microRNA information: hsa-miR-181a-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-181a-3p | miRbase |
| Accession: | MIMAT0000270 | miRbase |
| Precursor name: | hsa-mir-181a-1 | miRbase |
| Precursor accession: | MI0000289 | miRbase |
| Symbol: | NA | HGNC |
| RefSeq ID: | NA | GenBank |
| Sequence: | ACCAUCGACCGUUGAUUGUACC |
Reported expression in cancers: hsa-miR-181a-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-181a-3p | acute myeloid leukemia | upregulation | "This paper evaluated the association between micro ......" | 25646775 | RNA-Seq |
| hsa-miR-181a-3p | acute myeloid leukemia | upregulation | "Targeting the RAS/MAPK pathway with miR 181a in ac ......" | 27517749 | |
| hsa-miR-181a-3p | breast cancer | downregulation | "Increased expression of three of the most promisin ......" | 18708351 | Reverse transcription PCR; qPCR |
| hsa-miR-181a-3p | breast cancer | upregulation | "This was mediated by the micro miRNA family miR-18 ......" | 21102523 | |
| hsa-miR-181a-3p | breast cancer | upregulation | "TGF β upregulates miR 181a expression to promote ......" | 23241956 | |
| hsa-miR-181a-3p | breast cancer | downregulation | "RNA was extracted reverse transcribed and subjecte ......" | 24498016 | Microarray |
| hsa-miR-181a-3p | breast cancer | deregulation | "The expression profiles of miR-9 miR-21 miR-30a mi ......" | 25013435 | Reverse transcription PCR |
| hsa-miR-181a-3p | cervical and endocervical cancer | downregulation | "miR-181a has been reported to participate in tumor ......" | 27534652 | |
| hsa-miR-181a-3p | colorectal cancer | upregulation | "Recent studies have shown that miR-181a is dysregu ......" | 23023298 | qPCR |
| hsa-miR-181a-3p | gastric cancer | upregulation | "miRNA expression was determined using a custom-des ......" | 22112324 | Microarray |
| hsa-miR-181a-3p | gastric cancer | upregulation | "Genetic polymorphism at miR 181a binding site cont ......" | 22971574 | Reverse transcription PCR; Microarray |
| hsa-miR-181a-3p | glioblastoma | deregulation | "In our study we examined by microarray the global ......" | 16039986 | Microarray |
| hsa-miR-181a-3p | head and neck cancer | deregulation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | qPCR; Microarray |
| hsa-miR-181a-3p | liver cancer | upregulation | "Here using a global microarray-based miRNA profili ......" | 19585654 | Reverse transcription PCR; Microarray |
| hsa-miR-181a-3p | liver cancer | upregulation | "We demonstrated that conserved let-7 and miR-181 f ......" | 21352471 | qPCR; Microarray |
| hsa-miR-181a-3p | liver cancer | upregulation | "Up-regulation of miR-15a miR-16 miR-27b miR-30b mi ......" | 24314246 | qPCR |
| hsa-miR-181a-3p | liver cancer | upregulation | "Recent studies have found that miR-181a were dysre ......" | 24529171 | qPCR |
| hsa-miR-181a-3p | liver cancer | upregulation | "miR 181a mediates TGF β induced hepatocyte EMT an ......" | 24576072 | |
| hsa-miR-181a-3p | lung squamous cell cancer | deregulation | "Locked nucleic acids miRNA microarray expression p ......" | 20508945 | Microarray |
| hsa-miR-181a-3p | lung squamous cell cancer | deregulation | "In this study we analyzed the global expression pr ......" | 25524579 | |
| hsa-miR-181a-3p | lymphoma | upregulation | "The major findings were: the detection of a panel ......" | 19945163 | |
| hsa-miR-181a-3p | pancreatic cancer | downregulation | "The in vivo effect of miR-181a down-regulation on ......" | 26152285 | |
| hsa-miR-181a-3p | prostate cancer | upregulation | "In the present study the expression of miR-181 in ......" | 25187843 | |
| hsa-miR-181a-3p | sarcoma | downregulation | "Here we profiled miRNA expression of chondrosarcom ......" | 23940002 | qPCR; Microarray |
| hsa-miR-181a-3p | sarcoma | upregulation | "The expression of miR 181a 5p and miR 371b 5p in c ......" | 26214773 |
Reported cancer pathway affected by hsa-miR-181a-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-181a-3p | acute myeloid leukemia | cell cycle pathway | "miR 181a promotes G1/S transition and cell prolife ......" | 26113450 | Flow cytometry; Luciferase |
| hsa-miR-181a-3p | breast cancer | Epithelial mesenchymal transition pathway | "TGF β upregulates miR 181a expression to promote ......" | 23241956 | |
| hsa-miR-181a-3p | breast cancer | Apoptosis pathway | "The function role of miR 181a in chemosensitivity ......" | 24335172 | Western blot; Luciferase |
| hsa-miR-181a-3p | breast cancer | Apoptosis pathway | "Here we show that genotoxic treatments significant ......" | 26028030 | |
| hsa-miR-181a-3p | cervical and endocervical cancer | Apoptosis pathway | "MiR 181a confers resistance of cervical cancer to ......" | 22847611 | |
| hsa-miR-181a-3p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway | "miR-181a has been reported to participate in tumor ......" | 27534652 | Western blot |
| hsa-miR-181a-3p | colorectal cancer | Epithelial mesenchymal transition pathway | "Expression profile was further assessed using quan ......" | 24755295 | Luciferase |
| hsa-miR-181a-3p | colorectal cancer | Apoptosis pathway; PI3K/Akt signaling pathway | "The emerging role of microRNA-181A miR-181A in CRC ......" | 26750720 | |
| hsa-miR-181a-3p | gastric cancer | Apoptosis pathway | "In order to identify miRNA signatures for gastric ......" | 22112324 | |
| hsa-miR-181a-3p | gastric cancer | Apoptosis pathway | "However it remains unknown whether miR-181a is inv ......" | 22581522 | Colony formation; Luciferase; Western blot |
| hsa-miR-181a-3p | gastric cancer | Apoptosis pathway | "Based on our previous experiments this study is to ......" | 24531888 | Western blot; Luciferase |
| hsa-miR-181a-3p | glioblastoma | Epithelial mesenchymal transition pathway | "We annotated 491 TCGA samples' miRNA expression pr ......" | 26283154 | |
| hsa-miR-181a-3p | liver cancer | Apoptosis pathway | "Functional analysis of miR 181a and Fas involved i ......" | 25449696 | |
| hsa-miR-181a-3p | lung cancer | Epithelial mesenchymal transition pathway | "The metastatic properties of the cells were assess ......" | 26323677 | Western blot; Cell migration assay; Wound Healing Assay; Luciferase |
| hsa-miR-181a-3p | lung squamous cell cancer | Apoptosis pathway | "In this study we analyzed the global expression pr ......" | 25524579 | |
| hsa-miR-181a-3p | lymphoma | Apoptosis pathway | "Bim down-regulation is posttranscriptionally regul ......" | 20841506 | |
| hsa-miR-181a-3p | prostate cancer | Apoptosis pathway | "MiR 181a contributes to bufalin induced apoptosis ......" | 24267199 | Western blot |
| hsa-miR-181a-3p | prostate cancer | cell cycle pathway | "In the present study the expression of miR-181 in ......" | 25187843 | |
| hsa-miR-181a-3p | retinoblastoma | cell cycle pathway | "Among them hsa-miR-373 hsa-miR-125b and hsa-miR-18 ......" | 26730174 | |
| hsa-miR-181a-3p | sarcoma | Apoptosis pathway | "MicroRNA 181a miR-181a was found dysregulated in a ......" | 23740615 | Western blot |
Reported cancer prognosis affected by hsa-miR-181a-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-181a-3p | B cell lymphoma | poor survival; progression | "We measured the expression of each miRNA by quanti ......" | 21525173 | |
| hsa-miR-181a-3p | acute myeloid leukemia | differentiation | "The major features of these profiles were upregula ......" | 18809607 | |
| hsa-miR-181a-3p | acute myeloid leukemia | poor survival | "Prognostic significance of expression of a single ......" | 21079133 | |
| hsa-miR-181a-3p | acute myeloid leukemia | worse prognosis | "Recently we showed that increased miR-181a express ......" | 23100311 | |
| hsa-miR-181a-3p | acute myeloid leukemia | differentiation | "MiR 181 family: regulators of myeloid differentiat ......" | 25174404 | |
| hsa-miR-181a-3p | acute myeloid leukemia | worse prognosis; differentiation; poor survival | "The pathological role and prognostic impact of miR ......" | 25686674 | |
| hsa-miR-181a-3p | breast cancer | recurrence; poor survival; worse prognosis | "MicroRNA microarray analysis was performed to comp ......" | 21271219 | |
| hsa-miR-181a-3p | breast cancer | staging | "Decreased serum miR 181a is a potential new tool f ......" | 22692639 | |
| hsa-miR-181a-3p | breast cancer | metastasis; staging; poor survival | "TGF β upregulates miR 181a expression to promote ......" | 23241956 | |
| hsa-miR-181a-3p | breast cancer | progression | "MicroRNA-181 miR-181 is a multifaceted miRNA that ......" | 23524334 | |
| hsa-miR-181a-3p | breast cancer | drug resistance | "MiR 181a enhances drug sensitivity in mitoxantone ......" | 23780685 | Luciferase |
| hsa-miR-181a-3p | breast cancer | tumorigenesis | "The function role of miR 181a in chemosensitivity ......" | 24335172 | Western blot; Luciferase |
| hsa-miR-181a-3p | breast cancer | metastasis | "The expression of miRNAs in patients with primary ......" | 24846313 | |
| hsa-miR-181a-3p | breast cancer | metastasis; poor survival; drug resistance | "Here we show that genotoxic treatments significant ......" | 26028030 | |
| hsa-miR-181a-3p | breast cancer | poor survival | "In this multicenter study a 10-miRNA classifier in ......" | 27566954 | |
| hsa-miR-181a-3p | cervical and endocervical cancer | drug resistance | "MiR 181a confers resistance of cervical cancer to ......" | 22847611 | |
| hsa-miR-181a-3p | cervical and endocervical cancer | progression | "miR-181a has been reported to participate in tumor ......" | 27534652 | Western blot |
| hsa-miR-181a-3p | colorectal cancer | poor survival; drug resistance; differentiation | "miR 181a is associated with poor clinical outcome ......" | 24098024 | |
| hsa-miR-181a-3p | colorectal cancer | metastasis; staging; poor survival; motility | "Expression profile was further assessed using quan ......" | 24755295 | Luciferase |
| hsa-miR-181a-3p | colorectal cancer | metastasis; poor survival | "The emerging role of microRNA-181A miR-181A in CRC ......" | 26750720 | |
| hsa-miR-181a-3p | colorectal cancer | tumorigenesis | "It was found that miR-181a may be involved in the ......" | 27264420 | Luciferase |
| hsa-miR-181a-3p | endometrial cancer | poor survival; tumorigenesis; worse prognosis; metastasis; progression | "The aberrant expression of human microRNA-181a-1 h ......" | 25733820 | |
| hsa-miR-181a-3p | gastric cancer | drug resistance | "In order to identify miRNA signatures for gastric ......" | 22112324 | |
| hsa-miR-181a-3p | gastric cancer | malignant trasformation | "However it remains unknown whether miR-181a is inv ......" | 22581522 | Colony formation; Luciferase; Western blot |
| hsa-miR-181a-3p | gastric cancer | worse prognosis | "Genetic polymorphism at miR 181a binding site cont ......" | 22971574 | Luciferase |
| hsa-miR-181a-3p | gastric cancer | staging; cell migration | "Here we show that miR-181a levels were significant ......" | 25706394 | |
| hsa-miR-181a-3p | gastric cancer | drug resistance | "MiR 181a suppresses autophagy and sensitizes gastr ......" | 26589846 | |
| hsa-miR-181a-3p | gastric cancer | drug resistance; progression | "Role of miR 27a miR 181a and miR 20b in gastric ca ......" | 26793992 | |
| hsa-miR-181a-3p | glioblastoma | malignant trasformation | "In our study we examined by microarray the global ......" | 16039986 | |
| hsa-miR-181a-3p | glioblastoma | tumorigenesis | "miR 181 subunits enhance the chemosensitivity of t ......" | 24573637 | |
| hsa-miR-181a-3p | glioblastoma | poor survival | "We annotated 491 TCGA samples' miRNA expression pr ......" | 26283154 | |
| hsa-miR-181a-3p | head and neck cancer | malignant trasformation | "A global miRNA profiling was performed on 12 sampl ......" | 21637912 | |
| hsa-miR-181a-3p | head and neck cancer | poor survival | "Our findings showed that significant elevated expr ......" | 25677760 | |
| hsa-miR-181a-3p | liver cancer | differentiation | "Here using a global microarray-based miRNA profili ......" | 19585654 | |
| hsa-miR-181a-3p | liver cancer | motility; drug resistance | "We evaluated the expression of microRNA in human H ......" | 21352471 | |
| hsa-miR-181a-3p | liver cancer | drug resistance | "The cell viability MTT assay was used to detect dr ......" | 23229111 | MTT assay |
| hsa-miR-181a-3p | liver cancer | worse prognosis | "Expression of serum microRNAs miR 222 miR 181 miR ......" | 24124720 | |
| hsa-miR-181a-3p | liver cancer | progression | "Recent studies have found that miR-181a were dysre ......" | 24529171 | Western blot; Luciferase; Colony formation |
| hsa-miR-181a-3p | liver cancer | drug resistance | "miR 181a mediates TGF β induced hepatocyte EMT an ......" | 24576072 | |
| hsa-miR-181a-3p | liver cancer | motility | "MiR 181a 5p is downregulated in hepatocellular car ......" | 25058462 | |
| hsa-miR-181a-3p | lung cancer | progression; drug resistance | "The metastatic properties of the cells were assess ......" | 26323677 | Western blot; Cell migration assay; Wound Healing Assay; Luciferase |
| hsa-miR-181a-3p | lung squamous cell cancer | worse prognosis; staging; poor survival | "Deregulated expression of miR 21 miR 143 and miR 1 ......" | 20363096 | |
| hsa-miR-181a-3p | lymphoma | poor survival | "Bim down-regulation is posttranscriptionally regul ......" | 20841506 | |
| hsa-miR-181a-3p | melanoma | metastasis | "Circulating T cell natural killer NK natural kille ......" | 24370793 | Flow cytometry |
| hsa-miR-181a-3p | ovarian cancer | recurrence; poor survival; drug resistance | "Here we show that miR-181a promotes TGF-β-mediate ......" | 24394555 | |
| hsa-miR-181a-3p | ovarian cancer | drug resistance | "MiR 181a upregulation is associated with epithelia ......" | 27249598 | Flow cytometry; MTT assay |
| hsa-miR-181a-3p | pancreatic cancer | cell migration | "LPS induced miR 181a promotes pancreatic cancer ce ......" | 24532253 | |
| hsa-miR-181a-3p | prostate cancer | progression | "In the present study the expression of miR-181 in ......" | 25187843 | |
| hsa-miR-181a-3p | retinoblastoma | metastasis | "Among them hsa-miR-373 hsa-miR-125b and hsa-miR-18 ......" | 26730174 | |
| hsa-miR-181a-3p | sarcoma | progression | "MicroRNA 181a miR-181a was found dysregulated in a ......" | 23740615 | Western blot |
| hsa-miR-181a-3p | sarcoma | metastasis; progression | "miR 181a Targets RGS16 to Promote Chondrosarcoma G ......" | 26013170 |
Reported gene related to hsa-miR-181a-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-181a-3p | cervical and endocervical cancer | PTEN | "From our results down-regulation of miR-181a incre ......" | 27534652 |
| hsa-miR-181a-3p | colon cancer | PTEN | "miR-181a performs this function by inhibiting the ......" | 24685694 |
| hsa-miR-181a-3p | colorectal cancer | PTEN | "The expression of PTEN was regulated by IL-1β-sti ......" | 27264420 |
| hsa-miR-181a-3p | colorectal cancer | PTEN | "The expression of miR-181A and PTEN in CRC patient ......" | 26750720 |
| hsa-miR-181a-3p | lung cancer | PTEN | "Luciferase assays were performed to assess the abi ......" | 26323677 |
| hsa-miR-181a-3p | pancreatic cancer | PTEN | "LPS induced miR 181a promotes pancreatic cancer ce ......" | 24532253 |
| hsa-miR-181a-3p | acute myeloid leukemia | ATM | "MiR 181a Promotes Proliferation of Human Acute Mye ......" | 27150990 |
| hsa-miR-181a-3p | acute myeloid leukemia | ATM | "miR 181a promotes G1/S transition and cell prolife ......" | 26113450 |
| hsa-miR-181a-3p | breast cancer | ATM | "Ataxia telangiectasia mutated ATM a target gene of ......" | 21102523 |
| hsa-miR-181a-3p | breast cancer | ATM | "We report that miR-181a and miR-181b were overexpr ......" | 23656790 |
| hsa-miR-181a-3p | gastric cancer | ATM | "Ataxia-telangiectasia mutation ATM was predicted a ......" | 24531888 |
| hsa-miR-181a-3p | breast cancer | BCL2 | "The function role of miR 181a in chemosensitivity ......" | 24335172 |
| hsa-miR-181a-3p | cervical and endocervical cancer | BCL2 | "In addition inhibition of miR-181a promoted apopto ......" | 27534652 |
| hsa-miR-181a-3p | lung squamous cell cancer | BCL2 | "Moreover we also found miR-181 reduction was assoc ......" | 25524579 |
| hsa-miR-181a-3p | prostate cancer | BCL2 | "Bufalin was found to induce the expression of miR- ......" | 24267199 |
| hsa-miR-181a-3p | sarcoma | BCL2 | "The results from Western blotting indicated that m ......" | 23740615 |
| hsa-miR-181a-3p | acute myeloid leukemia | KRAS | "Here we report that miR-181a directly binds to 3'- ......" | 27517749 |
| hsa-miR-181a-3p | colorectal cancer | KRAS | "The KRAS mutational status was determined by pyros ......" | 24098024 |
| hsa-miR-181a-3p | lung squamous cell cancer | KRAS | "MiR 181a 5p inhibits cell proliferation and migrat ......" | 26124189 |
| hsa-miR-181a-3p | breast cancer | BAX | "We further identified BAX as a direct functional t ......" | 26028030 |
| hsa-miR-181a-3p | cervical and endocervical cancer | BAX | "In addition inhibition of miR-181a promoted apopto ......" | 27534652 |
| hsa-miR-181a-3p | breast cancer | BCL2L11 | "Mechanistically inactivation of miR-181a elevated ......" | 23241956 |
| hsa-miR-181a-3p | lymphoma | BCL2L11 | "Furthermore we found that cell adhesion-up-regulat ......" | 20841506 |
| hsa-miR-181a-3p | breast cancer | IL6 | "The upregulation of miR-181a was orchestrated by t ......" | 26028030 |
| hsa-miR-181a-3p | liver cancer | IL6 | "Knocking down IL-6 and Twist in HSCs significantly ......" | 21352471 |
| hsa-miR-181a-3p | sarcoma | VEGFA | "miR-181a is overexpressed in high-grade chondrosar ......" | 26013170 |
| hsa-miR-181a-3p | sarcoma | VEGFA | "miR-181a transfection of JJ cells doubled expressi ......" | 25106798 |
| hsa-miR-181a-3p | ovarian cancer | ABCB1 | "SKOV3 cells had increased P-gp expression after en ......" | 27249598 |
| hsa-miR-181a-3p | breast cancer | ABCG2 | "Luciferase activity assay showed that miR-181a mim ......" | 23780685 |
| hsa-miR-181a-3p | gastric cancer | ATG5 | "Then we indicated that ATG5 was a potential target ......" | 26589846 |
| hsa-miR-181a-3p | prostate cancer | CASP3 | "In prostate cancer PC-3cell line bufalin-induced a ......" | 24267199 |
| hsa-miR-181a-3p | colorectal cancer | CDH1 | "Ectopic expression of miR-181a suppressed the epit ......" | 24755295 |
| hsa-miR-181a-3p | ovarian cancer | CDH2 | "SKOV3/PTX cells had significantly higher expressio ......" | 27249598 |
| hsa-miR-181a-3p | acute myeloid leukemia | CEBPA | "Interestingly miR-181a expression was increased in ......" | 23100311 |
| hsa-miR-181a-3p | sarcoma | CXCR4 | "These data establish miR-181a as an oncomiR that p ......" | 26013170 |
| hsa-miR-181a-3p | liver cancer | E2F5 | "Mechanism investigation revealed that miR-181a inh ......" | 24529171 |
| hsa-miR-181a-3p | colorectal cancer | EGF | "However the role of miR-181a expression in CRC and ......" | 24098024 |
