microRNA information: hsa-miR-199a-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-199a-3p | miRbase |
Accession: | MIMAT0000232 | miRbase |
Precursor name: | hsa-mir-199a-1 | miRbase |
Precursor accession: | MI0000242 | miRbase |
Symbol: | MIR199A1 | HGNC |
RefSeq ID: | NR_029586 | GenBank |
Sequence: | ACAGUAGUCUGCACAUUGGUUA |
Reported expression in cancers: hsa-miR-199a-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-199a-3p | B cell lymphoma | upregulation | "miR 199a and miR 497 Are Associated with Better Ov ......" | 26251897 | |
hsa-miR-199a-3p | acute myeloid leukemia | deregulation | "After background subtraction and normalization usi ......" | 18187662 | Microarray; qPCR |
hsa-miR-199a-3p | bladder cancer | deregulation | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | qPCR |
hsa-miR-199a-3p | bladder cancer | deregulation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | qPCR; Microarray |
hsa-miR-199a-3p | colon cancer | upregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
hsa-miR-199a-3p | colorectal cancer | upregulation | "Aberrant expression of miR 199a 3p and its clinica ......" | 23292866 | |
hsa-miR-199a-3p | colorectal cancer | upregulation | "Circulating miR 199a 3p as a novel serum biomarker ......" | 25269744 | Microarray; qPCR |
hsa-miR-199a-3p | gastric cancer | upregulation | "Using real-time reverse-transcriptase RT-polymeras ......" | 21048306 | |
hsa-miR-199a-3p | gastric cancer | upregulation | "Here we report that miR-199a-3p was significantly ......" | 25448600 | |
hsa-miR-199a-3p | gastric cancer | upregulation | "Plasma samples from 3 independent groups comprise ......" | 26607322 | Microarray |
hsa-miR-199a-3p | kidney renal cell cancer | downregulation | "Association of miR 199a expression with clinicopat ......" | 23174576 | qPCR |
hsa-miR-199a-3p | liver cancer | downregulation | "Previous work by us and others reported decreased ......" | 21055388 | |
hsa-miR-199a-3p | liver cancer | downregulation | "microRNA-199a miR-199a is a highly conserved miRNA ......" | 21847633 | Microarray; qPCR |
hsa-miR-199a-3p | ovarian cancer | downregulation | "The conglomeration of diagnostic prognostic and th ......" | 26951510 | qPCR |
hsa-miR-199a-3p | prostate cancer | downregulation | "Moreover we demonstrate that down-regulation of mi ......" | 24631181 | |
hsa-miR-199a-3p | sarcoma | upregulation | "We performed a miRNA microarray analysis by detect ......" | 25266797 | Microarray; Reverse transcription PCR; qPCR |
Reported cancer pathway affected by hsa-miR-199a-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-199a-3p | B cell lymphoma | Apoptosis pathway | "miR 199a and miR 497 Are Associated with Better Ov ......" | 26251897 | |
hsa-miR-199a-3p | colorectal cancer | Apoptosis pathway | "Aberrant expression of miR 199a 3p and its clinica ......" | 23292866 | Flow cytometry |
hsa-miR-199a-3p | colorectal cancer | Apoptosis pathway; cell cycle pathway | "A critical role of mir 199a in the cell biological ......" | 26065676 | |
hsa-miR-199a-3p | endometrial cancer | cell cycle pathway; Apoptosis pathway | "Abnormal expression of miR-199a-3p which has simil ......" | 23851675 | Western blot; Luciferase |
hsa-miR-199a-3p | gastric cancer | Apoptosis pathway | "MiR 199a 3p promotes gastric cancer progression by ......" | 25448600 | |
hsa-miR-199a-3p | liver cancer | Apoptosis pathway | "The techniques used were the MTT assay flow cytome ......" | 23319430 | Flow cytometry; MTT assay |
hsa-miR-199a-3p | melanoma | Epithelial mesenchymal transition pathway | "An exploratory miRNA analysis of 666 miRs by low d ......" | 20302635 | |
hsa-miR-199a-3p | ovarian cancer | cell cycle pathway | "In this study we investigated the role of microRNA ......" | 22498306 | Luciferase; Colony formation; Cell migration assay |
hsa-miR-199a-3p | ovarian cancer | Apoptosis pathway | "Increasing evidence has shown that miR-199a is imp ......" | 24137412 | Western blot; Luciferase |
hsa-miR-199a-3p | prostate cancer | Apoptosis pathway | "miR 199a 3p targets stemness related and mitogenic ......" | 27447749 | Luciferase |
hsa-miR-199a-3p | sarcoma | Apoptosis pathway | "In this paper miR-199a and miR-34a were discussed ......" | 24957404 | |
hsa-miR-199a-3p | sarcoma | Apoptosis pathway | "In addition it was also proved that as a kind of c ......" | 25262514 | Western blot; Flow cytometry |
hsa-miR-199a-3p | thyroid cancer | cell cycle pathway | "MATERIAL AND METHODS We conducted qRT-PCR analysis ......" | 27062921 |
Reported cancer prognosis affected by hsa-miR-199a-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-199a-3p | B cell lymphoma | poor survival | "miR 199a and miR 497 Are Associated with Better Ov ......" | 26251897 | |
hsa-miR-199a-3p | acute myeloid leukemia | poor survival | "To determine whether miRNAs are associated with cy ......" | 18187662 | |
hsa-miR-199a-3p | bladder cancer | staging | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
hsa-miR-199a-3p | bladder cancer | malignant trasformation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | |
hsa-miR-199a-3p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
hsa-miR-199a-3p | bladder cancer | tumorigenesis | "Decrement of miR 199a 5p contributes to the tumori ......" | 26885275 | |
hsa-miR-199a-3p | cervical and endocervical cancer | staging | "In this study we profiled miRNA expression in 10 e ......" | 18451214 | |
hsa-miR-199a-3p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
hsa-miR-199a-3p | colorectal cancer | staging; metastasis; poor survival | "Aberrant expression of miR 199a 3p and its clinica ......" | 23292866 | Flow cytometry |
hsa-miR-199a-3p | colorectal cancer | metastasis; staging | "A critical role of mir 199a in the cell biological ......" | 26065676 | |
hsa-miR-199a-3p | endometrial cancer | metastasis; malignant trasformation; tumorigenesis | "Abnormal expression of miR-199a-3p which has simil ......" | 23851675 | Western blot; Luciferase |
hsa-miR-199a-3p | gastric cancer | progression | "353 gastric samples from two independent subsets o ......" | 20022810 | |
hsa-miR-199a-3p | gastric cancer | progression; metastasis | "miR 199a regulates the tumor suppressor mitogen ac ......" | 21048306 | |
hsa-miR-199a-3p | gastric cancer | recurrence; worse prognosis | "Initial profiling using miR microarrays was perfor ......" | 22046085 | |
hsa-miR-199a-3p | gastric cancer | metastasis | "SRF expedites metastasis and modulates the epithel ......" | 25080937 | |
hsa-miR-199a-3p | gastric cancer | progression | "MiR 199a 3p promotes gastric cancer progression by ......" | 25448600 | |
hsa-miR-199a-3p | kidney papillary renal cell cancer | staging; poor survival | "In the training stage the expression levels of 12 ......" | 25906110 | |
hsa-miR-199a-3p | kidney renal cell cancer | worse prognosis; poor survival; staging; metastasis; recurrence | "Association of miR 199a expression with clinicopat ......" | 23174576 | |
hsa-miR-199a-3p | liver cancer | tumorigenesis | "microRNA-199a miR-199a is a highly conserved miRNA ......" | 21847633 | Luciferase |
hsa-miR-199a-3p | liver cancer | staging | "Circulating miR 375 and miR 199a 3p as potential b ......" | 25618599 | |
hsa-miR-199a-3p | liver cancer | progression | "We analysed the expression of mature miRNA-122 miR ......" | 26133725 | |
hsa-miR-199a-3p | lung squamous cell cancer | progression | "MiR 199a suppresses the hypoxia induced proliferat ......" | 24022342 | |
hsa-miR-199a-3p | melanoma | metastasis; differentiation | "An exploratory miRNA analysis of 666 miRs by low d ......" | 20302635 | |
hsa-miR-199a-3p | melanoma | metastasis | "miR 199a 5p regulates the expression of metastasis ......" | 25400815 | |
hsa-miR-199a-3p | melanoma | progression | "Small RNA deep sequencing discriminates subsets of ......" | 26176991 | |
hsa-miR-199a-3p | ovarian cancer | worse prognosis | "The microRNA expression profiles were examined usi ......" | 18451233 | |
hsa-miR-199a-3p | ovarian cancer | poor survival | "The Cox proportional hazards model and the log-ran ......" | 21345725 | |
hsa-miR-199a-3p | ovarian cancer | drug resistance; tumorigenesis | "In this study we investigated the role of microRNA ......" | 22498306 | Luciferase; Colony formation; Cell migration assay |
hsa-miR-199a-3p | ovarian cancer | metastasis; drug resistance | "Increasing evidence has shown that miR-199a is imp ......" | 24137412 | Western blot; Luciferase |
hsa-miR-199a-3p | ovarian cancer | metastasis; cell migration | "Furthermore the opposite strand of DNM2 gene encod ......" | 24706848 | |
hsa-miR-199a-3p | ovarian cancer | progression | "The hypoxia related microRNA miR 199a 3p displays ......" | 25839163 | |
hsa-miR-199a-3p | ovarian cancer | drug resistance | "Involvement of miR 199a in cisplatin resistance of ......" | 26711828 | Western blot; Luciferase |
hsa-miR-199a-3p | ovarian cancer | progression; poor survival | "miRNA profiling by microarray real-time PCR and im ......" | 26782955 | |
hsa-miR-199a-3p | ovarian cancer | progression; staging; metastasis; worse prognosis; poor survival | "The conglomeration of diagnostic prognostic and th ......" | 26951510 | |
hsa-miR-199a-3p | pancreatic cancer | staging | "The miRNAs expression profile of early stage was s ......" | 24785459 | |
hsa-miR-199a-3p | prostate cancer | staging | "miR 199a 3p inhibits aurora kinase A and attenuate ......" | 24631181 | |
hsa-miR-199a-3p | prostate cancer | metastasis | "We identify that TGFβ1-related miR-143 miR-145 mi ......" | 24763824 | |
hsa-miR-199a-3p | sarcoma | metastasis | "Levels of six candidate miRNAs miR-21 miR-199a-3p ......" | 23269581 | |
hsa-miR-199a-3p | sarcoma | progression; metastasis; recurrence; worse prognosis | "miR 199a 3p negatively regulates the progression o ......" | 25520864 | |
hsa-miR-199a-3p | sarcoma | metastasis | "Second evaluation of miRNA concentration in indivi ......" | 25775010 | |
hsa-miR-199a-3p | sarcoma | progression; staging | "CD44 is a direct target of miR 199a 3p and contrib ......" | 26079799 |
Reported gene related to hsa-miR-199a-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-199a-3p | endometrial cancer | MTOR | "The results demonstrated that miR-199a-3p could in ......" | 23851675 |
hsa-miR-199a-3p | ovarian cancer | MTOR | "Involvement of miR 199a in cisplatin resistance of ......" | 26711828 |
hsa-miR-199a-3p | ovarian cancer | MTOR | "The miR-199a levels were increased in the C13* cel ......" | 24137412 |
hsa-miR-199a-3p | sarcoma | MTOR | "In addition we observed decreased mTOR and Stat3 e ......" | 21666078 |
hsa-miR-199a-3p | thyroid cancer | MTOR | "We demonstrated that miR-199a-3p restoration in PT ......" | 24810336 |
hsa-miR-199a-3p | liver cancer | CD44 | "miR 199a 3p targets CD44 and reduces proliferation ......" | 21055388 |
hsa-miR-199a-3p | ovarian cancer | CD44 | "Luciferase reporter gene assays confirmed that miR ......" | 22498306 |
hsa-miR-199a-3p | prostate cancer | CD44 | "Using target prediction program and luciferase ass ......" | 27447749 |
hsa-miR-199a-3p | sarcoma | CD44 | "CD44 is a direct target of miR 199a 3p and contrib ......" | 26079799 |
hsa-miR-199a-3p | esophageal cancer | MAP2K6 | "Overexpression of miR 199a 5p decreases esophageal ......" | 26717044 |
hsa-miR-199a-3p | gastric cancer | MAP2K6 | "miR 199a regulates the tumor suppressor mitogen ac ......" | 21048306 |
hsa-miR-199a-3p | liver cancer | MET | "16 2002 3074-3086 and c-Met is a known miR-199a-3p ......" | 21055388 |
hsa-miR-199a-3p | ovarian cancer | MET | "In silico analyses indicated that MET is one of th ......" | 25839163 |
hsa-miR-199a-3p | ovarian cancer | ABCG2 | "miR-199a significantly increased the chemosensitiv ......" | 22498306 |
hsa-miR-199a-3p | liver cancer | AFP | "However using miRNA panel of miR-22 and miR-199a-3 ......" | 27271989 |
hsa-miR-199a-3p | prostate cancer | AURKA | "miR 199a 3p inhibits aurora kinase A and attenuate ......" | 24631181 |
hsa-miR-199a-3p | sarcoma | AXL | "miR 199a 3p negatively regulates the progression o ......" | 25520864 |
hsa-miR-199a-3p | liver cancer | CASP8 | "The techniques used were the MTT assay flow cytome ......" | 23319430 |
hsa-miR-199a-3p | liver cancer | CASP9 | "The techniques used were the MTT assay flow cytome ......" | 23319430 |
hsa-miR-199a-3p | sarcoma | CCL5 | "CCL5 promotes vascular endothelial growth factor e ......" | 25444917 |
hsa-miR-199a-3p | thyroid cancer | CTGF | "We identified CTGF as target of miR-491 and viabil ......" | 27062921 |
hsa-miR-199a-3p | colorectal cancer | DDR1 | "MiR 199a 5p loss up regulated DDR1 aggravated colo ......" | 24711074 |
hsa-miR-199a-3p | ovarian cancer | DNM2 | "Furthermore the opposite strand of DNM2 gene encod ......" | 24706848 |
hsa-miR-199a-3p | liver cancer | ELAVL1 | "Suppression of miR 199a maturation by HuR is cruci ......" | 26346275 |
hsa-miR-199a-3p | breast cancer | ETS1 | "miR 199a 5p regulates β1 integrin through Ets 1 t ......" | 27094578 |
hsa-miR-199a-3p | colorectal cancer | FZD6 | "FZD6 expression is negatively regulated by miR 199 ......" | 25772759 |
hsa-miR-199a-3p | thyroid cancer | HGF | "Integrated analysis of miR-199a-3p targets unveils ......" | 24810336 |
hsa-miR-199a-3p | lung squamous cell cancer | HIF1A | "In this study we found that the upregulation of HI ......" | 24022342 |
hsa-miR-199a-3p | liver cancer | HK2 | "MiR 199a 5p is negatively associated with malignan ......" | 26054020 |
hsa-miR-199a-3p | breast cancer | ITGA9 | "miR 199a 5p regulates β1 integrin through Ets 1 t ......" | 27094578 |
hsa-miR-199a-3p | gastric cancer | KL | "Up regulated miR 199a 5p in gastric cancer functio ......" | 24655788 |
hsa-miR-199a-3p | esophageal cancer | MAP3K11 | "Overexpression of miR 199a 5p decreases esophageal ......" | 26717044 |
hsa-miR-199a-3p | liver cancer | MMP9 | "The real-time PCR was used to evaluate the effect ......" | 23742776 |
hsa-miR-199a-3p | ovarian cancer | NFASC | "Regulation of IKKbeta by miR 199a affects NF kappa ......" | 18408758 |
hsa-miR-199a-3p | ovarian cancer | NFKB1 | "Regulation of IKKbeta by miR 199a affects NF kappa ......" | 18408758 |
hsa-miR-199a-3p | colorectal cancer | NLK | "NLK a novel target of miR 199a 3p functions as a t ......" | 24972723 |
hsa-miR-199a-3p | lung squamous cell cancer | PDK1 | "MiR-199a overexpression suppressed the hypoxia-ind ......" | 24022342 |
hsa-miR-199a-3p | pancreatic cancer | PSC | "Taken together this study reveals miR-199a-3p and ......" | 26918939 |
hsa-miR-199a-3p | gastric cancer | SRF | "SRF expedites metastasis and modulates the epithel ......" | 25080937 |
hsa-miR-199a-3p | sarcoma | STAT3 | "In addition we observed decreased mTOR and Stat3 e ......" | 21666078 |
hsa-miR-199a-3p | sarcoma | TP53 | "The results demonstrated that miR-199a and miR-34a ......" | 24957404 |
hsa-miR-199a-3p | sarcoma | VEGFA | "In addition co-transfection with miR-199a mimic re ......" | 25444917 |
hsa-miR-199a-3p | gastric cancer | ZHX1 | "MiR 199a 3p promotes gastric cancer progression by ......" | 25448600 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-199a-3p | YWHAE | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; OV; PAAD; PRAD; THCA | MirTarget; PITA; miRNATAP | TCGA BLCA -0.061; TCGA BRCA -0.071; TCGA CESC -0.064; TCGA COAD -0.109; TCGA HNSC -0.081; TCGA KIRP -0.077; TCGA LGG -0.068; TCGA LUAD -0.092; TCGA OV -0.108; TCGA PAAD -0.2; TCGA PRAD -0.121; TCGA THCA -0.074 |
hsa-miR-199a-3p | FAM199X | 10 cancers: BLCA; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.054; TCGA ESCA -0.145; TCGA HNSC -0.144; TCGA LUAD -0.065; TCGA LUSC -0.125; TCGA PRAD -0.111; TCGA SARC -0.172; TCGA THCA -0.057; TCGA STAD -0.127; TCGA UCEC -0.096 |
hsa-miR-199a-3p | PPP1R9A | 10 cancers: BLCA; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD | MirTarget; PITA; miRNATAP | TCGA BLCA -0.589; TCGA ESCA -0.689; TCGA KIRP -0.11; TCGA LGG -0.113; TCGA LUAD -0.13; TCGA LUSC -0.761; TCGA PAAD -0.471; TCGA PRAD -0.141; TCGA THCA -0.062; TCGA STAD -0.362 |
hsa-miR-199a-3p | KIAA0141 | 12 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.171; TCGA BRCA -0.069; TCGA COAD -0.099; TCGA ESCA -0.206; TCGA LIHC -0.052; TCGA LUAD -0.117; TCGA LUSC -0.105; TCGA PAAD -0.092; TCGA PRAD -0.077; TCGA SARC -0.053; TCGA THCA -0.076; TCGA STAD -0.093 |
hsa-miR-199a-3p | UBXN2B | 9 cancers: BLCA; COAD; ESCA; LIHC; LUAD; LUSC; OV; SARC; UCEC | MirTarget | TCGA BLCA -0.108; TCGA COAD -0.131; TCGA ESCA -0.154; TCGA LIHC -0.062; TCGA LUAD -0.136; TCGA LUSC -0.107; TCGA OV -0.05; TCGA SARC -0.102; TCGA UCEC -0.077 |
hsa-miR-199a-3p | NRBP2 | 9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUSC; SARC; STAD | MirTarget | TCGA BLCA -0.097; TCGA BRCA -0.085; TCGA KIRC -0.351; TCGA KIRP -0.251; TCGA LGG -0.12; TCGA LIHC -0.129; TCGA LUSC -0.221; TCGA SARC -0.305; TCGA STAD -0.136 |
hsa-miR-199a-3p | NLK | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; SARC; THCA; UCEC | MirTarget; PITA; miRNATAP | TCGA BLCA -0.093; TCGA BRCA -0.08; TCGA CESC -0.059; TCGA COAD -0.099; TCGA ESCA -0.209; TCGA LIHC -0.069; TCGA LUAD -0.063; TCGA LUSC -0.218; TCGA PAAD -0.308; TCGA SARC -0.088; TCGA THCA -0.055; TCGA UCEC -0.076 |
hsa-miR-199a-3p | CETN3 | 9 cancers: BLCA; HNSC; KIRC; LIHC; LUSC; OV; PAAD; PRAD; UCEC | MirTarget; PITA | TCGA BLCA -0.122; TCGA HNSC -0.093; TCGA KIRC -0.057; TCGA LIHC -0.082; TCGA LUSC -0.171; TCGA OV -0.125; TCGA PAAD -0.133; TCGA PRAD -0.081; TCGA UCEC -0.071 |
hsa-miR-199a-3p | FAM60A | 9 cancers: BLCA; CESC; COAD; KIRP; LGG; OV; PRAD; SARC; UCEC | MirTarget; PITA; miRNATAP | TCGA BLCA -0.122; TCGA CESC -0.097; TCGA COAD -0.175; TCGA KIRP -0.052; TCGA LGG -0.123; TCGA OV -0.118; TCGA PRAD -0.087; TCGA SARC -0.101; TCGA UCEC -0.068 |
hsa-miR-199a-3p | KDM3A | 10 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; SARC | MirTarget | TCGA BLCA -0.129; TCGA CESC -0.073; TCGA COAD -0.143; TCGA HNSC -0.097; TCGA KIRC -0.191; TCGA KIRP -0.081; TCGA LGG -0.055; TCGA LIHC -0.077; TCGA LUSC -0.097; TCGA SARC -0.115 |
hsa-miR-199a-3p | KIAA0907 | 9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; UCEC | MirTarget; PITA | TCGA BLCA -0.168; TCGA BRCA -0.143; TCGA KIRC -0.25; TCGA KIRP -0.097; TCGA LGG -0.051; TCGA LIHC -0.116; TCGA LUSC -0.203; TCGA OV -0.057; TCGA UCEC -0.143 |
hsa-miR-199a-3p | ZC3H14 | 10 cancers: BLCA; COAD; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.088; TCGA COAD -0.126; TCGA LUAD -0.124; TCGA LUSC -0.09; TCGA OV -0.065; TCGA PAAD -0.175; TCGA PRAD -0.098; TCGA SARC -0.106; TCGA THCA -0.066; TCGA STAD -0.102 |
hsa-miR-199a-3p | RHOT1 | 10 cancers: BLCA; CESC; COAD; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD | MirTarget; PITA | TCGA BLCA -0.077; TCGA CESC -0.07; TCGA COAD -0.086; TCGA LUAD -0.104; TCGA LUSC -0.114; TCGA OV -0.058; TCGA PAAD -0.101; TCGA SARC -0.122; TCGA THCA -0.077; TCGA STAD -0.212 |
hsa-miR-199a-3p | ARG2 | 9 cancers: BLCA; COAD; HNSC; LIHC; OV; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.224; TCGA COAD -0.132; TCGA HNSC -0.21; TCGA LIHC -0.088; TCGA OV -0.076; TCGA PAAD -0.337; TCGA SARC -0.218; TCGA THCA -0.104; TCGA STAD -0.145 |
hsa-miR-199a-3p | KIAA0319L | 10 cancers: BLCA; BRCA; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; PITA | TCGA BLCA -0.068; TCGA BRCA -0.162; TCGA ESCA -0.245; TCGA LUAD -0.068; TCGA LUSC -0.094; TCGA PAAD -0.103; TCGA PRAD -0.153; TCGA THCA -0.081; TCGA STAD -0.087; TCGA UCEC -0.073 |
hsa-miR-199a-3p | SLC38A1 | 9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; SARC; UCEC | PITA | TCGA BLCA -0.156; TCGA CESC -0.143; TCGA COAD -0.129; TCGA HNSC -0.112; TCGA KIRC -0.182; TCGA KIRP -0.077; TCGA LGG -0.1; TCGA SARC -0.431; TCGA UCEC -0.175 |
hsa-miR-199a-3p | ACVR2B | 13 cancers: BLCA; ESCA; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | PITA; miRNATAP | TCGA BLCA -0.16; TCGA ESCA -0.136; TCGA KIRP -0.079; TCGA LGG -0.221; TCGA LUAD -0.109; TCGA LUSC -0.154; TCGA OV -0.082; TCGA PAAD -0.305; TCGA PRAD -0.118; TCGA SARC -0.079; TCGA THCA -0.07; TCGA STAD -0.161; TCGA UCEC -0.059 |
hsa-miR-199a-3p | OXSR1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; SARC; STAD | PITA | TCGA BLCA -0.063; TCGA CESC -0.105; TCGA COAD -0.079; TCGA ESCA -0.174; TCGA HNSC -0.062; TCGA LUAD -0.061; TCGA LUSC -0.062; TCGA SARC -0.092; TCGA STAD -0.129 |
hsa-miR-199a-3p | TACC2 | 10 cancers: BLCA; ESCA; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD | PITA; miRNATAP | TCGA BLCA -0.148; TCGA ESCA -0.256; TCGA LGG -0.065; TCGA LIHC -0.07; TCGA LUAD -0.367; TCGA LUSC -0.157; TCGA PAAD -0.293; TCGA SARC -0.431; TCGA THCA -0.072; TCGA STAD -0.205 |
hsa-miR-199a-3p | UBL3 | 9 cancers: BLCA; COAD; ESCA; LGG; LUAD; PAAD; PRAD; THCA; STAD | PITA | TCGA BLCA -0.081; TCGA COAD -0.129; TCGA ESCA -0.385; TCGA LGG -0.073; TCGA LUAD -0.173; TCGA PAAD -0.168; TCGA PRAD -0.095; TCGA THCA -0.052; TCGA STAD -0.298 |
hsa-miR-199a-3p | MKRN1 | 13 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | PITA; miRNATAP | TCGA BLCA -0.096; TCGA BRCA -0.072; TCGA ESCA -0.126; TCGA HNSC -0.093; TCGA KIRP -0.058; TCGA LGG -0.052; TCGA LUAD -0.056; TCGA LUSC -0.145; TCGA PAAD -0.137; TCGA PRAD -0.057; TCGA SARC -0.094; TCGA STAD -0.066; TCGA UCEC -0.053 |
hsa-miR-199a-3p | PLEKHH1 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA | PITA; miRNATAP | TCGA BLCA -0.389; TCGA BRCA -0.101; TCGA CESC -0.179; TCGA ESCA -0.891; TCGA HNSC -0.302; TCGA KIRC -0.135; TCGA KIRP -0.214; TCGA LIHC -0.11; TCGA LUSC -0.317; TCGA PAAD -0.351; TCGA PRAD -0.25; TCGA THCA -0.061 |
hsa-miR-199a-3p | ANKRD52 | 9 cancers: BLCA; CESC; ESCA; KIRP; LIHC; LUAD; PAAD; PRAD; SARC | PITA; miRNATAP | TCGA BLCA -0.071; TCGA CESC -0.104; TCGA ESCA -0.122; TCGA KIRP -0.061; TCGA LIHC -0.109; TCGA LUAD -0.065; TCGA PAAD -0.14; TCGA PRAD -0.085; TCGA SARC -0.064 |
hsa-miR-199a-3p | SLC45A4 | 9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; PAAD; PRAD; THCA; UCEC | mirMAP | TCGA BLCA -0.103; TCGA BRCA -0.094; TCGA ESCA -0.356; TCGA HNSC -0.123; TCGA LUAD -0.132; TCGA PAAD -0.152; TCGA PRAD -0.057; TCGA THCA -0.096; TCGA UCEC -0.128 |
hsa-miR-199a-3p | LYRM2 | 10 cancers: BLCA; COAD; ESCA; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.089; TCGA COAD -0.084; TCGA ESCA -0.099; TCGA LUAD -0.087; TCGA OV -0.137; TCGA PAAD -0.164; TCGA PRAD -0.128; TCGA SARC -0.056; TCGA STAD -0.137; TCGA UCEC -0.053 |
hsa-miR-199a-3p | MLLT6 | 9 cancers: BLCA; BRCA; ESCA; LGG; LIHC; LUSC; PAAD; PRAD; SARC | mirMAP; miRNATAP | TCGA BLCA -0.149; TCGA BRCA -0.108; TCGA ESCA -0.231; TCGA LGG -0.082; TCGA LIHC -0.066; TCGA LUSC -0.171; TCGA PAAD -0.138; TCGA PRAD -0.074; TCGA SARC -0.123 |
hsa-miR-199a-3p | PGPEP1 | 9 cancers: BLCA; BRCA; ESCA; LIHC; LUSC; PAAD; PRAD; SARC; THCA | mirMAP | TCGA BLCA -0.24; TCGA BRCA -0.153; TCGA ESCA -0.614; TCGA LIHC -0.117; TCGA LUSC -0.127; TCGA PAAD -0.232; TCGA PRAD -0.059; TCGA SARC -0.213; TCGA THCA -0.113 |
hsa-miR-199a-3p | MBD1 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.132; TCGA BRCA -0.08; TCGA CESC -0.06; TCGA HNSC -0.073; TCGA KIRC -0.066; TCGA LUSC -0.064; TCGA PAAD -0.121; TCGA SARC -0.067; TCGA STAD -0.077 |
hsa-miR-199a-3p | LIMD1 | 11 cancers: BLCA; CESC; ESCA; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.183; TCGA CESC -0.094; TCGA ESCA -0.305; TCGA KIRP -0.065; TCGA LIHC -0.076; TCGA LUAD -0.269; TCGA LUSC -0.211; TCGA PRAD -0.085; TCGA SARC -0.084; TCGA THCA -0.068; TCGA STAD -0.15 |
hsa-miR-199a-3p | UBN2 | 9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PAAD; PRAD | mirMAP | TCGA BLCA -0.157; TCGA COAD -0.076; TCGA ESCA -0.11; TCGA KIRC -0.136; TCGA KIRP -0.124; TCGA LGG -0.095; TCGA LUSC -0.195; TCGA PAAD -0.159; TCGA PRAD -0.062 |
hsa-miR-199a-3p | UQCRB | 13 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.074; TCGA BRCA -0.08; TCGA ESCA -0.118; TCGA HNSC -0.081; TCGA LGG -0.099; TCGA LIHC -0.097; TCGA LUAD -0.057; TCGA LUSC -0.097; TCGA PAAD -0.178; TCGA PRAD -0.098; TCGA SARC -0.074; TCGA STAD -0.17; TCGA UCEC -0.083 |
hsa-miR-199a-3p | LUC7L3 | 10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; SARC; UCEC | miRNATAP | TCGA BLCA -0.184; TCGA BRCA -0.058; TCGA KIRC -0.175; TCGA KIRP -0.138; TCGA LGG -0.131; TCGA LIHC -0.065; TCGA LUSC -0.227; TCGA PAAD -0.104; TCGA SARC -0.055; TCGA UCEC -0.074 |
hsa-miR-199a-3p | RBM47 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; UCEC | miRNATAP | TCGA BLCA -0.141; TCGA COAD -0.189; TCGA ESCA -0.693; TCGA HNSC -0.249; TCGA LUAD -0.16; TCGA LUSC -0.211; TCGA PRAD -0.115; TCGA THCA -0.064; TCGA UCEC -0.164 |
hsa-miR-199a-3p | MARS2 | 9 cancers: BLCA; CESC; COAD; ESCA; LUAD; OV; PRAD; THCA; UCEC | miRNATAP | TCGA BLCA -0.177; TCGA CESC -0.125; TCGA COAD -0.119; TCGA ESCA -0.315; TCGA LUAD -0.102; TCGA OV -0.103; TCGA PRAD -0.17; TCGA THCA -0.056; TCGA UCEC -0.069 |
hsa-miR-199a-3p | SCAI | 12 cancers: BLCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.093; TCGA COAD -0.09; TCGA HNSC -0.092; TCGA LGG -0.055; TCGA LIHC -0.06; TCGA LUAD -0.185; TCGA LUSC -0.207; TCGA OV -0.071; TCGA PAAD -0.157; TCGA PRAD -0.103; TCGA SARC -0.105; TCGA STAD -0.134 |
hsa-miR-199a-3p | ITPK1 | 9 cancers: BRCA; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; SARC; THCA | MirTarget; PITA; miRNATAP | TCGA BRCA -0.209; TCGA ESCA -0.381; TCGA HNSC -0.061; TCGA LGG -0.08; TCGA LUAD -0.133; TCGA LUSC -0.129; TCGA PAAD -0.133; TCGA SARC -0.343; TCGA THCA -0.06 |
hsa-miR-199a-3p | CCDC85C | 11 cancers: BRCA; CESC; HNSC; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.164; TCGA CESC -0.15; TCGA HNSC -0.184; TCGA LGG -0.08; TCGA LIHC -0.114; TCGA LUAD -0.119; TCGA PAAD -0.258; TCGA PRAD -0.193; TCGA SARC -0.197; TCGA THCA -0.115; TCGA STAD -0.187 |
hsa-miR-199a-3p | LLGL2 | 9 cancers: BRCA; ESCA; HNSC; LIHC; LUSC; PAAD; SARC; THCA; UCEC | PITA; miRNATAP | TCGA BRCA -0.274; TCGA ESCA -0.71; TCGA HNSC -0.287; TCGA LIHC -0.07; TCGA LUSC -0.265; TCGA PAAD -0.473; TCGA SARC -0.191; TCGA THCA -0.078; TCGA UCEC -0.1 |
hsa-miR-199a-3p | IMMT | 11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; STAD; UCEC | PITA | TCGA BRCA -0.051; TCGA CESC -0.071; TCGA COAD -0.075; TCGA ESCA -0.086; TCGA HNSC -0.059; TCGA LUAD -0.072; TCGA PAAD -0.064; TCGA PRAD -0.067; TCGA SARC -0.089; TCGA STAD -0.074; TCGA UCEC -0.066 |
hsa-miR-199a-3p | MMAB | 11 cancers: BRCA; HNSC; LGG; LIHC; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | PITA | TCGA BRCA -0.107; TCGA HNSC -0.146; TCGA LGG -0.088; TCGA LIHC -0.117; TCGA LUAD -0.121; TCGA OV -0.082; TCGA PAAD -0.402; TCGA PRAD -0.09; TCGA THCA -0.077; TCGA STAD -0.148; TCGA UCEC -0.072 |
hsa-miR-199a-3p | MAPK9 | 9 cancers: CESC; COAD; ESCA; LUAD; LUSC; PAAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA CESC -0.099; TCGA COAD -0.1; TCGA ESCA -0.149; TCGA LUAD -0.073; TCGA LUSC -0.075; TCGA PAAD -0.123; TCGA SARC -0.101; TCGA THCA -0.074; TCGA STAD -0.085 |
hsa-miR-199a-3p | SUZ12 | 10 cancers: COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | PITA; miRNATAP | TCGA COAD -0.155; TCGA ESCA -0.109; TCGA HNSC -0.107; TCGA LIHC -0.066; TCGA LUAD -0.054; TCGA LUSC -0.087; TCGA PRAD -0.094; TCGA SARC -0.154; TCGA STAD -0.101; TCGA UCEC -0.085 |
Enriched cancer pathways of putative targets