | "Hypoxia promotes C X C chemokine receptor type 4 e ......" | 26622579 | Luciferase; Cell migration assay |
| hsa-miR-150-3p | prostate cancer | poor survival; metastasis; recurrence; tumor size | "miR 150 is a factor of survival in prostate cancer ......" | 25778313 | Western blot |
| hsa-miR-150-3p | prostate cancer | metastasis; recurrence; progression | "MIR 150 promotes prostate cancer stem cell develop ......" | 26636522 | Western blot; Luciferase |
| hsa-miR-150-3p | sarcoma | metastasis | "MicroRNA 150 Inhibits Cell Invasion and Migration ......" | 26361218 | Western blot; Luciferase |
Reported gene related to hsa-miR-150-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-150-3p | colorectal cancer | MYB | "miR 150 functions as a tumour suppressor in human ......" | 25230975 |
| hsa-miR-150-3p | liver cancer | MYB | "We also show that miR-150 interacts with the 3'UTR ......" | 22025269 |
| hsa-miR-150-3p | lymphoma | MYB | "Re expression of microRNA 150 induces EBV positive ......" | 23521217 |
| hsa-miR-150-3p | lymphoma | MYB | "Moreover IHC and western blotting defined that c-M ......" | 24613688 |
| hsa-miR-150-3p | pancreatic cancer | MYB | "The associations of miR-150 c-Myb and MUC4 express ......" | 25522282 |
| hsa-miR-150-3p | pancreatic cancer | MYB | "Furthermore the addition of the miRNA inhibitor 2' ......" | 23675407 |
| hsa-miR-150-3p | colorectal cancer | MUC4 | "MiR 150 5p suppresses colorectal cancer cell migra ......" | 25124610 |
| hsa-miR-150-3p | pancreatic cancer | MUC4 | "MicroRNA 150 directly targets MUC4 and suppresses ......" | 21983127 |
| hsa-miR-150-3p | pancreatic cancer | MUC4 | "The associations of miR-150 c-Myb and MUC4 express ......" | 25522282 |
| hsa-miR-150-3p | pancreatic cancer | MUC4 | "Treatment of pancreatic cancer cells with miR-150- ......" | 24971005 |
| hsa-miR-150-3p | gastric cancer | EGR2 | "MiR 150 promotes gastric cancer proliferation by n ......" | 20067763 |
| hsa-miR-150-3p | lung cancer | EGR2 | "Here we demonstrate that miR-150 is aberrantly upr ......" | 23747308 |
| hsa-miR-150-3p | lung cancer | TP53 | "miR 150 promotes the proliferation of lung cancer ......" | 23747308 |
| hsa-miR-150-3p | lung squamous cell cancer | TP53 | "miR-150 and miR-3940-5p were found to be significa ......" | 23228962 |
| hsa-miR-150-3p | esophageal cancer | ZEB1 | "MiR 150 is associated with poor prognosis in esoph ......" | 23013135 |
| hsa-miR-150-3p | ovarian cancer | ZEB1 | "MicroRNA 150 predicts a favorable prognosis in pat ......" | 25090005 |
| hsa-miR-150-3p | lung squamous cell cancer | BAK1 | "Down regulation of miR 150 induces cell proliferat ......" | 24532468 |
| hsa-miR-150-3p | cervical and endocervical cancer | BCL2L11 | "Several cell cycle- and apoptosis-related genes Cy ......" | 26715362 |
| hsa-miR-150-3p | lymphoma | CCR6 | "MicroRNA 150 inhibits tumor invasion and metastasi ......" | 24385540 |
| hsa-miR-150-3p | prostate cancer | CD44 | "MiR-150 expression in CD144 or CD44 positive prima ......" | 26636522 |
| hsa-miR-150-3p | prostate cancer | CDH5 | "MiR-150 expression in CD144 or CD44 positive prima ......" | 26636522 |
| hsa-miR-150-3p | prostate cancer | CDKN1B | "MIR 150 promotes prostate cancer stem cell develop ......" | 26636522 |
| hsa-miR-150-3p | pancreatic cancer | CEP290 | "Hypoxia promotes C X C chemokine receptor type 4 e ......" | 26622579 |
| hsa-miR-150-3p | colorectal cancer | CREB1 | "Wnt/β catenin pathway transactivates microRNA 150 ......" | 27285761 |
| hsa-miR-150-3p | cervical and endocervical cancer | FASLG | "Several cell cycle- and apoptosis-related genes Cy ......" | 26715362 |
| hsa-miR-150-3p | thyroid cancer | FLNA | "Kaplan-Meier and multivariate analysis showed a si ......" | 24443580 |
| hsa-miR-150-3p | acute myeloid leukemia | FLT3 | "Eradication of Acute Myeloid Leukemia with FLT3 Li ......" | 27280396 |
| hsa-miR-150-3p | acute myeloid leukemia | FLT3LG | "Eradication of Acute Myeloid Leukemia with FLT3 Li ......" | 27280396 |
| hsa-miR-150-3p | cervical and endocervical cancer | FOXO4 | "microRNA 150 promotes cervical cancer cell growth ......" | 26715362 |
| hsa-miR-150-3p | liver cancer | GAB1 | "MicroRNA 150 suppresses cell proliferation and met ......" | 26871477 |
| hsa-miR-150-3p | lung cancer | KDM4A | "Finally the relationship between JMJD2A and miR-15 ......" | 26498874 |
| hsa-miR-150-3p | prostate cancer | NANOG | "MiR-150 could directly target 3'UTR of p27 and dec ......" | 26636522 |
| hsa-miR-150-3p | prostate cancer | NES | "MiR-150 could directly target 3'UTR of p27 and dec ......" | 26636522 |
| hsa-miR-150-3p | breast cancer | P2RX7 | "miR 150 promotes human breast cancer growth and ma ......" | 24312495 |
| hsa-miR-150-3p | bladder cancer | PDCD4 | "miR 150 modulates cisplatin chemosensitivity and i ......" | 25287716 |
| hsa-miR-150-3p | pancreatic cancer | PPFIA3 | "Hypoxia promotes C X C chemokine receptor type 4 e ......" | 26622579 |
| hsa-miR-150-3p | lung cancer | PPP1R1A | "miR 150 promotes the proliferation and migration o ......" | 24456795 |
| hsa-miR-150-3p | sarcoma | SP1 | "A luciferase reporter assay displayed that miR-150 ......" | 26361218 |
| hsa-miR-150-3p | lung cancer | SRC | "miR 150 promotes the proliferation and migration o ......" | 24456795 |
| hsa-miR-150-3p | lung cancer | SRCIN1 | "Furthermore an inverse correlation between miR-150 ......" | 24456795 |
| hsa-miR-150-3p | lymphoma | TSPYL2 | "In this study we show that microRNA-150 miR-150 is ......" | 24385540 |
Expression profile in cancer corhorts:
