microRNA information: hsa-miR-196a-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-196a-5p | miRbase |
Accession: | MIMAT0000226 | miRbase |
Precursor name: | hsa-mir-196a-1 | miRbase |
Precursor accession: | MI0000238 | miRbase |
Symbol: | MIR196A1 | HGNC |
RefSeq ID: | NR_029582 | GenBank |
Sequence: | UAGGUAGUUUCAUGUUGUUGGG |
Reported expression in cancers: hsa-miR-196a-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-196a-5p | breast cancer | upregulation | "Then five up-regulated miRNAs miR-100 miR-29a miR- ......" | 23994196 | |
hsa-miR-196a-5p | cervical and endocervical cancer | upregulation | "The expression of miR-196a in cervical cancer cell ......" | 24423924 | qPCR |
hsa-miR-196a-5p | cervical and endocervical cancer | upregulation | "Clinical significance of serum miR 196a in cervica ......" | 26782446 | Reverse transcription PCR |
hsa-miR-196a-5p | colon cancer | upregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
hsa-miR-196a-5p | colorectal cancer | upregulation | "Upregulation of microRNA 196a and microRNA 196b co ......" | 25525411 | qPCR |
hsa-miR-196a-5p | gastric cancer | upregulation | "In the analysis by real-time PCR-based miRNA array ......" | 22407237 | qPCR; Microarray |
hsa-miR-196a-5p | gastric cancer | upregulation | "Association of miR 193b down regulation and miR 19 ......" | 25374225 | qPCR; Microarray |
hsa-miR-196a-5p | gastric cancer | upregulation | "Clinical significance of upregulation of mir 196a ......" | 25773825 | qPCR |
hsa-miR-196a-5p | gastric cancer | upregulation | "miR-196a and/or miR-196b involved in cancer initia ......" | 27420607 | qPCR |
hsa-miR-196a-5p | glioblastoma | upregulation | "Recent studies have revealed that miR-196a is upre ......" | 24463357 | qPCR |
hsa-miR-196a-5p | head and neck cancer | upregulation | "MicroRNA miRNA expression profiling of a panel of ......" | 25523631 | |
hsa-miR-196a-5p | kidney renal cell cancer | downregulation | "Meanwhile the rs11614913 CC genotype was associate ......" | 24681820 | |
hsa-miR-196a-5p | liver cancer | upregulation | "Compared with the matched NT tissues 9 miRNAs were ......" | 24273923 | |
hsa-miR-196a-5p | melanoma | downregulation | "Resulting from a screening for microRNAs different ......" | 21077158 | |
hsa-miR-196a-5p | ovarian cancer | upregulation | "Increased expression of microRNA 196a predicts poo ......" | 26097603 | qPCR |
hsa-miR-196a-5p | pancreatic cancer | upregulation | "Profiling of 95 microRNAs in pancreatic cancer cel ......" | 19030927 | qPCR |
hsa-miR-196a-5p | pancreatic cancer | downregulation | "Four miRNAs miR-17-5p miR-21 miR-155 and miR-196a ......" | 24007214 | |
hsa-miR-196a-5p | sarcoma | upregulation | "miR 196a expression in human and canine osteosarco ......" | 25599934 |
Reported cancer pathway affected by hsa-miR-196a-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-196a-5p | bladder cancer | Apoptosis pathway | "Long non coding RNA UCA1 promotes cisplatin/gemcit ......" | 27591936 | |
hsa-miR-196a-5p | colorectal cancer | PI3K/Akt signaling pathway; Apoptosis pathway | "High miR 196a levels promote the oncogenic phenoty ......" | 19418581 | |
hsa-miR-196a-5p | endometrial cancer | cell cycle pathway | "Integrated microRNA and mRNA transcriptome sequenc ......" | 25329664 | |
hsa-miR-196a-5p | esophageal cancer | cell cycle pathway | "Inhibition of miR 196a affects esophageal cancer c ......" | 27621035 | |
hsa-miR-196a-5p | gastric cancer | cell cycle pathway | "MiR 196a is upregulated in gastric cancer and prom ......" | 22343731 | Colony formation; Western blot; Luciferase |
hsa-miR-196a-5p | gastric cancer | Epithelial mesenchymal transition pathway | "Aberrant expression of miR 196a in gastric cancers ......" | 22420029 | |
hsa-miR-196a-5p | glioblastoma | Apoptosis pathway | "MiR 196a exerts its oncogenic effect in glioblasto ......" | 24463357 | Luciferase |
hsa-miR-196a-5p | lung squamous cell cancer | Apoptosis pathway | "Inhibition of microRNA 196a might reverse cisplati ......" | 26376998 | Flow cytometry; Western blot |
hsa-miR-196a-5p | pancreatic cancer | Apoptosis pathway | "Aberrant expression miR 196a is associated with ab ......" | 24048456 |
Reported cancer prognosis affected by hsa-miR-196a-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-196a-5p | bladder cancer | drug resistance | "Long non coding RNA UCA1 promotes cisplatin/gemcit ......" | 27591936 | |
hsa-miR-196a-5p | breast cancer | metastasis; cell migration | "Enforced expression of miR-196a1/2 or miR-196b abr ......" | 20736365 | |
hsa-miR-196a-5p | breast cancer | drug resistance | "In present study miRNA expression profiles of MCF- ......" | 23994196 | |
hsa-miR-196a-5p | breast cancer | progression; tumorigenesis | "MicroRNA 196a post transcriptionally upregulates t ......" | 26062455 | |
hsa-miR-196a-5p | cervical and endocervical cancer | malignant trasformation; tumorigenesis | "miR 196a targets netrin 4 and regulates cell proli ......" | 24120501 | Western blot |
hsa-miR-196a-5p | cervical and endocervical cancer | staging; poor survival; recurrence | "MicroRNA 196a promotes cervical cancer proliferati ......" | 24423924 | Luciferase; Colony formation |
hsa-miR-196a-5p | cervical and endocervical cancer | staging; metastasis; tumor size; poor survival; progression; worse prognosis | "Clinical significance of serum miR 196a in cervica ......" | 26782446 | |
hsa-miR-196a-5p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
hsa-miR-196a-5p | colorectal cancer | metastasis | "High miR 196a levels promote the oncogenic phenoty ......" | 19418581 | |
hsa-miR-196a-5p | colorectal cancer | progression; worse prognosis; tumorigenesis; differentiation; staging; metastasis; poor survival | "Upregulation of microRNA 196a and microRNA 196b co ......" | 25525411 | |
hsa-miR-196a-5p | endometrial cancer | staging | "Integrated microRNA and mRNA transcriptome sequenc ......" | 25329664 | |
hsa-miR-196a-5p | esophageal cancer | metastasis | "MiR 196a binding site SNP regulates RAP1A expressi ......" | 22859270 | Luciferase |
hsa-miR-196a-5p | esophageal cancer | progression; tumorigenesis | "Inhibition of miR 196a affects esophageal cancer c ......" | 27621035 | |
hsa-miR-196a-5p | gastric cancer | staging; poor survival; tumor size; progression; tumorigenesis | "MiR 196a is upregulated in gastric cancer and prom ......" | 22343731 | Colony formation; Western blot; Luciferase |
hsa-miR-196a-5p | gastric cancer | recurrence; progression | "Aberrant expression of miR 196a in gastric cancers ......" | 22420029 | |
hsa-miR-196a-5p | gastric cancer | worse prognosis; staging; metastasis; differentiation; poor survival | "Association of miR 193b down regulation and miR 19 ......" | 25374225 | |
hsa-miR-196a-5p | gastric cancer | staging; metastasis | "Clinical significance of upregulation of mir 196a ......" | 25773825 | |
hsa-miR-196a-5p | gastric cancer | progression | "miR-196a and/or miR-196b involved in cancer initia ......" | 27420607 | |
hsa-miR-196a-5p | glioblastoma | malignant trasformation; poor survival; progression | "In this study we examined the expression levels of ......" | 20601442 | |
hsa-miR-196a-5p | head and neck cancer | worse prognosis | "Mature microRNA sequence polymorphism in MIR196A2 ......" | 20501619 | |
hsa-miR-196a-5p | head and neck cancer | drug resistance; poor survival; worse prognosis | "MicroRNA 196a promotes an oncogenic effect in head ......" | 25523631 | Western blot; Luciferase |
hsa-miR-196a-5p | head and neck cancer | malignant trasformation; cell migration | "The role of HOXB9 and miR 196a in head and neck sq ......" | 25860510 | Luciferase |
hsa-miR-196a-5p | liver cancer | recurrence; tumor size | "Donor miR 196a 2 polymorphism is associated with h ......" | 26365437 | |
hsa-miR-196a-5p | lung cancer | poor survival | "Recently we conducted a survey of common single nu ......" | 19293314 | |
hsa-miR-196a-5p | lung cancer | worse prognosis | "In this study the miRNAs were detected in normal a ......" | 27247934 | |
hsa-miR-196a-5p | lung squamous cell cancer | poor survival | "Genetic variants of miRNA sequences and non small ......" | 18521189 | |
hsa-miR-196a-5p | lung squamous cell cancer | progression; cell migration; staging; metastasis | "MicroRNA 196a promotes non small cell lung cancer ......" | 22876840 | Colony formation; Transwell assay; Western blot; Luciferase; RNAi |
hsa-miR-196a-5p | lung squamous cell cancer | drug resistance | "Inhibition of microRNA 196a might reverse cisplati ......" | 26376998 | Flow cytometry; Western blot |
hsa-miR-196a-5p | melanoma | malignant trasformation | "MicroRNA miR 196a is a central regulator of HOX B7 ......" | 20480203 | |
hsa-miR-196a-5p | melanoma | malignant trasformation; progression | "MicroRNA miR 196a controls melanoma associated gen ......" | 21077158 | Luciferase |
hsa-miR-196a-5p | ovarian cancer | worse prognosis; progression; staging; metastasis; tumor size; poor survival | "Increased expression of microRNA 196a predicts poo ......" | 26097603 | |
hsa-miR-196a-5p | ovarian cancer | cell migration | "miR-196a expression was evaluated with reverse tra ......" | 26870188 | |
hsa-miR-196a-5p | pancreatic cancer | poor survival | "Aberrant expression miR 196a is associated with ab ......" | 24048456 | |
hsa-miR-196a-5p | pancreatic cancer | progression; metastasis | "MiR 196a promotes pancreatic cancer progression by ......" | 24504166 | Luciferase |
hsa-miR-196a-5p | sarcoma | worse prognosis; metastasis; recurrence; poor survival | "Combined elevation of microRNA 196a and microRNA 1 ......" | 24747591 | |
hsa-miR-196a-5p | sarcoma | drug resistance; cell migration; motility | "miR 196a expression in human and canine osteosarco ......" | 25599934 |
Reported gene related to hsa-miR-196a-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-196a-5p | bladder cancer | CDKN1B | "miR-196a-5p induction is involved in UCA1 inhibiti ......" | 27591936 |
hsa-miR-196a-5p | bladder cancer | CDKN1B | "We selected 8 candidate miRNAs associated with UCA ......" | 26820254 |
hsa-miR-196a-5p | cervical and endocervical cancer | CDKN1B | "MicroRNA 196a promotes cervical cancer proliferati ......" | 24423924 |
hsa-miR-196a-5p | gastric cancer | CDKN1B | "MiR 196a is upregulated in gastric cancer and prom ......" | 22343731 |
hsa-miR-196a-5p | breast cancer | ANXA1 | "ANXA1 was previously shown to be regulated by hsa- ......" | 25536365 |
hsa-miR-196a-5p | breast cancer | ANXA1 | "ANXA1 inhibits the biogenesis of oncogenic miR-196 ......" | 27105503 |
hsa-miR-196a-5p | head and neck cancer | ANXA1 | "MicroRNA 196a promotes an oncogenic effect in head ......" | 25523631 |
hsa-miR-196a-5p | cervical and endocervical cancer | FOXO1 | "MicroRNA 196a promotes cervical cancer proliferati ......" | 24423924 |
hsa-miR-196a-5p | liver cancer | FOXO1 | "HCV core protein induced upregulation of microRNA ......" | 27108614 |
hsa-miR-196a-5p | lymphoma | HOXB7 | "This included NFκB1 and hsa-miR-9 hsa-miR-196a-1 ......" | 24145479 |
hsa-miR-196a-5p | pancreatic cancer | HOXB7 | "A further 16 significant differentially-expressed ......" | 24137477 |
hsa-miR-196a-5p | breast cancer | HOXC8 | "We found that miR-196 inhibited the expression of ......" | 20736365 |
hsa-miR-196a-5p | cervical and endocervical cancer | HOXC8 | "The most over-expressed was miR-196a which was eva ......" | 24817935 |
hsa-miR-196a-5p | esophageal cancer | PCNA | "Inhibition of miR-196a also altered cell cycle pro ......" | 27621035 |
hsa-miR-196a-5p | pancreatic cancer | PCNA | "Furthermore down-regulation of miR-196a in PANC-1 ......" | 24504166 |
hsa-miR-196a-5p | bladder cancer | UCA1 | "Long non coding RNA UCA1 promotes cisplatin/gemcit ......" | 27591936 |
hsa-miR-196a-5p | bladder cancer | UCA1 | "We selected 8 candidate miRNAs associated with UCA ......" | 26820254 |
hsa-miR-196a-5p | esophageal cancer | ABCG2 | "ABCG2 which was highly expressed in untransfected ......" | 27621035 |
hsa-miR-196a-5p | pancreatic cancer | APC | "The combination of miR-196a and -196b may be a pro ......" | 24956938 |
hsa-miR-196a-5p | melanoma | BMP4 | "MicroRNA miR 196a is a central regulator of HOX B7 ......" | 20480203 |
hsa-miR-196a-5p | esophageal cancer | CCNB1 | "Inhibition of miR-196a also altered cell cycle pro ......" | 27621035 |
hsa-miR-196a-5p | pancreatic cancer | CCND1 | "Furthermore down-regulation of miR-196a in PANC-1 ......" | 24504166 |
hsa-miR-196a-5p | acute myeloid leukemia | CD33 | "In T-ALL patients miR-196a and miR-196b expression ......" | 20570349 |
hsa-miR-196a-5p | acute myeloid leukemia | CD34 | "In T-ALL patients miR-196a and miR-196b expression ......" | 20570349 |
hsa-miR-196a-5p | melanoma | CD80 | "MicroRNA miR 196a is a central regulator of HOX B7 ......" | 20480203 |
hsa-miR-196a-5p | melanoma | CDCA3 | "MicroRNA miR 196a controls melanoma associated gen ......" | 21077158 |
hsa-miR-196a-5p | acute myeloid leukemia | CEBPA | "In contrast CEBPA mutated cases had a low expressi ......" | 21818844 |
hsa-miR-196a-5p | bladder cancer | CREB1 | "Long non coding RNA UCA1 promotes cisplatin/gemcit ......" | 27591936 |
hsa-miR-196a-5p | acute myeloid leukemia | ERG | "The role of microRNA 196a and microRNA 196b as ERG ......" | 20570349 |
hsa-miR-196a-5p | melanoma | ETS1 | "In detail strongly reduced expression of the micro ......" | 20480203 |
hsa-miR-196a-5p | melanoma | FGF2 | "In detail strongly reduced expression of the micro ......" | 20480203 |
hsa-miR-196a-5p | head and neck cancer | FN1 | "Knock-down of miR-196a expression decreased HNSCC ......" | 25860510 |
hsa-miR-196a-5p | head and neck cancer | H2AFX | "Importantly overexpression of miR-196a increased r ......" | 25523631 |
hsa-miR-196a-5p | lung squamous cell cancer | HOXA5 | "MicroRNA 196a promotes non small cell lung cancer ......" | 22876840 |
hsa-miR-196a-5p | head and neck cancer | HOXB9 | "The role of HOXB9 and miR 196a in head and neck sq ......" | 25860510 |
hsa-miR-196a-5p | pancreatic cancer | ING5 | "Then we explored the regulation of inhibitor of gr ......" | 24048456 |
hsa-miR-196a-5p | acute myeloid leukemia | KMT2A | "High miR-196a and -b expression was observed in pa ......" | 21818844 |
hsa-miR-196a-5p | head and neck cancer | MAMDC2 | "We confirmed that MAMDC2 is a novel miR-196a targe ......" | 25860510 |
hsa-miR-196a-5p | breast cancer | MYC | "ANXA1 inhibits the biogenesis of oncogenic miR-196 ......" | 27105503 |
hsa-miR-196a-5p | pancreatic cancer | NFKBIA | "Here we investigated the expression pattern and th ......" | 24504166 |
hsa-miR-196a-5p | acute myeloid leukemia | NPM1 | "High miR-196a and -b expression was observed in pa ......" | 21818844 |
hsa-miR-196a-5p | cervical and endocervical cancer | NTN4 | "miR 196a targets netrin 4 and regulates cell proli ......" | 24120501 |
hsa-miR-196a-5p | cervical and endocervical cancer | PDXP | "However whether serum miR-196a is increased in pat ......" | 26782446 |
hsa-miR-196a-5p | pancreatic cancer | PTPRN2 | "The combination of miR-196a and -196b may be a pro ......" | 24956938 |
hsa-miR-196a-5p | esophageal cancer | RAP1A | "MiR 196a binding site SNP regulates RAP1A expressi ......" | 22859270 |
hsa-miR-196a-5p | lymphoma | RTEL1 | "Our findings suggest that the miR-196a2 polymorphi ......" | 25501512 |
hsa-miR-196a-5p | gastric cancer | THBS1 | "Using the TSP algorithm hsa-miR-196a and hsa-miR-1 ......" | 24527072 |
hsa-miR-196a-5p | lung squamous cell cancer | TIMM8A | "We aimed to explore the possible mechanism of micr ......" | 26376998 |
hsa-miR-196a-5p | breast cancer | UBE2C | "MicroRNA 196a post transcriptionally upregulates t ......" | 26062455 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-196a-5p | PDCD4 | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; PAAD; SARC; UCEC | miRNAWalker2 validate | TCGA BLCA -0.052; TCGA CESC -0.062; TCGA ESCA -0.09; TCGA HNSC -0.098; TCGA KIRC -0.07; TCGA KIRP -0.157; TCGA PAAD -0.079; TCGA SARC -0.079; TCGA UCEC -0.051 |
hsa-miR-196a-5p | PBX1 | 9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; PAAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.149; TCGA COAD -0.125; TCGA ESCA -0.137; TCGA HNSC -0.132; TCGA KIRC -0.295; TCGA PAAD -0.08; TCGA SARC -0.147; TCGA STAD -0.152; TCGA UCEC -0.05 |
hsa-miR-196a-5p | PLN | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; SARC; STAD | MirTarget | TCGA BLCA -0.245; TCGA BRCA -0.088; TCGA CESC -0.271; TCGA COAD -0.608; TCGA ESCA -0.5; TCGA HNSC -0.31; TCGA LUSC -0.189; TCGA PAAD -0.144; TCGA SARC -0.33; TCGA STAD -0.423 |
hsa-miR-196a-5p | GPRASP1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.177; TCGA BRCA -0.073; TCGA CESC -0.087; TCGA COAD -0.275; TCGA ESCA -0.229; TCGA HNSC -0.11; TCGA KIRC -0.207; TCGA PAAD -0.239; TCGA STAD -0.23; TCGA UCEC -0.113 |
hsa-miR-196a-5p | NTN4 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.16; TCGA BRCA -0.1; TCGA COAD -0.108; TCGA ESCA -0.124; TCGA HNSC -0.073; TCGA LUAD -0.067; TCGA LUSC -0.168; TCGA STAD -0.124; TCGA UCEC -0.063 |
hsa-miR-196a-5p | HLF | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD | miRNATAP | TCGA BLCA -0.118; TCGA CESC -0.235; TCGA COAD -0.146; TCGA ESCA -0.34; TCGA HNSC -0.276; TCGA LUAD -0.126; TCGA LUSC -0.176; TCGA PAAD -0.331; TCGA STAD -0.354 |
hsa-miR-196a-5p | PPP1R12B | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; SARC; STAD | miRNATAP | TCGA BLCA -0.199; TCGA BRCA -0.071; TCGA CESC -0.13; TCGA COAD -0.282; TCGA ESCA -0.258; TCGA HNSC -0.161; TCGA KIRC -0.256; TCGA LUSC -0.107; TCGA PAAD -0.088; TCGA SARC -0.286; TCGA STAD -0.256 |
hsa-miR-196a-5p | COL14A1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.141; TCGA CESC -0.168; TCGA COAD -0.369; TCGA ESCA -0.238; TCGA HNSC -0.111; TCGA KIRC -0.336; TCGA LUSC -0.071; TCGA PAAD -0.203; TCGA STAD -0.162; TCGA UCEC -0.12 |
hsa-miR-196a-5p | ERG | 9 cancers: BRCA; CESC; COAD; ESCA; LUSC; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.066; TCGA CESC -0.108; TCGA COAD -0.269; TCGA ESCA -0.092; TCGA LUSC -0.181; TCGA PAAD -0.179; TCGA PRAD -0.218; TCGA STAD -0.074; TCGA UCEC -0.062 |
Enriched cancer pathways of putative targets