| hsa-miR-181a-3p | colorectal cancer | EGFR | "miR 181a is associated with poor clinical outcome ......" | 24098024 |
| hsa-miR-181a-3p | liver cancer | FAS | "Functional analysis of miR 181a and Fas involved i ......" | 25449696 |
| hsa-miR-181a-3p | sarcoma | FBXW11 | "First the expression of miR-181a in osteosarcoma c ......" | 23740615 |
| hsa-miR-181a-3p | cervical and endocervical cancer | FOXO1 | "From our results down-regulation of miR-181a incre ......" | 27534652 |
| hsa-miR-181a-3p | gastric cancer | KLF6 | "Site-directed mutagenesis and luciferase reporter ......" | 22581522 |
| hsa-miR-181a-3p | prostate cancer | LEF1 | "LEF1 targeting EMT in prostate cancer invasion is ......" | 26045991 |
| hsa-miR-181a-3p | pancreatic cancer | MAP2K4 | "LPS induced miR 181a promotes pancreatic cancer ce ......" | 24532253 |
| hsa-miR-181a-3p | liver cancer | MET | "MiR 181a 5p is downregulated in hepatocellular car ......" | 25058462 |
| hsa-miR-181a-3p | sarcoma | MMP9 | "The results from Western blotting indicated that m ......" | 23740615 |
| hsa-miR-181a-3p | gastric cancer | MTMR3 | "We further demonstrated that the rs12537CT genotyp ......" | 22971574 |
| hsa-miR-181a-3p | breast cancer | MX1 | "Overexpression of miR-181a down-regulated BCRP exp ......" | 23780685 |
| hsa-miR-181a-3p | acute myeloid leukemia | NPM1 | "The impact of miR-181a was most striking in poor m ......" | 21079133 |
| hsa-miR-181a-3p | acute myeloid leukemia | NRAS | "Here we report that miR-181a directly binds to 3'- ......" | 27517749 |
| hsa-miR-181a-3p | breast cancer | PGR | "In addition a transcriptome analysis revealed that ......" | 19826037 |
| hsa-miR-181a-3p | breast cancer | PLAU | "uPA mRNA was a direct target of miR-193a/b and miR ......" | 21779487 |
| hsa-miR-181a-3p | cervical and endocervical cancer | PRKCD | "MiR 181a confers resistance of cervical cancer to ......" | 22847611 |
| hsa-miR-181a-3p | gastric cancer | PROX1 | "In addition the ectopic expression of miR-181a in ......" | 25706394 |
| hsa-miR-181a-3p | chronic myeloid leukemia | RALA | "The delivery of miR-181a specifically inhibited th ......" | 26554155 |
| hsa-miR-181a-3p | glioblastoma | RAP1B | "miR 181 subunits enhance the chemosensitivity of t ......" | 24573637 |
| hsa-miR-181a-3p | colorectal cancer | RELA | "The expression levels of IL-1β NF-κB RelA and mi ......" | 27264420 |
| hsa-miR-181a-3p | sarcoma | RGS16 | "miR 181a Targets RGS16 to Promote Chondrosarcoma G ......" | 26013170 |
| hsa-miR-181a-3p | ovarian cancer | SMAD2 | "Here we show that miR-181a promotes TGF-β-mediate ......" | 24394555 |
| hsa-miR-181a-3p | ovarian cancer | SMAD7 | "Here we show that miR-181a promotes TGF-β-mediate ......" | 24394555 |
| hsa-miR-181a-3p | breast cancer | STAT3 | "The upregulation of miR-181a was orchestrated by t ......" | 26028030 |
| hsa-miR-181a-3p | thyroid cancer | THRB | "We observed lower levels of THRB transcripts in ce ......" | 21159845 |
| hsa-miR-181a-3p | liver cancer | TNF | "TNF receptor superfamily member 6 Fas was further ......" | 25449696 |
| hsa-miR-181a-3p | pancreatic cancer | TNFAIP1 | "Targeting of miR-181a on TNFAIP1 in pancreatic can ......" | 26152285 |
| hsa-miR-181a-3p | endometrial cancer | TRGV9 | "To predict the targets of hsa-miR-181a ten differe ......" | 25733820 |
| hsa-miR-181a-3p | liver cancer | TWIST1 | "Knocking down IL-6 and Twist in HSCs significantly ......" | 21352471 |
| hsa-miR-181a-3p | colorectal cancer | VIM | "Ectopic expression of miR-181a suppressed the epit ......" | 24755295 |
| hsa-miR-181a-3p | colorectal cancer | WIF1 | "Additionally we identified WIF-1 as direct and fun ......" | 24755295 |
Expression profile in cancer corhorts:
