microRNA information: hsa-miR-199a-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-199a-5p | miRbase |
| Accession: | MIMAT0000231 | miRbase |
| Precursor name: | hsa-mir-199a-1 | miRbase |
| Precursor accession: | MI0000242 | miRbase |
| Symbol: | MIR199A1 | HGNC |
| RefSeq ID: | NR_029586 | GenBank |
| Sequence: | CCCAGUGUUCAGACUACCUGUUC |
Reported expression in cancers: hsa-miR-199a-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-199a-5p | B cell lymphoma | upregulation | "miR 199a and miR 497 Are Associated with Better Ov ......" | 26251897 | |
| hsa-miR-199a-5p | acute myeloid leukemia | deregulation | "After background subtraction and normalization usi ......" | 18187662 | Microarray; qPCR |
| hsa-miR-199a-5p | bladder cancer | downregulation | "Decrement of miR 199a 5p contributes to the tumori ......" | 26885275 | |
| hsa-miR-199a-5p | colon cancer | upregulation | "Among the upregulated miRNAs we focused on miR-199 ......" | 26107137 | |
| hsa-miR-199a-5p | colorectal cancer | downregulation | "We found that miR-199a-5p was expressed at a low l ......" | 22903020 | |
| hsa-miR-199a-5p | colorectal cancer | downregulation | "Western blot was used to determine the relative si ......" | 24711074 | |
| hsa-miR-199a-5p | gastric cancer | upregulation | "Using real-time reverse-transcriptase RT-polymeras ......" | 21048306 | |
| hsa-miR-199a-5p | kidney renal cell cancer | downregulation | "Association of miR 199a expression with clinicopat ......" | 23174576 | qPCR |
| hsa-miR-199a-5p | liver cancer | downregulation | "A significant down-regulation of miR-199a-5p was o ......" | 20799954 | |
| hsa-miR-199a-5p | liver cancer | downregulation | "microRNA-199a miR-199a is a highly conserved miRNA ......" | 21847633 | Microarray; qPCR |
| hsa-miR-199a-5p | liver cancer | downregulation | "Subsequent investigation of the characterized miRN ......" | 26054020 | |
| hsa-miR-199a-5p | ovarian cancer | downregulation | "The conglomeration of diagnostic prognostic and th ......" | 26951510 | qPCR |
| hsa-miR-199a-5p | prostate cancer | downregulation | "Moreover we demonstrate that down-regulation of mi ......" | 24631181 | |
| hsa-miR-199a-5p | thyroid cancer | upregulation | "High expression levels of miR-146-5p miR-199a-5p m ......" | 27586203 |
Reported cancer pathway affected by hsa-miR-199a-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-199a-5p | B cell lymphoma | Apoptosis pathway | "miR 199a and miR 497 Are Associated with Better Ov ......" | 26251897 | |
| hsa-miR-199a-5p | bladder cancer | Apoptosis pathway | "Decrement of miR 199a 5p contributes to the tumori ......" | 26885275 | |
| hsa-miR-199a-5p | breast cancer | mTOR signaling pathway | "miR 199a 5p regulates β1 integrin through Ets 1 t ......" | 27094578 | Luciferase |
| hsa-miR-199a-5p | colorectal cancer | cell cycle pathway | "We found that miR-199a-5p was expressed at a low l ......" | 22903020 | Luciferase |
| hsa-miR-199a-5p | colorectal cancer | cell cycle pathway | "MiR 199a 5p loss up regulated DDR1 aggravated colo ......" | 24711074 | Western blot; Luciferase; Colony formation |
| hsa-miR-199a-5p | colorectal cancer | Apoptosis pathway; cell cycle pathway | "A critical role of mir 199a in the cell biological ......" | 26065676 | |
| hsa-miR-199a-5p | liver cancer | Apoptosis pathway | "The techniques used were the MTT assay flow cytome ......" | 23319430 | Flow cytometry; MTT assay |
| hsa-miR-199a-5p | melanoma | Epithelial mesenchymal transition pathway | "An exploratory miRNA analysis of 666 miRs by low d ......" | 20302635 | |
| hsa-miR-199a-5p | ovarian cancer | cell cycle pathway | "In this study we investigated the role of microRNA ......" | 22498306 | Luciferase; Colony formation; Cell migration assay |
| hsa-miR-199a-5p | ovarian cancer | Apoptosis pathway | "Increasing evidence has shown that miR-199a is imp ......" | 24137412 | Western blot; Luciferase |
| hsa-miR-199a-5p | sarcoma | Apoptosis pathway | "In this paper miR-199a and miR-34a were discussed ......" | 24957404 | |
| hsa-miR-199a-5p | thyroid cancer | cell cycle pathway | "BACKGROUND The objective of this study was to expl ......" | 27062921 | Luciferase |
Reported cancer prognosis affected by hsa-miR-199a-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-199a-5p | B cell lymphoma | poor survival | "miR 199a and miR 497 Are Associated with Better Ov ......" | 26251897 | |
| hsa-miR-199a-5p | acute myeloid leukemia | poor survival | "To determine whether miRNAs are associated with cy ......" | 18187662 | |
| hsa-miR-199a-5p | bladder cancer | staging | "Expression levels of miRNAs were assessed by quant ......" | 23169479 | |
| hsa-miR-199a-5p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
| hsa-miR-199a-5p | bladder cancer | tumorigenesis | "Decrement of miR 199a 5p contributes to the tumori ......" | 26885275 | |
| hsa-miR-199a-5p | breast cancer | metastasis; motility | "miR 199a 5p regulates β1 integrin through Ets 1 t ......" | 27094578 | Luciferase |
| hsa-miR-199a-5p | cervical and endocervical cancer | staging | "In this study we profiled miRNA expression in 10 e ......" | 18451214 | |
| hsa-miR-199a-5p | colon cancer | drug resistance | "MiR 199a 5p and miR 375 affect colon cancer cell s ......" | 26107137 | |
| hsa-miR-199a-5p | colorectal cancer | drug resistance; tumorigenesis | "We found that miR-199a-5p was expressed at a low l ......" | 22903020 | Luciferase |
| hsa-miR-199a-5p | colorectal cancer | progression | "MiR 199a 5p loss up regulated DDR1 aggravated colo ......" | 24711074 | Western blot; Luciferase; Colony formation |
| hsa-miR-199a-5p | colorectal cancer | metastasis; staging | "A critical role of mir 199a in the cell biological ......" | 26065676 | |
| hsa-miR-199a-5p | gastric cancer | progression | "353 gastric samples from two independent subsets o ......" | 20022810 | |
| hsa-miR-199a-5p | gastric cancer | progression; metastasis | "miR 199a regulates the tumor suppressor mitogen ac ......" | 21048306 | |
| hsa-miR-199a-5p | gastric cancer | progression; staging; metastasis | "Up regulated miR 199a 5p in gastric cancer functio ......" | 24655788 | Transwell assay; Luciferase |
| hsa-miR-199a-5p | gastric cancer | metastasis | "SRF expedites metastasis and modulates the epithel ......" | 25080937 | |
| hsa-miR-199a-5p | gastric cancer | progression | "MiR 199a 3p promotes gastric cancer progression by ......" | 25448600 | |
| hsa-miR-199a-5p | kidney papillary renal cell cancer | staging; poor survival | "In the training stage the expression levels of 12 ......" | 25906110 | |
| hsa-miR-199a-5p | kidney renal cell cancer | worse prognosis; poor survival; staging; metastasis; recurrence | "Association of miR 199a expression with clinicopat ......" | 23174576 | |
| hsa-miR-199a-5p | kidney renal cell cancer | staging | "This study aims to profile dysregulated microRNA m ......" | 25938468 | Luciferase |
| hsa-miR-199a-5p | liver cancer | tumorigenesis | "microRNA-199a miR-199a is a highly conserved miRNA ......" | 21847633 | Luciferase |
| hsa-miR-199a-5p | liver cancer | tumorigenesis | "Six hundred and sixty seven human miRNAs were quan ......" | 23082062 | Western blot; Luciferase |
| hsa-miR-199a-5p | liver cancer | staging; metastasis; poor survival; differentiation; tumor size | "MiR 199a 5p is negatively associated with malignan ......" | 26054020 | |
| hsa-miR-199a-5p | liver cancer | progression | "We analysed the expression of mature miRNA-122 miR ......" | 26133725 | |
| hsa-miR-199a-5p | lung squamous cell cancer | progression | "MiR 199a suppresses the hypoxia induced proliferat ......" | 24022342 | |
| hsa-miR-199a-5p | melanoma | metastasis; differentiation | "An exploratory miRNA analysis of 666 miRs by low d ......" | 20302635 | |
| hsa-miR-199a-5p | melanoma | metastasis | "miR 199a 5p regulates the expression of metastasis ......" | 25400815 | Western blot |
| hsa-miR-199a-5p | ovarian cancer | worse prognosis | "The microRNA expression profiles were examined usi ......" | 18451233 | |
| hsa-miR-199a-5p | ovarian cancer | poor survival | "The Cox proportional hazards model and the log-ran ......" | 21345725 | |
| hsa-miR-199a-5p | ovarian cancer | drug resistance; tumorigenesis | "In this study we investigated the role of microRNA ......" | 22498306 | Luciferase; Colony formation; Cell migration assay |
| hsa-miR-199a-5p | ovarian cancer | metastasis; drug resistance | "Increasing evidence has shown that miR-199a is imp ......" | 24137412 | Western blot; Luciferase |
| hsa-miR-199a-5p | ovarian cancer | metastasis; cell migration | "Furthermore the opposite strand of DNM2 gene encod ......" | 24706848 | |
| hsa-miR-199a-5p | ovarian cancer | drug resistance | "Involvement of miR 199a in cisplatin resistance of ......" | 26711828 | Western blot; Luciferase |
| hsa-miR-199a-5p | ovarian cancer | progression; poor survival | "miRNA profiling by microarray real-time PCR and im ......" | 26782955 | |
| hsa-miR-199a-5p | ovarian cancer | progression; staging; metastasis; worse prognosis; poor survival | "The conglomeration of diagnostic prognostic and th ......" | 26951510 | |
| hsa-miR-199a-5p | prostate cancer | metastasis | "We identify that TGFβ1-related miR-143 miR-145 mi ......" | 24763824 | |
| hsa-miR-199a-5p | sarcoma | progression | "miR 199a 3p negatively regulates the progression o ......" | 25520864 | |
| hsa-miR-199a-5p | sarcoma | progression; staging | "CD44 is a direct target of miR 199a 3p and contrib ......" | 26079799 |
Reported gene related to hsa-miR-199a-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-199a-5p | liver cancer | CD44 | "miR 199a 3p targets CD44 and reduces proliferation ......" | 21055388 |
| hsa-miR-199a-5p | ovarian cancer | CD44 | "Luciferase reporter gene assays confirmed that miR ......" | 22498306 |
| hsa-miR-199a-5p | sarcoma | CD44 | "CD44 is a direct target of miR 199a 3p and contrib ......" | 26079799 |
| hsa-miR-199a-5p | breast cancer | DDR1 | "Moreover we observed that DDR1 protein upregulatio ......" | 26655502 |
| hsa-miR-199a-5p | colorectal cancer | DDR1 | "MiR 199a 5p loss up regulated DDR1 aggravated colo ......" | 24711074 |
| hsa-miR-199a-5p | liver cancer | DDR1 | "Discoidin domain receptor-1 DDR1 tyrosine kinase i ......" | 20799954 |
| hsa-miR-199a-5p | esophageal cancer | MAP2K6 | "Overexpression of miR 199a 5p decreases esophageal ......" | 26717044 |
| hsa-miR-199a-5p | gastric cancer | MAP2K6 | "miR 199a regulates the tumor suppressor mitogen ac ......" | 21048306 |
| hsa-miR-199a-5p | bladder cancer | MAP3K11 | "Further investigation reported that MLK3 was a dir ......" | 26885275 |
| hsa-miR-199a-5p | esophageal cancer | MAP3K11 | "Overexpression of miR 199a 5p decreases esophageal ......" | 26717044 |
| hsa-miR-199a-5p | ovarian cancer | MTOR | "Involvement of miR 199a in cisplatin resistance of ......" | 26711828 |
| hsa-miR-199a-5p | ovarian cancer | MTOR | "The miR-199a levels were increased in the C13* cel ......" | 24137412 |
| hsa-miR-199a-5p | ovarian cancer | ABCG2 | "miR-199a significantly increased the chemosensitiv ......" | 22498306 |
| hsa-miR-199a-5p | prostate cancer | AURKA | "miR 199a 3p inhibits aurora kinase A and attenuate ......" | 24631181 |
| hsa-miR-199a-5p | sarcoma | AXL | "miR 199a 3p negatively regulates the progression o ......" | 25520864 |
| hsa-miR-199a-5p | breast cancer | BECN1 | "We also identify DRAM1 and Beclin1 as novel target ......" | 23337876 |
| hsa-miR-199a-5p | liver cancer | CASP8 | "The techniques used were the MTT assay flow cytome ......" | 23319430 |
| hsa-miR-199a-5p | liver cancer | CASP9 | "The techniques used were the MTT assay flow cytome ......" | 23319430 |
| hsa-miR-199a-5p | sarcoma | CCL5 | "CCL5 promotes vascular endothelial growth factor e ......" | 25444917 |
| hsa-miR-199a-5p | liver cancer | CCND3 | "Our data suggest an importance of miR-138 and miR- ......" | 23082062 |
| hsa-miR-199a-5p | gastric cancer | CDH1 | "In contrast inhibition of miR-199a-5p impaired the ......" | 25080937 |
| hsa-miR-199a-5p | thyroid cancer | CTGF | "We identified CTGF as target of miR-491 and viabil ......" | 27062921 |
| hsa-miR-199a-5p | colon cancer | CYP27A1 | "Indeed restoration of PHLPP1 increases sensitivity ......" | 26107137 |
| hsa-miR-199a-5p | ovarian cancer | DNM2 | "Furthermore the opposite strand of DNM2 gene encod ......" | 24706848 |
| hsa-miR-199a-5p | breast cancer | DRAM1 | "We also identify DRAM1 and Beclin1 as novel target ......" | 23337876 |
| hsa-miR-199a-5p | liver cancer | ELAVL1 | "Suppression of miR 199a maturation by HuR is cruci ......" | 26346275 |
| hsa-miR-199a-5p | breast cancer | ETS1 | "miR 199a 5p regulates β1 integrin through Ets 1 t ......" | 27094578 |
| hsa-miR-199a-5p | colorectal cancer | FZD6 | "FZD6 expression is negatively regulated by miR 199 ......" | 25772759 |
| hsa-miR-199a-5p | lung squamous cell cancer | HIF1A | "In this study we found that the upregulation of HI ......" | 24022342 |
| hsa-miR-199a-5p | liver cancer | HK2 | "MiR 199a 5p is negatively associated with malignan ......" | 26054020 |
| hsa-miR-199a-5p | breast cancer | ITGA9 | "miR 199a 5p regulates β1 integrin through Ets 1 t ......" | 27094578 |
| hsa-miR-199a-5p | kidney renal cell cancer | JUNB | "Luciferase reporter assays indicated that miR-199a ......" | 25938468 |
| hsa-miR-199a-5p | gastric cancer | KL | "Up regulated miR 199a 5p in gastric cancer functio ......" | 24655788 |
| hsa-miR-199a-5p | liver cancer | MMP9 | "The real-time PCR was used to evaluate the effect ......" | 23742776 |
| hsa-miR-199a-5p | ovarian cancer | NFASC | "Regulation of IKKbeta by miR 199a affects NF kappa ......" | 18408758 |
| hsa-miR-199a-5p | ovarian cancer | NFKB1 | "Regulation of IKKbeta by miR 199a affects NF kappa ......" | 18408758 |
| hsa-miR-199a-5p | colorectal cancer | NLK | "NLK a novel target of miR 199a 3p functions as a t ......" | 24972723 |
| hsa-miR-199a-5p | lung squamous cell cancer | PDK1 | "MiR-199a overexpression suppressed the hypoxia-ind ......" | 24022342 |
| hsa-miR-199a-5p | colon cancer | PHLPP1 | "Indeed restoration of PHLPP1 increases sensitivity ......" | 26107137 |
| hsa-miR-199a-5p | melanoma | SFN | "The effects of miR-199a-5p on melanoma cells were ......" | 27122154 |
| hsa-miR-199a-5p | gastric cancer | SRF | "SRF expedites metastasis and modulates the epithel ......" | 25080937 |
| hsa-miR-199a-5p | kidney renal cell cancer | TGFBR1 | "Luciferase reporter assays indicated that miR-199a ......" | 25938468 |
| hsa-miR-199a-5p | sarcoma | TP53 | "The results demonstrated that miR-199a and miR-34a ......" | 24957404 |
| hsa-miR-199a-5p | liver cancer | TXK | "Discoidin domain receptor-1 DDR1 tyrosine kinase i ......" | 20799954 |
| hsa-miR-199a-5p | sarcoma | VEGFA | "In addition co-transfection with miR-199a mimic re ......" | 25444917 |
| hsa-miR-199a-5p | gastric cancer | ZHX1 | "MiR 199a 3p promotes gastric cancer progression by ......" | 25448600 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-199a-5p | DDR1 | 11 cancers: BLCA; BRCA; HNSC; KIRP; LGG; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget; miRanda; miRNATAP | TCGA BLCA -0.074; TCGA BRCA -0.177; TCGA HNSC -0.075; TCGA KIRP -0.095; TCGA LGG -0.171; TCGA OV -0.09; TCGA PRAD -0.126; TCGA SARC -0.305; TCGA THCA -0.059; TCGA STAD -0.143; TCGA UCEC -0.097 |
hsa-miR-199a-5p | CDC7 | 12 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | MirTarget; miRanda | TCGA BLCA -0.075; TCGA BRCA -0.324; TCGA COAD -0.243; TCGA HNSC -0.172; TCGA KIRP -0.062; TCGA LIHC -0.111; TCGA LUAD -0.096; TCGA LUSC -0.174; TCGA OV -0.134; TCGA SARC -0.071; TCGA STAD -0.142; TCGA UCEC -0.151 |
hsa-miR-199a-5p | SLC35E1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; PRAD; STAD; UCEC | MirTarget; miRanda | TCGA BLCA -0.053; TCGA BRCA -0.055; TCGA CESC -0.072; TCGA COAD -0.066; TCGA ESCA -0.061; TCGA KIRC -0.082; TCGA LUSC -0.073; TCGA PRAD -0.139; TCGA STAD -0.062; TCGA UCEC -0.067 |
hsa-miR-199a-5p | VMA21 | 10 cancers: BLCA; BRCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; UCEC | MirTarget; miRanda | TCGA BLCA -0.056; TCGA BRCA -0.115; TCGA HNSC -0.063; TCGA LGG -0.062; TCGA LUAD -0.077; TCGA LUSC -0.152; TCGA PAAD -0.117; TCGA PRAD -0.08; TCGA SARC -0.155; TCGA UCEC -0.051 |
hsa-miR-199a-5p | SLC35A3 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.079; TCGA COAD -0.175; TCGA ESCA -0.328; TCGA HNSC -0.154; TCGA LUSC -0.08; TCGA PRAD -0.192; TCGA SARC -0.069; TCGA STAD -0.292; TCGA UCEC -0.075 |
hsa-miR-199a-5p | EIF5B | 10 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.134; TCGA BRCA -0.105; TCGA HNSC -0.079; TCGA LGG -0.061; TCGA LIHC -0.064; TCGA LUAD -0.228; TCGA LUSC -0.137; TCGA OV -0.07; TCGA PRAD -0.219; TCGA UCEC -0.082 |
hsa-miR-199a-5p | LYRM2 | 10 cancers: BLCA; BRCA; COAD; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA | MirTarget; miRanda | TCGA BLCA -0.074; TCGA BRCA -0.069; TCGA COAD -0.1; TCGA LUAD -0.115; TCGA LUSC -0.07; TCGA OV -0.12; TCGA PAAD -0.17; TCGA PRAD -0.122; TCGA SARC -0.053; TCGA THCA -0.054 |
hsa-miR-199a-5p | TFAM | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.08; TCGA BRCA -0.089; TCGA CESC -0.059; TCGA COAD -0.109; TCGA HNSC -0.135; TCGA LGG -0.07; TCGA LUAD -0.183; TCGA LUSC -0.095; TCGA OV -0.068; TCGA PRAD -0.163; TCGA STAD -0.102; TCGA UCEC -0.111 |
hsa-miR-199a-5p | AFTPH | 10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRanda; miRNATAP | TCGA BLCA -0.076; TCGA BRCA -0.069; TCGA COAD -0.065; TCGA HNSC -0.057; TCGA LUAD -0.125; TCGA LUSC -0.062; TCGA PRAD -0.144; TCGA SARC -0.054; TCGA STAD -0.115; TCGA UCEC -0.063 |
hsa-miR-199a-5p | NLK | 10 cancers: BLCA; BRCA; ESCA; LIHC; LUAD; LUSC; PAAD; SARC; THCA; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.061; TCGA BRCA -0.098; TCGA ESCA -0.108; TCGA LIHC -0.06; TCGA LUAD -0.078; TCGA LUSC -0.225; TCGA PAAD -0.27; TCGA SARC -0.067; TCGA THCA -0.059; TCGA UCEC -0.066 |
hsa-miR-199a-5p | PNPT1 | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; STAD; UCEC | MirTarget; miRanda | TCGA BLCA -0.051; TCGA BRCA -0.177; TCGA CESC -0.127; TCGA COAD -0.129; TCGA HNSC -0.07; TCGA LGG -0.057; TCGA LUAD -0.162; TCGA LUSC -0.15; TCGA OV -0.13; TCGA STAD -0.11; TCGA UCEC -0.086 |
hsa-miR-199a-5p | TAF9B | 10 cancers: BLCA; COAD; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA | MirTarget; miRanda; miRNATAP | TCGA BLCA -0.078; TCGA COAD -0.134; TCGA LGG -0.054; TCGA LIHC -0.067; TCGA LUAD -0.134; TCGA LUSC -0.14; TCGA PAAD -0.193; TCGA PRAD -0.097; TCGA SARC -0.185; TCGA THCA -0.055 |
hsa-miR-199a-5p | CCDC43 | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.053; TCGA BRCA -0.098; TCGA CESC -0.054; TCGA COAD -0.066; TCGA HNSC -0.055; TCGA KIRC -0.058; TCGA LUAD -0.112; TCGA LUSC -0.175; TCGA PRAD -0.055; TCGA THCA -0.056; TCGA STAD -0.075; TCGA UCEC -0.056 |
hsa-miR-199a-5p | NAA40 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUSC; OV; PAAD; STAD | MirTarget; miRanda; miRNATAP | TCGA BLCA -0.083; TCGA BRCA -0.122; TCGA COAD -0.075; TCGA ESCA -0.076; TCGA KIRP -0.07; TCGA LGG -0.098; TCGA LIHC -0.067; TCGA LUSC -0.097; TCGA OV -0.065; TCGA PAAD -0.075; TCGA STAD -0.084 |
hsa-miR-199a-5p | LARP4 | 10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.092; TCGA BRCA -0.067; TCGA CESC -0.077; TCGA COAD -0.145; TCGA HNSC -0.087; TCGA LUAD -0.195; TCGA LUSC -0.11; TCGA PRAD -0.136; TCGA STAD -0.151; TCGA UCEC -0.057 |
hsa-miR-199a-5p | SNRNP48 | 9 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; OV; PRAD; STAD | MirTarget; miRanda | TCGA BLCA -0.096; TCGA CESC -0.071; TCGA COAD -0.144; TCGA HNSC -0.074; TCGA KIRC -0.053; TCGA LUAD -0.06; TCGA OV -0.055; TCGA PRAD -0.067; TCGA STAD -0.084 |
hsa-miR-199a-5p | MGAT4B | 9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; OV; SARC; UCEC | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.055; TCGA BRCA -0.093; TCGA CESC -0.079; TCGA ESCA -0.395; TCGA KIRC -0.115; TCGA KIRP -0.097; TCGA OV -0.075; TCGA SARC -0.069; TCGA UCEC -0.072 |
hsa-miR-199a-5p | LIN7C | 9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; PRAD; SARC; THCA; STAD | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.093; TCGA BRCA -0.072; TCGA COAD -0.145; TCGA HNSC -0.058; TCGA LUAD -0.118; TCGA PRAD -0.156; TCGA SARC -0.079; TCGA THCA -0.061; TCGA STAD -0.088 |
hsa-miR-199a-5p | MPP5 | 10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; THCA; STAD | MirTarget; PITA; miRanda; miRNATAP | TCGA BLCA -0.108; TCGA COAD -0.137; TCGA ESCA -0.112; TCGA HNSC -0.124; TCGA LUAD -0.158; TCGA LUSC -0.088; TCGA OV -0.072; TCGA PRAD -0.231; TCGA THCA -0.056; TCGA STAD -0.15 |
hsa-miR-199a-5p | PHF6 | 10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD | PITA; miRanda | TCGA BLCA -0.11; TCGA BRCA -0.088; TCGA COAD -0.091; TCGA HNSC -0.122; TCGA LGG -0.127; TCGA LIHC -0.064; TCGA LUAD -0.089; TCGA LUSC -0.146; TCGA PRAD -0.123; TCGA STAD -0.105 |
hsa-miR-199a-5p | ACVR2B | 11 cancers: BLCA; BRCA; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA | PITA; miRNATAP | TCGA BLCA -0.113; TCGA BRCA -0.085; TCGA KIRP -0.08; TCGA LGG -0.229; TCGA LUAD -0.147; TCGA LUSC -0.18; TCGA OV -0.083; TCGA PAAD -0.274; TCGA PRAD -0.149; TCGA SARC -0.076; TCGA THCA -0.057 |
hsa-miR-199a-5p | AKAP1 | 12 cancers: BLCA; BRCA; ESCA; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD | PITA; miRanda; miRNATAP | TCGA BLCA -0.122; TCGA BRCA -0.104; TCGA ESCA -0.286; TCGA LGG -0.055; TCGA LUAD -0.099; TCGA LUSC -0.245; TCGA OV -0.064; TCGA PAAD -0.14; TCGA PRAD -0.092; TCGA SARC -0.459; TCGA THCA -0.072; TCGA STAD -0.16 |
hsa-miR-199a-5p | ACVR1B | 9 cancers: BLCA; ESCA; HNSC; LUAD; OV; PRAD; THCA; STAD; UCEC | PITA; miRanda; miRNATAP | TCGA BLCA -0.132; TCGA ESCA -0.141; TCGA HNSC -0.082; TCGA LUAD -0.095; TCGA OV -0.058; TCGA PRAD -0.172; TCGA THCA -0.085; TCGA STAD -0.124; TCGA UCEC -0.112 |
hsa-miR-199a-5p | ONECUT2 | 9 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; THCA; UCEC | PITA; miRNATAP | TCGA BLCA -0.262; TCGA BRCA -0.415; TCGA ESCA -0.757; TCGA HNSC -0.293; TCGA KIRP -0.301; TCGA LGG -0.189; TCGA LIHC -0.191; TCGA THCA -0.109; TCGA UCEC -0.18 |
hsa-miR-199a-5p | ARIH2 | 9 cancers: BLCA; CESC; ESCA; LIHC; LUSC; OV; PAAD; SARC; STAD | PITA; miRanda; miRNATAP | TCGA BLCA -0.077; TCGA CESC -0.054; TCGA ESCA -0.171; TCGA LIHC -0.071; TCGA LUSC -0.059; TCGA OV -0.056; TCGA PAAD -0.156; TCGA SARC -0.1; TCGA STAD -0.062 |
hsa-miR-199a-5p | BTBD3 | 9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PAAD; PRAD; THCA; STAD | PITA; miRanda; miRNATAP | TCGA BLCA -0.157; TCGA BRCA -0.071; TCGA COAD -0.117; TCGA ESCA -0.133; TCGA LUAD -0.13; TCGA PAAD -0.297; TCGA PRAD -0.085; TCGA THCA -0.068; TCGA STAD -0.185 |
hsa-miR-199a-5p | FBXO28 | 9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PRAD; SARC; STAD | PITA; miRanda | TCGA BLCA -0.09; TCGA BRCA -0.056; TCGA COAD -0.12; TCGA HNSC -0.063; TCGA LUAD -0.066; TCGA LUSC -0.063; TCGA PRAD -0.106; TCGA SARC -0.069; TCGA STAD -0.119 |
hsa-miR-199a-5p | RAB10 | 9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; LUSC; PRAD; STAD | PITA; miRanda; miRNATAP | TCGA BLCA -0.097; TCGA BRCA -0.105; TCGA COAD -0.096; TCGA HNSC -0.102; TCGA LGG -0.054; TCGA LUAD -0.124; TCGA LUSC -0.069; TCGA PRAD -0.098; TCGA STAD -0.16 |
hsa-miR-199a-5p | ZCCHC2 | 9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; OV; PRAD; SARC | PITA; miRanda; miRNATAP | TCGA BLCA -0.164; TCGA BRCA -0.071; TCGA COAD -0.127; TCGA HNSC -0.133; TCGA KIRC -0.076; TCGA LUAD -0.167; TCGA OV -0.06; TCGA PRAD -0.127; TCGA SARC -0.17 |
hsa-miR-199a-5p | PRPF40A | 10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; STAD | PITA; miRanda; miRNATAP | TCGA BLCA -0.079; TCGA BRCA -0.053; TCGA COAD -0.127; TCGA HNSC -0.07; TCGA LGG -0.058; TCGA LUAD -0.133; TCGA LUSC -0.108; TCGA OV -0.088; TCGA PRAD -0.13; TCGA STAD -0.068 |
hsa-miR-199a-5p | ARHGAP12 | 11 cancers: BLCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD | PITA; miRanda; miRNATAP | TCGA BLCA -0.132; TCGA COAD -0.07; TCGA ESCA -0.297; TCGA HNSC -0.057; TCGA LGG -0.156; TCGA LIHC -0.056; TCGA LUAD -0.142; TCGA LUSC -0.115; TCGA PRAD -0.132; TCGA SARC -0.053; TCGA STAD -0.139 |
hsa-miR-199a-5p | ZCCHC4 | 9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; STAD | PITA; miRanda | TCGA BLCA -0.125; TCGA COAD -0.105; TCGA ESCA -0.093; TCGA HNSC -0.08; TCGA KIRC -0.074; TCGA KIRP -0.061; TCGA LUAD -0.074; TCGA PRAD -0.076; TCGA STAD -0.11 |
hsa-miR-199a-5p | PDIK1L | 10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUSC; OV; PRAD; THCA; STAD | PITA; miRanda; miRNATAP | TCGA BLCA -0.073; TCGA BRCA -0.09; TCGA COAD -0.073; TCGA HNSC -0.064; TCGA LGG -0.06; TCGA LUSC -0.078; TCGA OV -0.062; TCGA PRAD -0.1; TCGA THCA -0.084; TCGA STAD -0.128 |
hsa-miR-199a-5p | RCCD1 | 12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; SARC; UCEC | miRanda | TCGA BLCA -0.06; TCGA BRCA -0.19; TCGA COAD -0.132; TCGA HNSC -0.053; TCGA KIRC -0.069; TCGA KIRP -0.057; TCGA LGG -0.076; TCGA LIHC -0.116; TCGA LUSC -0.151; TCGA OV -0.081; TCGA SARC -0.064; TCGA UCEC -0.051 |
hsa-miR-199a-5p | CHCHD4 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.056; TCGA BRCA -0.145; TCGA CESC -0.112; TCGA COAD -0.095; TCGA ESCA -0.205; TCGA HNSC -0.06; TCGA LIHC -0.095; TCGA LUAD -0.083; TCGA LUSC -0.136; TCGA PAAD -0.162; TCGA SARC -0.056; TCGA STAD -0.112; TCGA UCEC -0.077 |
hsa-miR-199a-5p | MTRR | 10 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.068; TCGA CESC -0.137; TCGA COAD -0.132; TCGA HNSC -0.057; TCGA KIRC -0.059; TCGA LUAD -0.14; TCGA PAAD -0.072; TCGA PRAD -0.18; TCGA SARC -0.057; TCGA STAD -0.072 |
hsa-miR-199a-5p | HNRNPF | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD | miRanda | TCGA BLCA -0.071; TCGA BRCA -0.085; TCGA COAD -0.119; TCGA ESCA -0.138; TCGA HNSC -0.096; TCGA LUAD -0.138; TCGA LUSC -0.091; TCGA PRAD -0.083; TCGA STAD -0.137 |
hsa-miR-199a-5p | SFXN1 | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.062; TCGA BRCA -0.164; TCGA CESC -0.074; TCGA COAD -0.208; TCGA HNSC -0.113; TCGA KIRC -0.126; TCGA LGG -0.06; TCGA LUAD -0.088; TCGA PAAD -0.144; TCGA PRAD -0.061; TCGA THCA -0.051; TCGA STAD -0.166; TCGA UCEC -0.056 |
hsa-miR-199a-5p | TRIM35 | 9 cancers: BLCA; COAD; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.073; TCGA COAD -0.094; TCGA HNSC -0.089; TCGA KIRP -0.069; TCGA LUAD -0.064; TCGA LUSC -0.093; TCGA PRAD -0.078; TCGA SARC -0.075; TCGA STAD -0.062 |
hsa-miR-199a-5p | RALGAPA1 | 9 cancers: BLCA; COAD; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRanda; miRNATAP | TCGA BLCA -0.148; TCGA COAD -0.164; TCGA LGG -0.076; TCGA LUAD -0.109; TCGA LUSC -0.097; TCGA OV -0.056; TCGA PAAD -0.15; TCGA PRAD -0.126; TCGA STAD -0.074 |
hsa-miR-199a-5p | E2F5 | 12 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC | miRanda | TCGA BLCA -0.097; TCGA BRCA -0.303; TCGA COAD -0.154; TCGA ESCA -0.37; TCGA LGG -0.14; TCGA LIHC -0.066; TCGA LUAD -0.152; TCGA LUSC -0.13; TCGA OV -0.092; TCGA PAAD -0.153; TCGA THCA -0.061; TCGA UCEC -0.074 |
hsa-miR-199a-5p | GRPEL1 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC | miRanda | TCGA BLCA -0.068; TCGA BRCA -0.128; TCGA CESC -0.11; TCGA COAD -0.14; TCGA ESCA -0.187; TCGA HNSC -0.065; TCGA LUAD -0.125; TCGA LUSC -0.102; TCGA PAAD -0.087; TCGA STAD -0.174; TCGA UCEC -0.093 |
hsa-miR-199a-5p | TCOF1 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; SARC; UCEC | miRanda | TCGA BLCA -0.074; TCGA BRCA -0.132; TCGA CESC -0.113; TCGA HNSC -0.113; TCGA KIRC -0.071; TCGA KIRP -0.06; TCGA LIHC -0.104; TCGA LUSC -0.106; TCGA PAAD -0.14; TCGA SARC -0.052; TCGA UCEC -0.077 |
hsa-miR-199a-5p | GCH1 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.074; TCGA BRCA -0.144; TCGA COAD -0.178; TCGA ESCA -0.134; TCGA HNSC -0.177; TCGA LUAD -0.176; TCGA LUSC -0.17; TCGA PAAD -0.265; TCGA SARC -0.123; TCGA STAD -0.15; TCGA UCEC -0.11 |
hsa-miR-199a-5p | PDSS1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BLCA -0.059; TCGA BRCA -0.186; TCGA CESC -0.101; TCGA COAD -0.1; TCGA ESCA -0.298; TCGA HNSC -0.133; TCGA KIRC -0.075; TCGA LGG -0.113; TCGA LUAD -0.182; TCGA LUSC -0.168; TCGA OV -0.074; TCGA STAD -0.147; TCGA UCEC -0.115 |
hsa-miR-199a-5p | HLTF | 9 cancers: BLCA; BRCA; LIHC; LUAD; OV; PAAD; PRAD; THCA; UCEC | miRanda | TCGA BLCA -0.069; TCGA BRCA -0.138; TCGA LIHC -0.082; TCGA LUAD -0.109; TCGA OV -0.084; TCGA PAAD -0.163; TCGA PRAD -0.073; TCGA THCA -0.065; TCGA UCEC -0.1 |
hsa-miR-199a-5p | PLEKHH1 | 11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA; STAD | miRanda; miRNATAP | TCGA BLCA -0.262; TCGA BRCA -0.102; TCGA ESCA -0.599; TCGA HNSC -0.258; TCGA KIRP -0.189; TCGA LIHC -0.094; TCGA LUSC -0.21; TCGA PAAD -0.205; TCGA PRAD -0.195; TCGA THCA -0.069; TCGA STAD -0.177 |
hsa-miR-199a-5p | BRCA1 | 14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD | miRanda | TCGA BLCA -0.072; TCGA BRCA -0.14; TCGA CESC -0.076; TCGA COAD -0.148; TCGA HNSC -0.213; TCGA KIRC -0.07; TCGA KIRP -0.074; TCGA LIHC -0.144; TCGA LUAD -0.167; TCGA LUSC -0.213; TCGA PRAD -0.089; TCGA SARC -0.104; TCGA THCA -0.059; TCGA STAD -0.156 |
hsa-miR-199a-5p | LARS | 9 cancers: BLCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; STAD | miRanda | TCGA BLCA -0.071; TCGA COAD -0.079; TCGA HNSC -0.06; TCGA LGG -0.084; TCGA LIHC -0.062; TCGA LUAD -0.094; TCGA LUSC -0.108; TCGA PAAD -0.073; TCGA STAD -0.057 |
hsa-miR-199a-5p | CDK7 | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BLCA -0.081; TCGA BRCA -0.065; TCGA CESC -0.077; TCGA ESCA -0.131; TCGA HNSC -0.068; TCGA KIRC -0.145; TCGA KIRP -0.08; TCGA LIHC -0.067; TCGA LUAD -0.114; TCGA LUSC -0.105; TCGA OV -0.08; TCGA STAD -0.117; TCGA UCEC -0.069 |
hsa-miR-199a-5p | PDHX | 10 cancers: BLCA; BRCA; COAD; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD | miRanda | TCGA BLCA -0.065; TCGA BRCA -0.184; TCGA COAD -0.151; TCGA LUAD -0.163; TCGA LUSC -0.067; TCGA OV -0.101; TCGA PAAD -0.073; TCGA SARC -0.074; TCGA THCA -0.055; TCGA STAD -0.115 |
hsa-miR-199a-5p | MRPL22 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda; miRNATAP | TCGA BLCA -0.083; TCGA BRCA -0.081; TCGA CESC -0.064; TCGA COAD -0.129; TCGA ESCA -0.109; TCGA HNSC -0.07; TCGA KIRC -0.155; TCGA KIRP -0.055; TCGA LIHC -0.077; TCGA LUAD -0.089; TCGA LUSC -0.147; TCGA OV -0.098; TCGA PAAD -0.158; TCGA STAD -0.088; TCGA UCEC -0.084 |
hsa-miR-199a-5p | SMARCAD1 | 9 cancers: BLCA; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; STAD | miRanda; miRNATAP | TCGA BLCA -0.148; TCGA COAD -0.115; TCGA HNSC -0.063; TCGA LGG -0.073; TCGA LUAD -0.083; TCGA LUSC -0.064; TCGA OV -0.078; TCGA PRAD -0.173; TCGA STAD -0.079 |
hsa-miR-199a-5p | GOSR1 | 10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRanda; miRNATAP | TCGA BLCA -0.061; TCGA BRCA -0.063; TCGA COAD -0.1; TCGA ESCA -0.109; TCGA LUAD -0.056; TCGA LUSC -0.092; TCGA PAAD -0.122; TCGA PRAD -0.117; TCGA THCA -0.059; TCGA STAD -0.089 |
hsa-miR-199a-5p | MAT2A | 9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LGG; LUSC; SARC; STAD | miRanda | TCGA BLCA -0.106; TCGA COAD -0.147; TCGA ESCA -0.126; TCGA HNSC -0.063; TCGA KIRC -0.087; TCGA LGG -0.07; TCGA LUSC -0.082; TCGA SARC -0.104; TCGA STAD -0.123 |
hsa-miR-199a-5p | RAD21 | 9 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; LUSC; PRAD; STAD | miRanda | TCGA BLCA -0.062; TCGA BRCA -0.228; TCGA COAD -0.152; TCGA HNSC -0.112; TCGA LGG -0.087; TCGA LUAD -0.204; TCGA LUSC -0.104; TCGA PRAD -0.125; TCGA STAD -0.132 |
hsa-miR-199a-5p | BAG1 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; PAAD; SARC; THCA; STAD | miRanda | TCGA BLCA -0.068; TCGA BRCA -0.11; TCGA CESC -0.085; TCGA ESCA -0.244; TCGA HNSC -0.08; TCGA LUAD -0.117; TCGA PAAD -0.238; TCGA SARC -0.088; TCGA THCA -0.052; TCGA STAD -0.204 |
hsa-miR-199a-5p | PRPS2 | 10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.126; TCGA BRCA -0.109; TCGA COAD -0.148; TCGA HNSC -0.127; TCGA LUAD -0.074; TCGA LUSC -0.122; TCGA OV -0.087; TCGA PRAD -0.078; TCGA SARC -0.317; TCGA STAD -0.167 |
hsa-miR-199a-5p | MRPS35 | 10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.065; TCGA BRCA -0.105; TCGA COAD -0.153; TCGA ESCA -0.239; TCGA LUAD -0.197; TCGA LUSC -0.142; TCGA PAAD -0.153; TCGA THCA -0.06; TCGA STAD -0.183; TCGA UCEC -0.106 |
hsa-miR-199a-5p | RBMX | 11 cancers: BLCA; BRCA; COAD; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD | miRanda | TCGA BLCA -0.074; TCGA BRCA -0.071; TCGA COAD -0.103; TCGA KIRC -0.095; TCGA LGG -0.071; TCGA LIHC -0.058; TCGA LUAD -0.091; TCGA LUSC -0.111; TCGA OV -0.089; TCGA PAAD -0.08; TCGA STAD -0.08 |
hsa-miR-199a-5p | RBM47 | 10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRanda; miRNATAP | TCGA BLCA -0.098; TCGA COAD -0.194; TCGA ESCA -0.556; TCGA HNSC -0.237; TCGA LUAD -0.133; TCGA LUSC -0.155; TCGA PRAD -0.213; TCGA THCA -0.074; TCGA STAD -0.283; TCGA UCEC -0.193 |
hsa-miR-199a-5p | SMC4 | 12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.083; TCGA BRCA -0.239; TCGA COAD -0.139; TCGA HNSC -0.153; TCGA KIRC -0.076; TCGA LIHC -0.082; TCGA LUAD -0.195; TCGA LUSC -0.135; TCGA OV -0.066; TCGA SARC -0.119; TCGA STAD -0.137; TCGA UCEC -0.148 |
hsa-miR-199a-5p | RFC1 | 9 cancers: BLCA; COAD; HNSC; LIHC; LUAD; OV; PAAD; PRAD; STAD | miRanda | TCGA BLCA -0.059; TCGA COAD -0.092; TCGA HNSC -0.109; TCGA LIHC -0.082; TCGA LUAD -0.131; TCGA OV -0.051; TCGA PAAD -0.098; TCGA PRAD -0.122; TCGA STAD -0.075 |
hsa-miR-199a-5p | PDE12 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.102; TCGA COAD -0.146; TCGA ESCA -0.25; TCGA HNSC -0.06; TCGA LUAD -0.128; TCGA LUSC -0.091; TCGA PRAD -0.149; TCGA SARC -0.062; TCGA STAD -0.187 |
hsa-miR-199a-5p | MFSD6 | 10 cancers: BLCA; COAD; HNSC; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD | miRanda; miRNATAP | TCGA BLCA -0.114; TCGA COAD -0.102; TCGA HNSC -0.084; TCGA LUAD -0.072; TCGA OV -0.067; TCGA PAAD -0.127; TCGA PRAD -0.17; TCGA SARC -0.269; TCGA THCA -0.084; TCGA STAD -0.172 |
hsa-miR-199a-5p | LSM12 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.05; TCGA BRCA -0.093; TCGA CESC -0.078; TCGA COAD -0.153; TCGA ESCA -0.087; TCGA HNSC -0.057; TCGA LIHC -0.059; TCGA LUAD -0.107; TCGA LUSC -0.122; TCGA PRAD -0.075; TCGA THCA -0.069; TCGA STAD -0.115; TCGA UCEC -0.06 |
hsa-miR-199a-5p | MAPK9 | 9 cancers: BLCA; CESC; COAD; LUAD; LUSC; PAAD; SARC; THCA; STAD | miRanda | TCGA BLCA -0.075; TCGA CESC -0.059; TCGA COAD -0.072; TCGA LUAD -0.072; TCGA LUSC -0.07; TCGA PAAD -0.108; TCGA SARC -0.087; TCGA THCA -0.077; TCGA STAD -0.066 |
hsa-miR-199a-5p | LRBA | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD | miRanda | TCGA BLCA -0.101; TCGA COAD -0.142; TCGA ESCA -0.142; TCGA HNSC -0.121; TCGA LUAD -0.125; TCGA LUSC -0.14; TCGA PAAD -0.109; TCGA PRAD -0.156; TCGA STAD -0.206 |
hsa-miR-199a-5p | TNK1 | 9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.13; TCGA BRCA -0.092; TCGA ESCA -0.155; TCGA HNSC -0.079; TCGA KIRC -0.098; TCGA KIRP -0.077; TCGA THCA -0.051; TCGA STAD -0.188; TCGA UCEC -0.079 |
hsa-miR-199a-5p | NFX1 | 9 cancers: BLCA; BRCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; STAD | miRanda | TCGA BLCA -0.096; TCGA BRCA -0.069; TCGA HNSC -0.098; TCGA KIRC -0.06; TCGA LUAD -0.111; TCGA OV -0.067; TCGA PAAD -0.1; TCGA PRAD -0.073; TCGA STAD -0.098 |
hsa-miR-199a-5p | VEGFA | 10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; PRAD; THCA; STAD; UCEC | miRanda; miRNATAP | TCGA BLCA -0.206; TCGA BRCA -0.179; TCGA CESC -0.138; TCGA ESCA -0.212; TCGA KIRC -0.583; TCGA LIHC -0.069; TCGA PRAD -0.351; TCGA THCA -0.078; TCGA STAD -0.151; TCGA UCEC -0.091 |
hsa-miR-199a-5p | GALE | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; OV; STAD; UCEC | miRanda | TCGA BLCA -0.076; TCGA BRCA -0.114; TCGA CESC -0.1; TCGA ESCA -0.551; TCGA HNSC -0.107; TCGA KIRC -0.135; TCGA KIRP -0.071; TCGA LIHC -0.081; TCGA OV -0.076; TCGA STAD -0.336; TCGA UCEC -0.106 |
hsa-miR-199a-5p | ING3 | 10 cancers: BLCA; BRCA; COAD; KIRC; LGG; LUAD; LUSC; OV; PRAD; STAD | miRanda | TCGA BLCA -0.083; TCGA BRCA -0.054; TCGA COAD -0.119; TCGA KIRC -0.074; TCGA LGG -0.083; TCGA LUAD -0.122; TCGA LUSC -0.098; TCGA OV -0.068; TCGA PRAD -0.106; TCGA STAD -0.058 |
hsa-miR-199a-5p | ZNF274 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; OV; SARC | miRanda | TCGA BLCA -0.105; TCGA BRCA -0.063; TCGA CESC -0.099; TCGA HNSC -0.09; TCGA KIRC -0.093; TCGA KIRP -0.053; TCGA LGG -0.096; TCGA OV -0.073; TCGA SARC -0.136 |
hsa-miR-199a-5p | SUCLA2 | 10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.06; TCGA COAD -0.094; TCGA ESCA -0.092; TCGA HNSC -0.077; TCGA LUAD -0.121; TCGA LUSC -0.078; TCGA PAAD -0.091; TCGA PRAD -0.107; TCGA THCA -0.05; TCGA STAD -0.152 |
hsa-miR-199a-5p | PTCD3 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD | miRanda | TCGA BLCA -0.095; TCGA BRCA -0.116; TCGA CESC -0.054; TCGA COAD -0.119; TCGA ESCA -0.089; TCGA LGG -0.071; TCGA LIHC -0.067; TCGA LUAD -0.121; TCGA LUSC -0.139; TCGA OV -0.07; TCGA PAAD -0.111; TCGA STAD -0.138 |
hsa-miR-199a-5p | EEF1A1 | 9 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; STAD | miRanda | TCGA BLCA -0.071; TCGA COAD -0.101; TCGA ESCA -0.082; TCGA LGG -0.13; TCGA LUAD -0.124; TCGA LUSC -0.075; TCGA PAAD -0.081; TCGA PRAD -0.133; TCGA STAD -0.1 |
hsa-miR-199a-5p | ZNF765 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; OV; PRAD; SARC | miRanda | TCGA BLCA -0.051; TCGA BRCA -0.067; TCGA COAD -0.15; TCGA ESCA -0.116; TCGA HNSC -0.058; TCGA LUAD -0.107; TCGA OV -0.066; TCGA PRAD -0.188; TCGA SARC -0.076 |
hsa-miR-199a-5p | GHITM | 10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.062; TCGA BRCA -0.085; TCGA COAD -0.07; TCGA ESCA -0.134; TCGA LUAD -0.157; TCGA LUSC -0.069; TCGA PAAD -0.078; TCGA THCA -0.054; TCGA STAD -0.138; TCGA UCEC -0.057 |
hsa-miR-199a-5p | TBCE | 11 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; LUSC; OV; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.056; TCGA BRCA -0.121; TCGA COAD -0.112; TCGA KIRC -0.08; TCGA LIHC -0.103; TCGA LUAD -0.088; TCGA LUSC -0.117; TCGA OV -0.065; TCGA THCA -0.072; TCGA STAD -0.118; TCGA UCEC -0.125 |
hsa-miR-199a-5p | INTS12 | 9 cancers: BLCA; COAD; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRanda | TCGA BLCA -0.066; TCGA COAD -0.085; TCGA LGG -0.073; TCGA LUAD -0.072; TCGA LUSC -0.067; TCGA OV -0.073; TCGA PAAD -0.09; TCGA PRAD -0.053; TCGA STAD -0.118 |
hsa-miR-199a-5p | SAP130 | 10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD | miRanda | TCGA BLCA -0.055; TCGA BRCA -0.059; TCGA COAD -0.11; TCGA HNSC -0.076; TCGA LGG -0.068; TCGA LIHC -0.074; TCGA LUAD -0.091; TCGA LUSC -0.124; TCGA PRAD -0.114; TCGA STAD -0.066 |
hsa-miR-199a-5p | HPRT1 | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.077; TCGA BRCA -0.206; TCGA CESC -0.08; TCGA COAD -0.094; TCGA HNSC -0.085; TCGA LUAD -0.091; TCGA LUSC -0.169; TCGA OV -0.068; TCGA PAAD -0.133; TCGA SARC -0.052; TCGA STAD -0.101; TCGA UCEC -0.123 |
hsa-miR-199a-5p | AGPAT5 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.065; TCGA BRCA -0.072; TCGA COAD -0.213; TCGA ESCA -0.263; TCGA HNSC -0.116; TCGA KIRC -0.109; TCGA LGG -0.09; TCGA LUAD -0.165; TCGA LUSC -0.111; TCGA OV -0.083; TCGA PRAD -0.088; TCGA THCA -0.085; TCGA STAD -0.166 |
hsa-miR-199a-5p | GPD2 | 10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD | miRanda; miRNATAP | TCGA BLCA -0.122; TCGA BRCA -0.079; TCGA COAD -0.128; TCGA HNSC -0.158; TCGA LUAD -0.162; TCGA LUSC -0.145; TCGA OV -0.072; TCGA PRAD -0.206; TCGA SARC -0.081; TCGA STAD -0.235 |
hsa-miR-199a-5p | OCRL | 10 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA | miRanda | TCGA BLCA -0.137; TCGA BRCA -0.07; TCGA HNSC -0.05; TCGA LIHC -0.058; TCGA LUAD -0.079; TCGA LUSC -0.173; TCGA PAAD -0.235; TCGA PRAD -0.088; TCGA SARC -0.09; TCGA THCA -0.073 |
hsa-miR-199a-5p | GTF3C2 | 11 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.06; TCGA BRCA -0.118; TCGA COAD -0.074; TCGA HNSC -0.07; TCGA LGG -0.068; TCGA LIHC -0.067; TCGA LUAD -0.079; TCGA LUSC -0.107; TCGA PRAD -0.098; TCGA STAD -0.095; TCGA UCEC -0.052 |
hsa-miR-199a-5p | TUBG1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; OV; PAAD; SARC; THCA; STAD | miRanda; miRNATAP | TCGA BLCA -0.081; TCGA BRCA -0.193; TCGA CESC -0.058; TCGA COAD -0.112; TCGA ESCA -0.185; TCGA HNSC -0.129; TCGA KIRP -0.057; TCGA LIHC -0.13; TCGA LUSC -0.177; TCGA OV -0.052; TCGA PAAD -0.214; TCGA SARC -0.179; TCGA THCA -0.074; TCGA STAD -0.138 |
hsa-miR-199a-5p | SYNCRIP | 9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; OV; PRAD; STAD | miRanda | TCGA BLCA -0.09; TCGA BRCA -0.064; TCGA COAD -0.097; TCGA HNSC -0.06; TCGA LUAD -0.105; TCGA LUSC -0.076; TCGA OV -0.07; TCGA PRAD -0.149; TCGA STAD -0.081 |
hsa-miR-199a-5p | TMEM69 | 10 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; OV; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.067; TCGA BRCA -0.129; TCGA COAD -0.151; TCGA HNSC -0.076; TCGA LIHC -0.105; TCGA LUAD -0.053; TCGA OV -0.085; TCGA THCA -0.059; TCGA STAD -0.127; TCGA UCEC -0.073 |
hsa-miR-199a-5p | THOC1 | 9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; UCEC | miRanda | TCGA BLCA -0.066; TCGA BRCA -0.079; TCGA KIRC -0.113; TCGA KIRP -0.073; TCGA LGG -0.088; TCGA LIHC -0.06; TCGA LUSC -0.157; TCGA OV -0.086; TCGA UCEC -0.071 |
hsa-miR-199a-5p | ARL6IP1 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.112; TCGA BRCA -0.131; TCGA COAD -0.125; TCGA ESCA -0.127; TCGA HNSC -0.12; TCGA LUAD -0.103; TCGA LUSC -0.182; TCGA OV -0.119; TCGA PRAD -0.068; TCGA STAD -0.221; TCGA UCEC -0.082 |
hsa-miR-199a-5p | NFATC2IP | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; SARC | miRanda | TCGA BLCA -0.111; TCGA BRCA -0.071; TCGA COAD -0.076; TCGA ESCA -0.1; TCGA HNSC -0.105; TCGA KIRC -0.099; TCGA KIRP -0.093; TCGA LGG -0.06; TCGA LIHC -0.053; TCGA LUSC -0.102; TCGA OV -0.058; TCGA SARC -0.215 |
hsa-miR-199a-5p | NT5DC1 | 9 cancers: BLCA; HNSC; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.126; TCGA HNSC -0.088; TCGA LUAD -0.104; TCGA OV -0.085; TCGA PRAD -0.17; TCGA SARC -0.124; TCGA THCA -0.057; TCGA STAD -0.16; TCGA UCEC -0.067 |
hsa-miR-199a-5p | CNOT10 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.058; TCGA BRCA -0.098; TCGA CESC -0.075; TCGA COAD -0.096; TCGA ESCA -0.158; TCGA HNSC -0.059; TCGA LIHC -0.09; TCGA LUAD -0.122; TCGA LUSC -0.102; TCGA OV -0.094; TCGA PAAD -0.092; TCGA SARC -0.054; TCGA STAD -0.126; TCGA UCEC -0.059 |
hsa-miR-199a-5p | TTC19 | 9 cancers: BLCA; ESCA; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.06; TCGA ESCA -0.079; TCGA LUAD -0.117; TCGA LUSC -0.126; TCGA OV -0.075; TCGA PAAD -0.21; TCGA PRAD -0.064; TCGA THCA -0.063; TCGA STAD -0.136 |
hsa-miR-199a-5p | PEX3 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; PRAD; STAD | miRanda | TCGA BLCA -0.064; TCGA CESC -0.076; TCGA COAD -0.113; TCGA ESCA -0.106; TCGA HNSC -0.058; TCGA LUAD -0.071; TCGA OV -0.111; TCGA PAAD -0.077; TCGA PRAD -0.148; TCGA STAD -0.117 |
hsa-miR-199a-5p | TMEM164 | 9 cancers: BLCA; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.068; TCGA ESCA -0.232; TCGA HNSC -0.073; TCGA LUAD -0.081; TCGA LUSC -0.099; TCGA PAAD -0.208; TCGA PRAD -0.088; TCGA STAD -0.163; TCGA UCEC -0.13 |
hsa-miR-199a-5p | TMPO | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.055; TCGA BRCA -0.172; TCGA COAD -0.22; TCGA ESCA -0.101; TCGA HNSC -0.177; TCGA LIHC -0.06; TCGA LUAD -0.238; TCGA LUSC -0.186; TCGA OV -0.088; TCGA PRAD -0.082; TCGA SARC -0.057; TCGA STAD -0.165 |
hsa-miR-199a-5p | CLINT1 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.127; TCGA COAD -0.138; TCGA ESCA -0.149; TCGA HNSC -0.099; TCGA LUAD -0.067; TCGA LUSC -0.079; TCGA PRAD -0.167; TCGA STAD -0.194; TCGA UCEC -0.051 |
hsa-miR-199a-5p | INTS7 | 14 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.065; TCGA BRCA -0.148; TCGA CESC -0.053; TCGA COAD -0.144; TCGA HNSC -0.096; TCGA LGG -0.054; TCGA LIHC -0.056; TCGA LUAD -0.107; TCGA LUSC -0.096; TCGA OV -0.073; TCGA PRAD -0.165; TCGA SARC -0.085; TCGA STAD -0.136; TCGA UCEC -0.074 |
hsa-miR-199a-5p | SLC38A1 | 11 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; UCEC | miRanda | TCGA BLCA -0.172; TCGA CESC -0.12; TCGA COAD -0.141; TCGA HNSC -0.166; TCGA KIRC -0.172; TCGA KIRP -0.075; TCGA LGG -0.092; TCGA LUAD -0.203; TCGA PRAD -0.16; TCGA SARC -0.386; TCGA UCEC -0.195 |
hsa-miR-199a-5p | UTP14A | 9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; STAD; UCEC | miRanda | TCGA BLCA -0.054; TCGA BRCA -0.086; TCGA CESC -0.062; TCGA HNSC -0.08; TCGA LIHC -0.091; TCGA LUAD -0.075; TCGA LUSC -0.162; TCGA STAD -0.087; TCGA UCEC -0.077 |
hsa-miR-199a-5p | TCERG1 | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC | miRanda | TCGA BLCA -0.151; TCGA BRCA -0.068; TCGA COAD -0.111; TCGA HNSC -0.1; TCGA KIRC -0.151; TCGA KIRP -0.07; TCGA LGG -0.076; TCGA LIHC -0.053; TCGA LUAD -0.056; TCGA LUSC -0.109 |
hsa-miR-199a-5p | NIF3L1 | 9 cancers: BLCA; BRCA; CESC; COAD; LUAD; LUSC; OV; PAAD; STAD | miRanda | TCGA BLCA -0.072; TCGA BRCA -0.097; TCGA CESC -0.055; TCGA COAD -0.093; TCGA LUAD -0.1; TCGA LUSC -0.163; TCGA OV -0.098; TCGA PAAD -0.053; TCGA STAD -0.084 |
hsa-miR-199a-5p | OAS3 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; OV; SARC | miRanda | TCGA BLCA -0.146; TCGA BRCA -0.264; TCGA CESC -0.237; TCGA ESCA -0.201; TCGA HNSC -0.317; TCGA KIRC -0.105; TCGA LUAD -0.116; TCGA OV -0.175; TCGA SARC -0.132 |
hsa-miR-199a-5p | RBBP5 | 9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.119; TCGA BRCA -0.066; TCGA COAD -0.11; TCGA HNSC -0.088; TCGA LUAD -0.101; TCGA LUSC -0.072; TCGA PRAD -0.231; TCGA SARC -0.061; TCGA STAD -0.09 |
hsa-miR-199a-5p | MRPS22 | 9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BLCA -0.074; TCGA BRCA -0.097; TCGA COAD -0.142; TCGA HNSC -0.077; TCGA LUAD -0.117; TCGA LUSC -0.077; TCGA OV -0.065; TCGA STAD -0.148; TCGA UCEC -0.102 |
hsa-miR-199a-5p | SUZ12 | 11 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.079; TCGA BRCA -0.1; TCGA COAD -0.166; TCGA HNSC -0.131; TCGA LIHC -0.06; TCGA LUAD -0.143; TCGA LUSC -0.176; TCGA PRAD -0.15; TCGA SARC -0.13; TCGA STAD -0.137; TCGA UCEC -0.055 |
hsa-miR-199a-5p | SNRNP200 | 9 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD | miRanda | TCGA BLCA -0.078; TCGA BRCA -0.053; TCGA HNSC -0.092; TCGA LGG -0.108; TCGA LIHC -0.063; TCGA LUAD -0.084; TCGA LUSC -0.123; TCGA PRAD -0.109; TCGA STAD -0.099 |
hsa-miR-199a-5p | HCCS | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.066; TCGA BRCA -0.107; TCGA CESC -0.095; TCGA ESCA -0.154; TCGA HNSC -0.09; TCGA LUAD -0.052; TCGA LUSC -0.103; TCGA SARC -0.066; TCGA STAD -0.128; TCGA UCEC -0.073 |
hsa-miR-199a-5p | EGLN1 | 9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.068; TCGA BRCA -0.087; TCGA CESC -0.059; TCGA COAD -0.132; TCGA KIRC -0.094; TCGA LUAD -0.113; TCGA PRAD -0.085; TCGA THCA -0.06; TCGA STAD -0.081 |
hsa-miR-199a-5p | TMCO6 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PAAD; UCEC | miRanda | TCGA BLCA -0.096; TCGA BRCA -0.103; TCGA CESC -0.058; TCGA ESCA -0.111; TCGA HNSC -0.077; TCGA KIRC -0.181; TCGA KIRP -0.107; TCGA LIHC -0.12; TCGA LUSC -0.142; TCGA OV -0.086; TCGA PAAD -0.119; TCGA UCEC -0.051 |
hsa-miR-199a-5p | UPRT | 9 cancers: BLCA; BRCA; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.094; TCGA BRCA -0.084; TCGA ESCA -0.15; TCGA LUAD -0.053; TCGA LUSC -0.113; TCGA PAAD -0.103; TCGA PRAD -0.065; TCGA THCA -0.056; TCGA STAD -0.122 |
hsa-miR-199a-5p | VPS13A | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.187; TCGA COAD -0.103; TCGA ESCA -0.18; TCGA HNSC -0.136; TCGA KIRC -0.099; TCGA LUAD -0.072; TCGA LUSC -0.105; TCGA PRAD -0.113; TCGA SARC -0.235; TCGA STAD -0.167 |
hsa-miR-199a-5p | FAM162A | 12 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; OV; PAAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.138; TCGA BRCA -0.075; TCGA COAD -0.123; TCGA KIRC -0.107; TCGA LIHC -0.067; TCGA LUAD -0.081; TCGA OV -0.101; TCGA PAAD -0.15; TCGA SARC -0.127; TCGA THCA -0.07; TCGA STAD -0.161; TCGA UCEC -0.173 |
hsa-miR-199a-5p | BEND3 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda; miRNATAP | TCGA BLCA -0.103; TCGA BRCA -0.144; TCGA CESC -0.072; TCGA COAD -0.141; TCGA ESCA -0.209; TCGA HNSC -0.087; TCGA LGG -0.088; TCGA LIHC -0.066; TCGA LUAD -0.111; TCGA LUSC -0.08; TCGA OV -0.097; TCGA PAAD -0.154; TCGA PRAD -0.126; TCGA THCA -0.07; TCGA STAD -0.239; TCGA UCEC -0.103 |
hsa-miR-199a-5p | COX15 | 10 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.055; TCGA COAD -0.073; TCGA ESCA -0.132; TCGA LGG -0.064; TCGA LUAD -0.121; TCGA LUSC -0.063; TCGA PAAD -0.065; TCGA PRAD -0.077; TCGA THCA -0.062; TCGA STAD -0.119 |
hsa-miR-199a-5p | RPS6KB1 | 10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; STAD | miRanda | TCGA BLCA -0.08; TCGA BRCA -0.084; TCGA COAD -0.08; TCGA HNSC -0.069; TCGA LGG -0.054; TCGA LIHC -0.072; TCGA LUAD -0.096; TCGA LUSC -0.133; TCGA PRAD -0.105; TCGA STAD -0.067 |
hsa-miR-199a-5p | CCT6P1 | 9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUSC; OV; PAAD; SARC | miRanda | TCGA BLCA -0.051; TCGA BRCA -0.085; TCGA KIRC -0.157; TCGA KIRP -0.141; TCGA LGG -0.091; TCGA LUSC -0.122; TCGA OV -0.101; TCGA PAAD -0.105; TCGA SARC -0.255 |
hsa-miR-199a-5p | HK2 | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.091; TCGA BRCA -0.201; TCGA CESC -0.192; TCGA COAD -0.211; TCGA HNSC -0.135; TCGA KIRC -0.519; TCGA KIRP -0.26; TCGA LUAD -0.191; TCGA PRAD -0.18; TCGA THCA -0.073; TCGA STAD -0.348; TCGA UCEC -0.098 |
hsa-miR-199a-5p | MGST2 | 9 cancers: BLCA; COAD; ESCA; KIRC; LIHC; OV; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.108; TCGA COAD -0.123; TCGA ESCA -0.284; TCGA KIRC -0.088; TCGA LIHC -0.061; TCGA OV -0.106; TCGA SARC -0.056; TCGA STAD -0.178; TCGA UCEC -0.066 |
hsa-miR-199a-5p | CGRRF1 | 9 cancers: BLCA; COAD; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA | miRanda | TCGA BLCA -0.054; TCGA COAD -0.095; TCGA LUAD -0.054; TCGA LUSC -0.074; TCGA OV -0.074; TCGA PAAD -0.163; TCGA PRAD -0.077; TCGA SARC -0.057; TCGA THCA -0.052 |
hsa-miR-199a-5p | TOE1 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; OV; PAAD; SARC; STAD | miRanda | TCGA BLCA -0.059; TCGA BRCA -0.088; TCGA COAD -0.09; TCGA ESCA -0.239; TCGA HNSC -0.075; TCGA LIHC -0.058; TCGA OV -0.081; TCGA PAAD -0.1; TCGA SARC -0.059; TCGA STAD -0.112 |
hsa-miR-199a-5p | EED | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV | miRanda | TCGA BLCA -0.055; TCGA BRCA -0.084; TCGA CESC -0.074; TCGA COAD -0.103; TCGA ESCA -0.14; TCGA HNSC -0.104; TCGA KIRC -0.057; TCGA LGG -0.058; TCGA LUAD -0.058; TCGA LUSC -0.087; TCGA OV -0.082 |
hsa-miR-199a-5p | MNAT1 | 10 cancers: BLCA; BRCA; COAD; LGG; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRanda | TCGA BLCA -0.051; TCGA BRCA -0.06; TCGA COAD -0.098; TCGA LGG -0.058; TCGA LIHC -0.063; TCGA LUAD -0.074; TCGA LUSC -0.077; TCGA OV -0.055; TCGA PAAD -0.107; TCGA UCEC -0.058 |
hsa-miR-199a-5p | MRPS18C | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; UCEC | miRanda | TCGA BLCA -0.053; TCGA BRCA -0.087; TCGA CESC -0.077; TCGA COAD -0.104; TCGA ESCA -0.147; TCGA HNSC -0.063; TCGA KIRC -0.067; TCGA LUAD -0.083; TCGA LUSC -0.099; TCGA OV -0.093; TCGA PAAD -0.118; TCGA UCEC -0.06 |
hsa-miR-199a-5p | MBTD1 | 10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD | miRanda | TCGA BLCA -0.119; TCGA BRCA -0.098; TCGA COAD -0.086; TCGA KIRC -0.054; TCGA KIRP -0.077; TCGA LGG -0.169; TCGA LUAD -0.084; TCGA LUSC -0.207; TCGA PRAD -0.125; TCGA STAD -0.111 |
hsa-miR-199a-5p | MRS2 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.083; TCGA BRCA -0.131; TCGA CESC -0.108; TCGA COAD -0.154; TCGA ESCA -0.102; TCGA HNSC -0.076; TCGA LUAD -0.106; TCGA LUSC -0.102; TCGA OV -0.09; TCGA PAAD -0.148; TCGA PRAD -0.058; TCGA THCA -0.06; TCGA STAD -0.15; TCGA UCEC -0.081 |
hsa-miR-199a-5p | LIMD1 | 11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LIHC; LUAD; PRAD; SARC; THCA; STAD | miRanda | TCGA BLCA -0.12; TCGA BRCA -0.06; TCGA COAD -0.104; TCGA ESCA -0.172; TCGA KIRP -0.065; TCGA LIHC -0.063; TCGA LUAD -0.134; TCGA PRAD -0.11; TCGA SARC -0.064; TCGA THCA -0.073; TCGA STAD -0.119 |
hsa-miR-199a-5p | RNF138 | 9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; OV; PRAD; STAD | miRanda | TCGA BLCA -0.085; TCGA BRCA -0.116; TCGA COAD -0.252; TCGA HNSC -0.081; TCGA LUAD -0.129; TCGA LUSC -0.13; TCGA OV -0.101; TCGA PRAD -0.124; TCGA STAD -0.102 |
hsa-miR-199a-5p | SVIP | 10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; OV; PRAD; SARC; STAD; UCEC | miRanda | TCGA BLCA -0.105; TCGA BRCA -0.12; TCGA COAD -0.138; TCGA ESCA -0.259; TCGA LUAD -0.073; TCGA OV -0.151; TCGA PRAD -0.062; TCGA SARC -0.081; TCGA STAD -0.103; TCGA UCEC -0.071 |
hsa-miR-199a-5p | RBMXL1 | 10 cancers: BLCA; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.085; TCGA COAD -0.099; TCGA HNSC -0.092; TCGA LGG -0.075; TCGA LUAD -0.153; TCGA LUSC -0.11; TCGA OV -0.086; TCGA PRAD -0.165; TCGA SARC -0.074; TCGA STAD -0.086 |
hsa-miR-199a-5p | PAPOLA | 9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PAAD; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.082; TCGA BRCA -0.07; TCGA COAD -0.131; TCGA ESCA -0.065; TCGA LUAD -0.146; TCGA PAAD -0.074; TCGA PRAD -0.11; TCGA STAD -0.092; TCGA UCEC -0.061 |
hsa-miR-199a-5p | CHD7 | 12 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PRAD; UCEC | miRanda | TCGA BLCA -0.105; TCGA BRCA -0.09; TCGA ESCA -0.241; TCGA HNSC -0.085; TCGA KIRP -0.078; TCGA LGG -0.278; TCGA LIHC -0.057; TCGA LUAD -0.127; TCGA LUSC -0.133; TCGA OV -0.088; TCGA PRAD -0.204; TCGA UCEC -0.07 |
hsa-miR-199a-5p | PEX19 | 9 cancers: BLCA; COAD; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC | miRanda | TCGA BLCA -0.093; TCGA COAD -0.112; TCGA LUAD -0.104; TCGA LUSC -0.132; TCGA OV -0.082; TCGA PAAD -0.116; TCGA PRAD -0.092; TCGA THCA -0.08; TCGA UCEC -0.071 |
hsa-miR-199a-5p | MBD2 | 9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; SARC; STAD | miRanda | TCGA BLCA -0.068; TCGA BRCA -0.059; TCGA COAD -0.074; TCGA HNSC -0.057; TCGA KIRC -0.064; TCGA KIRP -0.054; TCGA LUAD -0.057; TCGA SARC -0.055; TCGA STAD -0.066 |
hsa-miR-199a-5p | NEDD4L | 11 cancers: BLCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.129; TCGA CESC -0.091; TCGA COAD -0.214; TCGA HNSC -0.086; TCGA LIHC -0.129; TCGA LUAD -0.233; TCGA LUSC -0.168; TCGA PAAD -0.139; TCGA PRAD -0.12; TCGA STAD -0.187; TCGA UCEC -0.061 |
hsa-miR-199a-5p | METAP1 | 9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.146; TCGA BRCA -0.092; TCGA COAD -0.116; TCGA HNSC -0.094; TCGA LUAD -0.11; TCGA LUSC -0.088; TCGA PRAD -0.081; TCGA SARC -0.122; TCGA STAD -0.172 |
hsa-miR-199a-5p | FDFT1 | 11 cancers: BLCA; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.085; TCGA ESCA -0.159; TCGA HNSC -0.063; TCGA LGG -0.068; TCGA LIHC -0.078; TCGA LUAD -0.133; TCGA LUSC -0.135; TCGA OV -0.136; TCGA PRAD -0.076; TCGA SARC -0.123; TCGA STAD -0.149 |
hsa-miR-199a-5p | AIFM1 | 10 cancers: BLCA; BRCA; ESCA; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.062; TCGA BRCA -0.139; TCGA ESCA -0.207; TCGA KIRP -0.059; TCGA LUAD -0.062; TCGA LUSC -0.209; TCGA PAAD -0.175; TCGA THCA -0.069; TCGA STAD -0.213; TCGA UCEC -0.112 |
hsa-miR-199a-5p | PM20D2 | 10 cancers: BLCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC | miRanda | TCGA BLCA -0.131; TCGA KIRP -0.073; TCGA LGG -0.134; TCGA LIHC -0.055; TCGA LUAD -0.117; TCGA LUSC -0.138; TCGA OV -0.106; TCGA PAAD -0.145; TCGA PRAD -0.167; TCGA SARC -0.121 |
hsa-miR-199a-5p | MMACHC | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.059; TCGA BRCA -0.144; TCGA COAD -0.194; TCGA ESCA -0.227; TCGA HNSC -0.135; TCGA OV -0.089; TCGA PAAD -0.11; TCGA PRAD -0.168; TCGA THCA -0.091; TCGA STAD -0.132; TCGA UCEC -0.088 |
hsa-miR-199a-5p | ZBTB42 | 9 cancers: BLCA; ESCA; KIRC; OV; PAAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.106; TCGA ESCA -0.212; TCGA KIRC -0.082; TCGA OV -0.088; TCGA PAAD -0.124; TCGA SARC -0.145; TCGA THCA -0.067; TCGA STAD -0.139; TCGA UCEC -0.126 |
hsa-miR-199a-5p | HNRNPA1 | 9 cancers: BLCA; COAD; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD | miRanda | TCGA BLCA -0.06; TCGA COAD -0.106; TCGA KIRC -0.071; TCGA LGG -0.129; TCGA LIHC -0.085; TCGA LUAD -0.139; TCGA LUSC -0.111; TCGA OV -0.051; TCGA PAAD -0.091 |
hsa-miR-199a-5p | UQCRC2 | 9 cancers: BLCA; COAD; ESCA; KIRP; LUAD; LUSC; OV; THCA; STAD | miRanda | TCGA BLCA -0.105; TCGA COAD -0.094; TCGA ESCA -0.162; TCGA KIRP -0.054; TCGA LUAD -0.1; TCGA LUSC -0.087; TCGA OV -0.052; TCGA THCA -0.067; TCGA STAD -0.194 |
hsa-miR-199a-5p | OAS1 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; OV; SARC; UCEC | miRanda | TCGA BLCA -0.162; TCGA BRCA -0.274; TCGA CESC -0.241; TCGA ESCA -0.393; TCGA HNSC -0.224; TCGA KIRC -0.294; TCGA KIRP -0.106; TCGA LUSC -0.165; TCGA OV -0.168; TCGA SARC -0.193; TCGA UCEC -0.205 |
hsa-miR-199a-5p | SLC48A1 | 9 cancers: BLCA; COAD; HNSC; LUAD; LUSC; PAAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.102; TCGA COAD -0.065; TCGA HNSC -0.055; TCGA LUAD -0.136; TCGA LUSC -0.154; TCGA PAAD -0.208; TCGA SARC -0.139; TCGA THCA -0.12; TCGA UCEC -0.128 |
hsa-miR-199a-5p | TIFA | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; OV; PRAD; SARC; STAD | miRanda | TCGA BLCA -0.081; TCGA BRCA -0.091; TCGA COAD -0.162; TCGA HNSC -0.064; TCGA KIRC -0.066; TCGA LUAD -0.15; TCGA OV -0.078; TCGA PRAD -0.149; TCGA SARC -0.129; TCGA STAD -0.154 |
hsa-miR-199a-5p | MAVS | 9 cancers: BLCA; ESCA; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; THCA | mirMAP | TCGA BLCA -0.097; TCGA ESCA -0.109; TCGA KIRP -0.068; TCGA LGG -0.069; TCGA LIHC -0.107; TCGA LUAD -0.067; TCGA PAAD -0.18; TCGA PRAD -0.074; TCGA THCA -0.064 |
hsa-miR-199a-5p | ACOT11 | 9 cancers: BLCA; BRCA; ESCA; HNSC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.196; TCGA BRCA -0.166; TCGA ESCA -0.313; TCGA HNSC -0.136; TCGA PRAD -0.181; TCGA SARC -0.25; TCGA THCA -0.067; TCGA STAD -0.169; TCGA UCEC -0.114 |
hsa-miR-199a-5p | KIAA1522 | 10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.091; TCGA BRCA -0.116; TCGA ESCA -0.195; TCGA HNSC -0.123; TCGA LIHC -0.059; TCGA PRAD -0.096; TCGA SARC -0.164; TCGA THCA -0.072; TCGA STAD -0.23; TCGA UCEC -0.111 |
hsa-miR-199a-5p | HIPK2 | 9 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LUAD; PAAD; PRAD; THCA | miRNATAP | TCGA BLCA -0.072; TCGA BRCA -0.087; TCGA ESCA -0.151; TCGA KIRC -0.111; TCGA LGG -0.203; TCGA LUAD -0.146; TCGA PAAD -0.176; TCGA PRAD -0.272; TCGA THCA -0.051 |
hsa-miR-199a-5p | KLHL23 | 10 cancers: BLCA; BRCA; COAD; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA | miRNATAP | TCGA BLCA -0.224; TCGA BRCA -0.213; TCGA COAD -0.122; TCGA LGG -0.169; TCGA LUAD -0.155; TCGA LUSC -0.275; TCGA OV -0.158; TCGA PRAD -0.346; TCGA SARC -0.49; TCGA THCA -0.122 |
hsa-miR-199a-5p | IPO7 | 10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PRAD; THCA | miRNATAP | TCGA BLCA -0.098; TCGA BRCA -0.07; TCGA CESC -0.061; TCGA COAD -0.085; TCGA HNSC -0.089; TCGA LGG -0.073; TCGA LUAD -0.172; TCGA LUSC -0.092; TCGA PRAD -0.162; TCGA THCA -0.061 |
hsa-miR-199a-5p | CEP350 | 9 cancers: BLCA; HNSC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.104; TCGA HNSC -0.07; TCGA LGG -0.074; TCGA LIHC -0.061; TCGA LUAD -0.074; TCGA LUSC -0.072; TCGA PRAD -0.176; TCGA SARC -0.051; TCGA STAD -0.101 |
hsa-miR-199a-5p | WBP11 | 10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRNATAP | TCGA BLCA -0.072; TCGA BRCA -0.134; TCGA COAD -0.155; TCGA HNSC -0.078; TCGA LUAD -0.138; TCGA LUSC -0.097; TCGA OV -0.066; TCGA PAAD -0.12; TCGA PRAD -0.158; TCGA STAD -0.097 |
hsa-miR-199a-5p | ATG4D | 10 cancers: BLCA; BRCA; COAD; KIRP; LUSC; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.09; TCGA BRCA -0.196; TCGA COAD -0.121; TCGA KIRP -0.053; TCGA LUSC -0.121; TCGA PAAD -0.323; TCGA SARC -0.096; TCGA THCA -0.072; TCGA STAD -0.192; TCGA UCEC -0.115 |
hsa-miR-199a-5p | NOL6 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; PAAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.052; TCGA BRCA -0.081; TCGA CESC -0.09; TCGA ESCA -0.156; TCGA HNSC -0.09; TCGA PAAD -0.081; TCGA PRAD -0.05; TCGA STAD -0.139; TCGA UCEC -0.059 |
hsa-miR-199a-5p | C18orf25 | 10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.111; TCGA BRCA -0.095; TCGA COAD -0.145; TCGA HNSC -0.087; TCGA LUAD -0.066; TCGA LUSC -0.075; TCGA PRAD -0.133; TCGA SARC -0.186; TCGA STAD -0.124; TCGA UCEC -0.053 |
hsa-miR-199a-5p | NAA15 | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; OV; PRAD; SARC; STAD | miRNATAP | TCGA BLCA -0.09; TCGA BRCA -0.082; TCGA CESC -0.066; TCGA COAD -0.136; TCGA HNSC -0.096; TCGA KIRC -0.069; TCGA LUAD -0.144; TCGA LUSC -0.103; TCGA OV -0.087; TCGA PRAD -0.115; TCGA SARC -0.075; TCGA STAD -0.099 |
hsa-miR-199a-5p | EZH2 | 12 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.317; TCGA COAD -0.18; TCGA HNSC -0.106; TCGA KIRC -0.308; TCGA KIRP -0.173; TCGA LGG -0.15; TCGA LIHC -0.205; TCGA LUSC -0.201; TCGA OV -0.129; TCGA SARC -0.191; TCGA STAD -0.18; TCGA UCEC -0.127 |
hsa-miR-199a-5p | UNG | 12 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate; MirTarget; miRanda; miRNATAP | TCGA BRCA -0.216; TCGA COAD -0.119; TCGA HNSC -0.099; TCGA LIHC -0.066; TCGA LUAD -0.15; TCGA LUSC -0.159; TCGA OV -0.128; TCGA PAAD -0.065; TCGA PRAD -0.072; TCGA THCA -0.062; TCGA STAD -0.157; TCGA UCEC -0.109 |
hsa-miR-199a-5p | TMEM54 | 9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; SARC; STAD | miRTarBase | TCGA BRCA -0.17; TCGA COAD -0.131; TCGA ESCA -0.398; TCGA HNSC -0.107; TCGA KIRC -0.089; TCGA KIRP -0.122; TCGA LGG -0.079; TCGA SARC -0.211; TCGA STAD -0.243 |
hsa-miR-199a-5p | TXNDC12 | 10 cancers: BRCA; CESC; COAD; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD | MirTarget; miRanda | TCGA BRCA -0.09; TCGA CESC -0.077; TCGA COAD -0.058; TCGA LIHC -0.056; TCGA LUAD -0.054; TCGA LUSC -0.062; TCGA OV -0.074; TCGA PAAD -0.076; TCGA PRAD -0.069; TCGA STAD -0.068 |
hsa-miR-199a-5p | CDCA7L | 9 cancers: BRCA; CESC; COAD; KIRC; KIRP; LUSC; OV; PRAD; SARC | MirTarget; miRanda; miRNATAP | TCGA BRCA -0.104; TCGA CESC -0.11; TCGA COAD -0.189; TCGA KIRC -0.256; TCGA KIRP -0.097; TCGA LUSC -0.15; TCGA OV -0.176; TCGA PRAD -0.13; TCGA SARC -0.209 |
hsa-miR-199a-5p | MYO19 | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; SARC; THCA; STAD; UCEC | MirTarget; miRanda | TCGA BRCA -0.208; TCGA CESC -0.085; TCGA COAD -0.139; TCGA ESCA -0.125; TCGA HNSC -0.104; TCGA KIRC -0.07; TCGA KIRP -0.079; TCGA LIHC -0.113; TCGA SARC -0.106; TCGA THCA -0.063; TCGA STAD -0.211; TCGA UCEC -0.055 |
hsa-miR-199a-5p | XPOT | 11 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget; PITA; miRanda | TCGA BRCA -0.16; TCGA CESC -0.084; TCGA COAD -0.114; TCGA HNSC -0.088; TCGA LIHC -0.055; TCGA LUAD -0.176; TCGA LUSC -0.142; TCGA PRAD -0.092; TCGA THCA -0.102; TCGA STAD -0.095; TCGA UCEC -0.069 |
hsa-miR-199a-5p | CNNM3 | 11 cancers: BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD | MirTarget | TCGA BRCA -0.089; TCGA COAD -0.096; TCGA ESCA -0.215; TCGA KIRC -0.094; TCGA LGG -0.075; TCGA LIHC -0.054; TCGA LUAD -0.087; TCGA LUSC -0.105; TCGA PAAD -0.234; TCGA PRAD -0.099; TCGA STAD -0.077 |
hsa-miR-199a-5p | GPR89A | 10 cancers: BRCA; CESC; ESCA; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC | MirTarget; miRanda; miRNATAP | TCGA BRCA -0.137; TCGA CESC -0.06; TCGA ESCA -0.131; TCGA LIHC -0.069; TCGA LUAD -0.058; TCGA LUSC -0.081; TCGA OV -0.092; TCGA PAAD -0.127; TCGA THCA -0.059; TCGA UCEC -0.107 |
hsa-miR-199a-5p | WDR76 | 9 cancers: BRCA; COAD; HNSC; KIRC; LIHC; LUAD; OV; SARC; STAD | MirTarget; miRNATAP | TCGA BRCA -0.198; TCGA COAD -0.227; TCGA HNSC -0.234; TCGA KIRC -0.061; TCGA LIHC -0.2; TCGA LUAD -0.209; TCGA OV -0.091; TCGA SARC -0.242; TCGA STAD -0.115 |
hsa-miR-199a-5p | FANCA | 10 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; OV; SARC; UCEC | PITA; miRanda; miRNATAP | TCGA BRCA -0.403; TCGA CESC -0.085; TCGA COAD -0.159; TCGA HNSC -0.147; TCGA KIRC -0.334; TCGA KIRP -0.227; TCGA LIHC -0.14; TCGA OV -0.091; TCGA SARC -0.1; TCGA UCEC -0.146 |
hsa-miR-199a-5p | ZBTB5 | 11 cancers: BRCA; COAD; HNSC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; STAD | PITA; miRNATAP | TCGA BRCA -0.065; TCGA COAD -0.065; TCGA HNSC -0.1; TCGA KIRP -0.064; TCGA LGG -0.154; TCGA LUAD -0.073; TCGA LUSC -0.132; TCGA OV -0.079; TCGA PAAD -0.107; TCGA PRAD -0.075; TCGA STAD -0.159 |
hsa-miR-199a-5p | DEPDC1B | 9 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; OV; SARC; UCEC | PITA; miRanda | TCGA BRCA -0.398; TCGA COAD -0.191; TCGA HNSC -0.233; TCGA LIHC -0.183; TCGA LUAD -0.166; TCGA LUSC -0.28; TCGA OV -0.136; TCGA SARC -0.106; TCGA UCEC -0.221 |
hsa-miR-199a-5p | ADK | 10 cancers: BRCA; CESC; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRanda | TCGA BRCA -0.063; TCGA CESC -0.115; TCGA HNSC -0.114; TCGA LGG -0.145; TCGA LUAD -0.097; TCGA LUSC -0.087; TCGA PAAD -0.11; TCGA PRAD -0.069; TCGA STAD -0.146; TCGA UCEC -0.072 |
hsa-miR-199a-5p | NFS1 | 11 cancers: BRCA; CESC; ESCA; KIRP; LIHC; LUSC; OV; PAAD; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.095; TCGA CESC -0.066; TCGA ESCA -0.143; TCGA KIRP -0.056; TCGA LIHC -0.052; TCGA LUSC -0.184; TCGA OV -0.057; TCGA PAAD -0.184; TCGA THCA -0.056; TCGA STAD -0.102; TCGA UCEC -0.096 |
hsa-miR-199a-5p | TXNRD1 | 9 cancers: BRCA; COAD; LIHC; LUAD; LUSC; OV; PRAD; SARC; UCEC | miRanda; miRNATAP | TCGA BRCA -0.129; TCGA COAD -0.146; TCGA LIHC -0.149; TCGA LUAD -0.259; TCGA LUSC -0.358; TCGA OV -0.065; TCGA PRAD -0.084; TCGA SARC -0.204; TCGA UCEC -0.072 |
hsa-miR-199a-5p | GPSM2 | 9 cancers: BRCA; HNSC; KIRC; KIRP; LGG; LIHC; OV; SARC; STAD | miRanda | TCGA BRCA -0.236; TCGA HNSC -0.15; TCGA KIRC -0.086; TCGA KIRP -0.092; TCGA LGG -0.16; TCGA LIHC -0.161; TCGA OV -0.085; TCGA SARC -0.094; TCGA STAD -0.127 |
hsa-miR-199a-5p | TARBP2 | 9 cancers: BRCA; CESC; ESCA; KIRP; LIHC; LUSC; OV; PAAD; UCEC | miRanda | TCGA BRCA -0.067; TCGA CESC -0.064; TCGA ESCA -0.095; TCGA KIRP -0.061; TCGA LIHC -0.073; TCGA LUSC -0.102; TCGA OV -0.094; TCGA PAAD -0.185; TCGA UCEC -0.107 |
hsa-miR-199a-5p | MRPL52 | 11 cancers: BRCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.116; TCGA CESC -0.077; TCGA COAD -0.101; TCGA ESCA -0.143; TCGA KIRP -0.06; TCGA LGG -0.054; TCGA LIHC -0.085; TCGA OV -0.12; TCGA PAAD -0.184; TCGA STAD -0.093; TCGA UCEC -0.089 |
hsa-miR-199a-5p | ARL6IP6 | 11 cancers: BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC | miRanda | TCGA BRCA -0.096; TCGA CESC -0.072; TCGA COAD -0.16; TCGA HNSC -0.096; TCGA KIRC -0.069; TCGA LGG -0.128; TCGA LUAD -0.141; TCGA LUSC -0.1; TCGA OV -0.125; TCGA PRAD -0.096; TCGA SARC -0.084 |
hsa-miR-199a-5p | DIAPH3 | 10 cancers: BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; SARC; STAD | miRanda | TCGA BRCA -0.275; TCGA CESC -0.142; TCGA COAD -0.162; TCGA HNSC -0.153; TCGA KIRP -0.08; TCGA LIHC -0.301; TCGA LUAD -0.275; TCGA LUSC -0.119; TCGA SARC -0.085; TCGA STAD -0.21 |
hsa-miR-199a-5p | MED20 | 13 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRanda | TCGA BRCA -0.056; TCGA CESC -0.063; TCGA COAD -0.066; TCGA ESCA -0.128; TCGA HNSC -0.053; TCGA LGG -0.087; TCGA LIHC -0.076; TCGA LUAD -0.069; TCGA LUSC -0.101; TCGA OV -0.065; TCGA PAAD -0.076; TCGA PRAD -0.129; TCGA STAD -0.11 |
hsa-miR-199a-5p | CHD1L | 9 cancers: BRCA; CESC; ESCA; LIHC; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BRCA -0.113; TCGA CESC -0.108; TCGA ESCA -0.09; TCGA LIHC -0.084; TCGA LUAD -0.084; TCGA LUSC -0.09; TCGA OV -0.057; TCGA STAD -0.093; TCGA UCEC -0.085 |
hsa-miR-199a-5p | DUS4L | 10 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA | miRanda | TCGA BRCA -0.117; TCGA COAD -0.094; TCGA KIRC -0.068; TCGA KIRP -0.078; TCGA LIHC -0.067; TCGA LUAD -0.076; TCGA LUSC -0.159; TCGA OV -0.09; TCGA PAAD -0.179; TCGA THCA -0.067 |
hsa-miR-199a-5p | UBL5 | 9 cancers: BRCA; CESC; ESCA; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRanda | TCGA BRCA -0.138; TCGA CESC -0.068; TCGA ESCA -0.109; TCGA LIHC -0.058; TCGA LUAD -0.059; TCGA LUSC -0.131; TCGA OV -0.098; TCGA PAAD -0.183; TCGA UCEC -0.081 |
hsa-miR-199a-5p | TSFM | 11 cancers: BRCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.139; TCGA CESC -0.097; TCGA COAD -0.136; TCGA ESCA -0.104; TCGA LUAD -0.075; TCGA LUSC -0.153; TCGA OV -0.113; TCGA PAAD -0.186; TCGA THCA -0.069; TCGA STAD -0.087; TCGA UCEC -0.121 |
hsa-miR-199a-5p | CRIPT | 10 cancers: BRCA; CESC; COAD; LIHC; LUAD; LUSC; OV; PAAD; PRAD; UCEC | miRanda | TCGA BRCA -0.119; TCGA CESC -0.076; TCGA COAD -0.067; TCGA LIHC -0.054; TCGA LUAD -0.127; TCGA LUSC -0.077; TCGA OV -0.111; TCGA PAAD -0.078; TCGA PRAD -0.087; TCGA UCEC -0.116 |
hsa-miR-199a-5p | CDC6 | 11 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; SARC; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.351; TCGA CESC -0.148; TCGA COAD -0.154; TCGA HNSC -0.172; TCGA KIRC -0.341; TCGA KIRP -0.146; TCGA LIHC -0.267; TCGA SARC -0.07; TCGA THCA -0.064; TCGA STAD -0.243; TCGA UCEC -0.156 |
hsa-miR-199a-5p | STIL | 10 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LIHC; OV; SARC; STAD; UCEC | miRanda | TCGA BRCA -0.331; TCGA COAD -0.218; TCGA HNSC -0.258; TCGA KIRC -0.074; TCGA KIRP -0.08; TCGA LIHC -0.157; TCGA OV -0.092; TCGA SARC -0.085; TCGA STAD -0.221; TCGA UCEC -0.137 |
hsa-miR-199a-5p | TLCD1 | 9 cancers: BRCA; CESC; ESCA; KIRP; LIHC; LUSC; PAAD; THCA; UCEC | miRanda | TCGA BRCA -0.289; TCGA CESC -0.175; TCGA ESCA -0.347; TCGA KIRP -0.085; TCGA LIHC -0.144; TCGA LUSC -0.285; TCGA PAAD -0.28; TCGA THCA -0.082; TCGA UCEC -0.205 |
hsa-miR-199a-5p | YWHAE | 12 cancers: BRCA; COAD; HNSC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD | miRanda | TCGA BRCA -0.087; TCGA COAD -0.124; TCGA HNSC -0.052; TCGA KIRP -0.069; TCGA LGG -0.067; TCGA LUAD -0.149; TCGA LUSC -0.12; TCGA OV -0.071; TCGA PAAD -0.219; TCGA PRAD -0.056; TCGA THCA -0.068; TCGA STAD -0.126 |
hsa-miR-199a-5p | CDKAL1 | 9 cancers: BRCA; CESC; COAD; LGG; LIHC; LUAD; OV; PRAD; UCEC | miRanda | TCGA BRCA -0.098; TCGA CESC -0.066; TCGA COAD -0.174; TCGA LGG -0.079; TCGA LIHC -0.069; TCGA LUAD -0.09; TCGA OV -0.052; TCGA PRAD -0.09; TCGA UCEC -0.069 |
hsa-miR-199a-5p | MCM10 | 10 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; OV; UCEC | miRanda | TCGA BRCA -0.448; TCGA CESC -0.143; TCGA COAD -0.199; TCGA HNSC -0.207; TCGA KIRC -0.4; TCGA KIRP -0.132; TCGA LIHC -0.261; TCGA LUAD -0.161; TCGA OV -0.094; TCGA UCEC -0.23 |
hsa-miR-199a-5p | CSTF2 | 11 cancers: BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD | miRanda | TCGA BRCA -0.127; TCGA CESC -0.072; TCGA ESCA -0.106; TCGA HNSC -0.138; TCGA LGG -0.055; TCGA LIHC -0.103; TCGA LUSC -0.125; TCGA OV -0.064; TCGA PRAD -0.07; TCGA SARC -0.075; TCGA STAD -0.208 |
hsa-miR-199a-5p | SOX12 | 10 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; PAAD; THCA; UCEC | miRanda | TCGA BRCA -0.089; TCGA KIRC -0.055; TCGA KIRP -0.125; TCGA LGG -0.148; TCGA LIHC -0.137; TCGA LUSC -0.183; TCGA OV -0.111; TCGA PAAD -0.303; TCGA THCA -0.108; TCGA UCEC -0.092 |
hsa-miR-199a-5p | CCT3 | 11 cancers: BRCA; CESC; ESCA; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.157; TCGA CESC -0.097; TCGA ESCA -0.153; TCGA LGG -0.076; TCGA LIHC -0.117; TCGA LUAD -0.124; TCGA LUSC -0.134; TCGA OV -0.079; TCGA PAAD -0.147; TCGA STAD -0.146; TCGA UCEC -0.12 |
hsa-miR-199a-5p | CYB561 | 9 cancers: BRCA; ESCA; HNSC; KIRP; LUSC; PAAD; PRAD; THCA; STAD | miRanda | TCGA BRCA -0.153; TCGA ESCA -0.263; TCGA HNSC -0.069; TCGA KIRP -0.053; TCGA LUSC -0.082; TCGA PAAD -0.285; TCGA PRAD -0.061; TCGA THCA -0.084; TCGA STAD -0.19 |
hsa-miR-199a-5p | MRPL11 | 10 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; PAAD; UCEC | miRanda | TCGA BRCA -0.122; TCGA CESC -0.073; TCGA COAD -0.097; TCGA HNSC -0.061; TCGA LIHC -0.079; TCGA LUAD -0.106; TCGA LUSC -0.15; TCGA OV -0.121; TCGA PAAD -0.104; TCGA UCEC -0.08 |
hsa-miR-199a-5p | EBP | 9 cancers: BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BRCA -0.144; TCGA ESCA -0.187; TCGA HNSC -0.072; TCGA LIHC -0.104; TCGA LUAD -0.071; TCGA LUSC -0.118; TCGA OV -0.072; TCGA STAD -0.255; TCGA UCEC -0.12 |
hsa-miR-199a-5p | LMNB1 | 9 cancers: BRCA; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; OV; UCEC | miRanda | TCGA BRCA -0.29; TCGA COAD -0.157; TCGA HNSC -0.195; TCGA KIRC -0.156; TCGA LIHC -0.108; TCGA LUAD -0.149; TCGA LUSC -0.181; TCGA OV -0.077; TCGA UCEC -0.088 |
hsa-miR-199a-5p | PRC1 | 9 cancers: BRCA; COAD; HNSC; KIRC; LIHC; LUAD; OV; SARC; STAD | miRanda | TCGA BRCA -0.337; TCGA COAD -0.245; TCGA HNSC -0.164; TCGA KIRC -0.142; TCGA LIHC -0.239; TCGA LUAD -0.16; TCGA OV -0.109; TCGA SARC -0.116; TCGA STAD -0.201 |
hsa-miR-199a-5p | PUS7 | 9 cancers: BRCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD | miRanda | TCGA BRCA -0.145; TCGA CESC -0.067; TCGA COAD -0.133; TCGA HNSC -0.065; TCGA KIRC -0.123; TCGA LIHC -0.076; TCGA LUAD -0.095; TCGA LUSC -0.117; TCGA PRAD -0.081 |
hsa-miR-199a-5p | RNF114 | 10 cancers: BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.134; TCGA CESC -0.089; TCGA ESCA -0.146; TCGA HNSC -0.066; TCGA LUAD -0.057; TCGA LUSC -0.103; TCGA OV -0.073; TCGA PAAD -0.095; TCGA STAD -0.069; TCGA UCEC -0.13 |
hsa-miR-199a-5p | SET | 10 cancers: BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; PAAD; STAD | miRanda | TCGA BRCA -0.096; TCGA CESC -0.079; TCGA COAD -0.106; TCGA HNSC -0.076; TCGA LGG -0.053; TCGA LUAD -0.163; TCGA LUSC -0.166; TCGA OV -0.065; TCGA PAAD -0.055; TCGA STAD -0.101 |
hsa-miR-199a-5p | DBF4 | 9 cancers: BRCA; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV | miRanda | TCGA BRCA -0.223; TCGA COAD -0.173; TCGA HNSC -0.113; TCGA KIRC -0.11; TCGA LGG -0.071; TCGA LIHC -0.085; TCGA LUAD -0.167; TCGA LUSC -0.129; TCGA OV -0.095 |
hsa-miR-199a-5p | RBM8A | 9 cancers: BRCA; COAD; LGG; LIHC; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BRCA -0.131; TCGA COAD -0.053; TCGA LGG -0.084; TCGA LIHC -0.068; TCGA LUAD -0.076; TCGA LUSC -0.132; TCGA OV -0.063; TCGA STAD -0.058; TCGA UCEC -0.097 |
hsa-miR-199a-5p | SLC25A44 | 9 cancers: BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRanda | TCGA BRCA -0.064; TCGA COAD -0.056; TCGA ESCA -0.107; TCGA LUAD -0.084; TCGA LUSC -0.114; TCGA PAAD -0.11; TCGA PRAD -0.082; TCGA STAD -0.07; TCGA UCEC -0.097 |
hsa-miR-199a-5p | RRM2 | 9 cancers: BRCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; STAD; UCEC | miRanda | TCGA BRCA -0.397; TCGA CESC -0.125; TCGA COAD -0.237; TCGA HNSC -0.202; TCGA KIRC -0.316; TCGA LIHC -0.288; TCGA LUAD -0.156; TCGA STAD -0.212; TCGA UCEC -0.203 |
hsa-miR-199a-5p | STX3 | 10 cancers: BRCA; ESCA; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.094; TCGA ESCA -0.323; TCGA KIRC -0.137; TCGA KIRP -0.054; TCGA LUAD -0.111; TCGA LUSC -0.097; TCGA SARC -0.228; TCGA THCA -0.067; TCGA STAD -0.208; TCGA UCEC -0.05 |
hsa-miR-199a-5p | DEK | 12 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | miRanda | TCGA BRCA -0.142; TCGA CESC -0.065; TCGA COAD -0.125; TCGA HNSC -0.123; TCGA LIHC -0.076; TCGA LUAD -0.156; TCGA LUSC -0.139; TCGA OV -0.09; TCGA PRAD -0.09; TCGA SARC -0.104; TCGA STAD -0.102; TCGA UCEC -0.064 |
hsa-miR-199a-5p | AGBL5 | 9 cancers: BRCA; COAD; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA | miRanda | TCGA BRCA -0.151; TCGA COAD -0.095; TCGA LIHC -0.13; TCGA LUAD -0.093; TCGA LUSC -0.165; TCGA OV -0.08; TCGA PAAD -0.198; TCGA SARC -0.113; TCGA THCA -0.085 |
hsa-miR-199a-5p | PRPF3 | 9 cancers: BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUSC; OV; UCEC | miRanda | TCGA BRCA -0.136; TCGA CESC -0.066; TCGA KIRC -0.115; TCGA KIRP -0.057; TCGA LGG -0.079; TCGA LIHC -0.089; TCGA LUSC -0.15; TCGA OV -0.051; TCGA UCEC -0.085 |
hsa-miR-199a-5p | QRSL1 | 11 cancers: BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; OV; PAAD; PRAD; UCEC | miRanda | TCGA BRCA -0.071; TCGA CESC -0.061; TCGA COAD -0.11; TCGA ESCA -0.171; TCGA LGG -0.055; TCGA LUAD -0.081; TCGA LUSC -0.085; TCGA OV -0.087; TCGA PAAD -0.091; TCGA PRAD -0.072; TCGA UCEC -0.066 |
hsa-miR-199a-5p | BUB1 | 12 cancers: BRCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | miRanda | TCGA BRCA -0.38; TCGA CESC -0.121; TCGA COAD -0.223; TCGA HNSC -0.192; TCGA KIRC -0.41; TCGA LIHC -0.292; TCGA LUAD -0.183; TCGA LUSC -0.182; TCGA OV -0.135; TCGA SARC -0.094; TCGA STAD -0.201; TCGA UCEC -0.197 |
hsa-miR-199a-5p | LCLAT1 | 10 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA | miRanda | TCGA BRCA -0.14; TCGA CESC -0.054; TCGA COAD -0.177; TCGA HNSC -0.074; TCGA LIHC -0.084; TCGA LUAD -0.106; TCGA LUSC -0.121; TCGA PAAD -0.152; TCGA PRAD -0.119; TCGA THCA -0.089 |
hsa-miR-199a-5p | DYNLRB1 | 9 cancers: BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; UCEC | miRanda | TCGA BRCA -0.138; TCGA ESCA -0.141; TCGA KIRC -0.075; TCGA KIRP -0.067; TCGA LIHC -0.086; TCGA LUAD -0.056; TCGA LUSC -0.127; TCGA PAAD -0.222; TCGA UCEC -0.07 |
hsa-miR-199a-5p | MRPL17 | 9 cancers: BRCA; CESC; ESCA; KIRC; LIHC; LUSC; OV; PAAD; UCEC | miRanda | TCGA BRCA -0.147; TCGA CESC -0.119; TCGA ESCA -0.192; TCGA KIRC -0.075; TCGA LIHC -0.051; TCGA LUSC -0.095; TCGA OV -0.064; TCGA PAAD -0.148; TCGA UCEC -0.075 |
hsa-miR-199a-5p | NAT9 | 10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; UCEC | miRanda | TCGA BRCA -0.129; TCGA CESC -0.068; TCGA ESCA -0.175; TCGA KIRC -0.07; TCGA KIRP -0.087; TCGA LGG -0.091; TCGA LIHC -0.161; TCGA LUSC -0.134; TCGA PAAD -0.217; TCGA UCEC -0.06 |
hsa-miR-199a-5p | STARD7 | 11 cancers: BRCA; COAD; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.121; TCGA COAD -0.12; TCGA LUAD -0.15; TCGA LUSC -0.144; TCGA OV -0.056; TCGA PAAD -0.09; TCGA PRAD -0.072; TCGA SARC -0.077; TCGA THCA -0.052; TCGA STAD -0.124; TCGA UCEC -0.074 |
hsa-miR-199a-5p | TPMT | 11 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LUSC; OV; PRAD; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.108; TCGA COAD -0.155; TCGA ESCA -0.29; TCGA HNSC -0.07; TCGA KIRP -0.082; TCGA LUSC -0.099; TCGA OV -0.093; TCGA PRAD -0.094; TCGA THCA -0.101; TCGA STAD -0.26; TCGA UCEC -0.078 |
hsa-miR-199a-5p | CCNA2 | 11 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; OV; STAD; UCEC | miRanda | TCGA BRCA -0.375; TCGA CESC -0.089; TCGA COAD -0.266; TCGA HNSC -0.209; TCGA KIRC -0.329; TCGA KIRP -0.091; TCGA LIHC -0.275; TCGA LUAD -0.15; TCGA OV -0.108; TCGA STAD -0.226; TCGA UCEC -0.106 |
hsa-miR-199a-5p | CNPY2 | 11 cancers: BRCA; CESC; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.131; TCGA CESC -0.117; TCGA ESCA -0.211; TCGA KIRC -0.085; TCGA LIHC -0.103; TCGA LUAD -0.085; TCGA LUSC -0.098; TCGA OV -0.074; TCGA PAAD -0.323; TCGA STAD -0.113; TCGA UCEC -0.087 |
hsa-miR-199a-5p | CCDC47 | 11 cancers: BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.089; TCGA COAD -0.099; TCGA ESCA -0.162; TCGA HNSC -0.059; TCGA LIHC -0.065; TCGA LUAD -0.098; TCGA LUSC -0.138; TCGA PRAD -0.121; TCGA THCA -0.053; TCGA STAD -0.195; TCGA UCEC -0.06 |
hsa-miR-199a-5p | DLEU1 | 10 cancers: BRCA; COAD; KIRC; LGG; LIHC; LUAD; PAAD; PRAD; THCA; UCEC | miRanda | TCGA BRCA -0.133; TCGA COAD -0.149; TCGA KIRC -0.171; TCGA LGG -0.069; TCGA LIHC -0.086; TCGA LUAD -0.168; TCGA PAAD -0.303; TCGA PRAD -0.102; TCGA THCA -0.079; TCGA UCEC -0.075 |
hsa-miR-199a-5p | NDUFA4 | 9 cancers: BRCA; COAD; ESCA; LIHC; LUAD; LUSC; SARC; THCA; UCEC | miRanda | TCGA BRCA -0.1; TCGA COAD -0.089; TCGA ESCA -0.092; TCGA LIHC -0.057; TCGA LUAD -0.059; TCGA LUSC -0.072; TCGA SARC -0.163; TCGA THCA -0.075; TCGA UCEC -0.079 |
hsa-miR-199a-5p | KIF24 | 11 cancers: BRCA; COAD; HNSC; KIRP; LIHC; LUAD; OV; PAAD; SARC; THCA; STAD | miRanda | TCGA BRCA -0.161; TCGA COAD -0.115; TCGA HNSC -0.23; TCGA KIRP -0.091; TCGA LIHC -0.148; TCGA LUAD -0.131; TCGA OV -0.127; TCGA PAAD -0.166; TCGA SARC -0.122; TCGA THCA -0.066; TCGA STAD -0.156 |
hsa-miR-199a-5p | EXOSC3 | 10 cancers: BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.141; TCGA CESC -0.121; TCGA HNSC -0.112; TCGA LIHC -0.061; TCGA LUAD -0.102; TCGA LUSC -0.157; TCGA OV -0.087; TCGA PAAD -0.094; TCGA STAD -0.093; TCGA UCEC -0.056 |
hsa-miR-199a-5p | ALKBH2 | 10 cancers: BRCA; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BRCA -0.124; TCGA ESCA -0.21; TCGA KIRC -0.102; TCGA LGG -0.128; TCGA LIHC -0.144; TCGA LUAD -0.076; TCGA LUSC -0.158; TCGA OV -0.116; TCGA STAD -0.09; TCGA UCEC -0.069 |
hsa-miR-199a-5p | SOD1 | 10 cancers: BRCA; COAD; ESCA; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | miRanda | TCGA BRCA -0.143; TCGA COAD -0.105; TCGA ESCA -0.098; TCGA LIHC -0.055; TCGA LUAD -0.061; TCGA LUSC -0.161; TCGA OV -0.103; TCGA SARC -0.084; TCGA STAD -0.13; TCGA UCEC -0.095 |
hsa-miR-199a-5p | HAUS5 | 9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; OV; PAAD; SARC | miRanda | TCGA BRCA -0.125; TCGA CESC -0.069; TCGA HNSC -0.069; TCGA KIRC -0.11; TCGA KIRP -0.057; TCGA LIHC -0.116; TCGA OV -0.104; TCGA PAAD -0.16; TCGA SARC -0.112 |
hsa-miR-199a-5p | FANCC | 11 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; THCA | miRanda | TCGA BRCA -0.107; TCGA CESC -0.078; TCGA COAD -0.106; TCGA HNSC -0.169; TCGA KIRC -0.114; TCGA KIRP -0.122; TCGA LUAD -0.107; TCGA LUSC -0.128; TCGA OV -0.056; TCGA PAAD -0.157; TCGA THCA -0.073 |
hsa-miR-199a-5p | ALDH9A1 | 11 cancers: BRCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.063; TCGA COAD -0.112; TCGA ESCA -0.094; TCGA LGG -0.051; TCGA LUAD -0.116; TCGA LUSC -0.077; TCGA PAAD -0.123; TCGA PRAD -0.142; TCGA THCA -0.099; TCGA STAD -0.194; TCGA UCEC -0.064 |
hsa-miR-199a-5p | ATAD3A | 9 cancers: BRCA; CESC; ESCA; HNSC; LIHC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.185; TCGA CESC -0.077; TCGA ESCA -0.197; TCGA HNSC -0.051; TCGA LIHC -0.061; TCGA OV -0.099; TCGA PAAD -0.164; TCGA STAD -0.138; TCGA UCEC -0.094 |
hsa-miR-199a-5p | ZNF367 | 10 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; OV; SARC; THCA; STAD | miRanda | TCGA BRCA -0.266; TCGA COAD -0.189; TCGA HNSC -0.198; TCGA LIHC -0.065; TCGA LUAD -0.226; TCGA LUSC -0.201; TCGA OV -0.099; TCGA SARC -0.24; TCGA THCA -0.083; TCGA STAD -0.196 |
hsa-miR-199a-5p | ATIC | 10 cancers: BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BRCA -0.06; TCGA CESC -0.076; TCGA ESCA -0.14; TCGA HNSC -0.059; TCGA LIHC -0.085; TCGA LUAD -0.102; TCGA LUSC -0.086; TCGA OV -0.058; TCGA STAD -0.082; TCGA UCEC -0.055 |
hsa-miR-199a-5p | B9D1 | 10 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUSC; OV; PAAD; SARC; THCA | miRanda | TCGA BRCA -0.11; TCGA COAD -0.147; TCGA KIRC -0.103; TCGA KIRP -0.088; TCGA LIHC -0.099; TCGA LUSC -0.116; TCGA OV -0.081; TCGA PAAD -0.539; TCGA SARC -0.151; TCGA THCA -0.101 |
hsa-miR-199a-5p | NXT2 | 9 cancers: BRCA; COAD; HNSC; LIHC; LUAD; OV; PRAD; STAD; UCEC | miRanda; miRNATAP | TCGA BRCA -0.066; TCGA COAD -0.16; TCGA HNSC -0.08; TCGA LIHC -0.094; TCGA LUAD -0.122; TCGA OV -0.104; TCGA PRAD -0.146; TCGA STAD -0.101; TCGA UCEC -0.071 |
hsa-miR-199a-5p | STOX1 | 9 cancers: BRCA; LGG; LIHC; LUSC; OV; SARC; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.122; TCGA LGG -0.232; TCGA LIHC -0.179; TCGA LUSC -0.243; TCGA OV -0.143; TCGA SARC -0.204; TCGA THCA -0.06; TCGA STAD -0.188; TCGA UCEC -0.114 |
hsa-miR-199a-5p | OASL | 9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LUAD; OV; SARC; UCEC | miRanda | TCGA BRCA -0.438; TCGA CESC -0.29; TCGA ESCA -0.406; TCGA HNSC -0.364; TCGA KIRC -0.291; TCGA LUAD -0.139; TCGA OV -0.175; TCGA SARC -0.243; TCGA UCEC -0.24 |
hsa-miR-199a-5p | PQBP1 | 9 cancers: BRCA; ESCA; KIRC; LGG; LIHC; LUSC; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.135; TCGA ESCA -0.117; TCGA KIRC -0.067; TCGA LGG -0.095; TCGA LIHC -0.094; TCGA LUSC -0.113; TCGA PAAD -0.208; TCGA STAD -0.09; TCGA UCEC -0.059 |
hsa-miR-199a-5p | TRIM37 | 10 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC | miRanda | TCGA BRCA -0.133; TCGA COAD -0.083; TCGA HNSC -0.056; TCGA LIHC -0.08; TCGA LUAD -0.12; TCGA LUSC -0.145; TCGA OV -0.074; TCGA PAAD -0.143; TCGA PRAD -0.064; TCGA SARC -0.112 |
hsa-miR-199a-5p | KDM1B | 13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRanda; miRNATAP | TCGA BRCA -0.108; TCGA CESC -0.066; TCGA COAD -0.179; TCGA ESCA -0.116; TCGA HNSC -0.1; TCGA KIRP -0.067; TCGA LUAD -0.09; TCGA LUSC -0.126; TCGA OV -0.075; TCGA PRAD -0.103; TCGA THCA -0.052; TCGA STAD -0.145; TCGA UCEC -0.06 |
hsa-miR-199a-5p | LMAN2 | 9 cancers: BRCA; CESC; ESCA; KIRC; LIHC; PAAD; THCA; STAD; UCEC | miRanda; miRNATAP | TCGA BRCA -0.058; TCGA CESC -0.067; TCGA ESCA -0.195; TCGA KIRC -0.153; TCGA LIHC -0.084; TCGA PAAD -0.136; TCGA THCA -0.053; TCGA STAD -0.103; TCGA UCEC -0.092 |
hsa-miR-199a-5p | LSM4 | 9 cancers: BRCA; CESC; ESCA; LIHC; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.227; TCGA CESC -0.072; TCGA ESCA -0.125; TCGA LIHC -0.08; TCGA LUSC -0.153; TCGA OV -0.131; TCGA PAAD -0.202; TCGA STAD -0.131; TCGA UCEC -0.123 |
hsa-miR-199a-5p | FAM96A | 9 cancers: BRCA; CESC; COAD; ESCA; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BRCA -0.157; TCGA CESC -0.068; TCGA COAD -0.147; TCGA ESCA -0.182; TCGA LUAD -0.119; TCGA LUSC -0.097; TCGA OV -0.103; TCGA STAD -0.095; TCGA UCEC -0.072 |
hsa-miR-199a-5p | FAM136A | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.189; TCGA CESC -0.065; TCGA COAD -0.09; TCGA ESCA -0.164; TCGA HNSC -0.065; TCGA LIHC -0.094; TCGA LUAD -0.081; TCGA LUSC -0.168; TCGA OV -0.096; TCGA PAAD -0.089; TCGA STAD -0.123; TCGA UCEC -0.085 |
hsa-miR-199a-5p | HSPA14 | 11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BRCA -0.173; TCGA COAD -0.081; TCGA ESCA -0.119; TCGA HNSC -0.086; TCGA KIRC -0.058; TCGA LGG -0.071; TCGA LUAD -0.131; TCGA LUSC -0.092; TCGA OV -0.079; TCGA STAD -0.151; TCGA UCEC -0.071 |
hsa-miR-199a-5p | NUDT5 | 12 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; STAD; UCEC | miRanda; miRNATAP | TCGA BRCA -0.201; TCGA CESC -0.101; TCGA ESCA -0.194; TCGA HNSC -0.084; TCGA KIRC -0.054; TCGA LGG -0.069; TCGA LIHC -0.096; TCGA LUAD -0.11; TCGA LUSC -0.091; TCGA OV -0.079; TCGA STAD -0.092; TCGA UCEC -0.129 |
hsa-miR-199a-5p | TTC27 | 10 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | miRanda | TCGA BRCA -0.073; TCGA CESC -0.061; TCGA COAD -0.075; TCGA HNSC -0.05; TCGA LIHC -0.086; TCGA LUAD -0.1; TCGA LUSC -0.134; TCGA PRAD -0.057; TCGA STAD -0.077; TCGA UCEC -0.064 |
hsa-miR-199a-5p | GSS | 11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.076; TCGA ESCA -0.141; TCGA HNSC -0.061; TCGA KIRC -0.076; TCGA KIRP -0.169; TCGA LIHC -0.068; TCGA LUSC -0.12; TCGA PAAD -0.105; TCGA THCA -0.058; TCGA STAD -0.157; TCGA UCEC -0.051 |
hsa-miR-199a-5p | GLE1 | 11 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD | miRanda | TCGA BRCA -0.106; TCGA CESC -0.07; TCGA COAD -0.071; TCGA HNSC -0.112; TCGA LIHC -0.075; TCGA LUAD -0.125; TCGA LUSC -0.194; TCGA OV -0.072; TCGA PAAD -0.106; TCGA PRAD -0.055; TCGA STAD -0.183 |
hsa-miR-199a-5p | KPNA2 | 10 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; STAD; UCEC | miRanda | TCGA BRCA -0.293; TCGA CESC -0.124; TCGA COAD -0.166; TCGA HNSC -0.154; TCGA LIHC -0.138; TCGA LUAD -0.15; TCGA LUSC -0.217; TCGA OV -0.075; TCGA STAD -0.153; TCGA UCEC -0.123 |
hsa-miR-199a-5p | FANCD2 | 12 cancers: BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; OV; SARC; STAD; UCEC | miRanda | TCGA BRCA -0.169; TCGA CESC -0.122; TCGA COAD -0.223; TCGA HNSC -0.181; TCGA KIRP -0.077; TCGA LIHC -0.205; TCGA LUAD -0.083; TCGA LUSC -0.157; TCGA OV -0.117; TCGA SARC -0.093; TCGA STAD -0.172; TCGA UCEC -0.102 |
hsa-miR-199a-5p | COPS6 | 9 cancers: BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD | miRanda | TCGA BRCA -0.113; TCGA ESCA -0.106; TCGA KIRC -0.053; TCGA KIRP -0.08; TCGA LIHC -0.082; TCGA LUAD -0.069; TCGA LUSC -0.136; TCGA OV -0.056; TCGA PAAD -0.199 |
hsa-miR-199a-5p | TARS2 | 9 cancers: BRCA; CESC; ESCA; KIRC; LUSC; OV; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.137; TCGA CESC -0.082; TCGA ESCA -0.119; TCGA KIRC -0.064; TCGA LUSC -0.129; TCGA OV -0.096; TCGA THCA -0.062; TCGA STAD -0.133; TCGA UCEC -0.144 |
hsa-miR-199a-5p | QSOX2 | 9 cancers: BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUSC; PAAD | miRanda | TCGA BRCA -0.175; TCGA CESC -0.136; TCGA COAD -0.09; TCGA ESCA -0.097; TCGA KIRC -0.09; TCGA LGG -0.086; TCGA LIHC -0.069; TCGA LUSC -0.112; TCGA PAAD -0.243 |
hsa-miR-199a-5p | UBQLN1 | 9 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD | miRanda | TCGA BRCA -0.069; TCGA COAD -0.104; TCGA ESCA -0.077; TCGA HNSC -0.093; TCGA LUAD -0.13; TCGA LUSC -0.093; TCGA PAAD -0.093; TCGA PRAD -0.08; TCGA STAD -0.154 |
hsa-miR-199a-5p | TMEM97 | 12 cancers: BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD | miRanda | TCGA BRCA -0.155; TCGA COAD -0.141; TCGA ESCA -0.293; TCGA HNSC -0.09; TCGA LGG -0.102; TCGA LIHC -0.135; TCGA LUAD -0.187; TCGA LUSC -0.284; TCGA OV -0.105; TCGA PRAD -0.122; TCGA THCA -0.069; TCGA STAD -0.213 |
hsa-miR-199a-5p | WBSCR22 | 9 cancers: BRCA; ESCA; KIRP; LIHC; LUSC; OV; PAAD; THCA; UCEC | miRanda | TCGA BRCA -0.158; TCGA ESCA -0.154; TCGA KIRP -0.064; TCGA LIHC -0.074; TCGA LUSC -0.102; TCGA OV -0.061; TCGA PAAD -0.265; TCGA THCA -0.051; TCGA UCEC -0.099 |
hsa-miR-199a-5p | INO80E | 10 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; PAAD | miRanda | TCGA BRCA -0.074; TCGA CESC -0.054; TCGA ESCA -0.1; TCGA KIRC -0.177; TCGA KIRP -0.109; TCGA LGG -0.052; TCGA LIHC -0.076; TCGA LUSC -0.093; TCGA OV -0.05; TCGA PAAD -0.123 |
hsa-miR-199a-5p | PPOX | 10 cancers: BRCA; KIRC; KIRP; LGG; LIHC; LUSC; OV; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.089; TCGA KIRC -0.094; TCGA KIRP -0.057; TCGA LGG -0.065; TCGA LIHC -0.126; TCGA LUSC -0.129; TCGA OV -0.116; TCGA PAAD -0.23; TCGA STAD -0.083; TCGA UCEC -0.095 |
hsa-miR-199a-5p | GNPNAT1 | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD | miRanda | TCGA BRCA -0.085; TCGA CESC -0.083; TCGA COAD -0.236; TCGA ESCA -0.244; TCGA HNSC -0.139; TCGA LUAD -0.104; TCGA LUSC -0.146; TCGA PRAD -0.118; TCGA STAD -0.225 |
hsa-miR-199a-5p | FEN1 | 13 cancers: BRCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; SARC; STAD; UCEC | miRanda | TCGA BRCA -0.256; TCGA CESC -0.089; TCGA COAD -0.112; TCGA HNSC -0.127; TCGA KIRC -0.077; TCGA LIHC -0.15; TCGA LUAD -0.108; TCGA LUSC -0.192; TCGA OV -0.085; TCGA PAAD -0.149; TCGA SARC -0.224; TCGA STAD -0.159; TCGA UCEC -0.108 |
hsa-miR-199a-5p | EXOSC9 | 9 cancers: BRCA; COAD; KIRC; LIHC; LUAD; LUSC; OV; PAAD; STAD | miRanda | TCGA BRCA -0.114; TCGA COAD -0.132; TCGA KIRC -0.106; TCGA LIHC -0.054; TCGA LUAD -0.088; TCGA LUSC -0.11; TCGA OV -0.075; TCGA PAAD -0.116; TCGA STAD -0.084 |
hsa-miR-199a-5p | TBC1D22B | 9 cancers: BRCA; COAD; ESCA; KIRC; LUSC; PAAD; PRAD; THCA; STAD | miRanda | TCGA BRCA -0.126; TCGA COAD -0.118; TCGA ESCA -0.121; TCGA KIRC -0.067; TCGA LUSC -0.063; TCGA PAAD -0.095; TCGA PRAD -0.108; TCGA THCA -0.056; TCGA STAD -0.151 |
hsa-miR-199a-5p | HOOK1 | 12 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.161; TCGA COAD -0.178; TCGA HNSC -0.19; TCGA KIRC -0.15; TCGA KIRP -0.066; TCGA LUAD -0.111; TCGA OV -0.095; TCGA PAAD -0.227; TCGA PRAD -0.214; TCGA THCA -0.122; TCGA STAD -0.329; TCGA UCEC -0.201 |
hsa-miR-199a-5p | H2AFV | 9 cancers: BRCA; COAD; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC | miRanda | TCGA BRCA -0.071; TCGA COAD -0.056; TCGA LIHC -0.057; TCGA LUAD -0.065; TCGA LUSC -0.12; TCGA OV -0.052; TCGA PAAD -0.161; TCGA PRAD -0.066; TCGA SARC -0.095 |
hsa-miR-199a-5p | TCTA | 9 cancers: BRCA; ESCA; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD | miRanda; miRNATAP | TCGA BRCA -0.072; TCGA ESCA -0.264; TCGA LIHC -0.097; TCGA LUSC -0.08; TCGA PAAD -0.214; TCGA PRAD -0.057; TCGA SARC -0.173; TCGA THCA -0.069; TCGA STAD -0.09 |
hsa-miR-199a-5p | ADCK5 | 9 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LIHC; PAAD; STAD; UCEC | miRanda | TCGA BRCA -0.202; TCGA COAD -0.125; TCGA ESCA -0.235; TCGA KIRC -0.099; TCGA KIRP -0.07; TCGA LIHC -0.105; TCGA PAAD -0.174; TCGA STAD -0.134; TCGA UCEC -0.106 |
hsa-miR-199a-5p | FGFR1OP | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; OV; STAD; UCEC | miRanda | TCGA BRCA -0.097; TCGA CESC -0.077; TCGA COAD -0.078; TCGA ESCA -0.209; TCGA HNSC -0.06; TCGA KIRC -0.244; TCGA OV -0.082; TCGA STAD -0.176; TCGA UCEC -0.065 |
hsa-miR-199a-5p | KIF11 | 9 cancers: BRCA; COAD; HNSC; KIRC; LIHC; LUAD; OV; STAD; UCEC | miRanda | TCGA BRCA -0.298; TCGA COAD -0.215; TCGA HNSC -0.184; TCGA KIRC -0.088; TCGA LIHC -0.181; TCGA LUAD -0.201; TCGA OV -0.073; TCGA STAD -0.197; TCGA UCEC -0.156 |
hsa-miR-199a-5p | BLOC1S1 | 10 cancers: BRCA; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC | miRanda | TCGA BRCA -0.06; TCGA ESCA -0.183; TCGA KIRC -0.106; TCGA LIHC -0.083; TCGA LUAD -0.063; TCGA LUSC -0.109; TCGA OV -0.093; TCGA PAAD -0.229; TCGA THCA -0.052; TCGA UCEC -0.078 |
hsa-miR-199a-5p | PSMG4 | 9 cancers: BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUSC; OV; PAAD | mirMAP | TCGA BRCA -0.155; TCGA CESC -0.145; TCGA COAD -0.111; TCGA ESCA -0.28; TCGA KIRC -0.118; TCGA LIHC -0.124; TCGA LUSC -0.123; TCGA OV -0.086; TCGA PAAD -0.201 |
hsa-miR-199a-5p | YIPF6 | 11 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.081; TCGA COAD -0.076; TCGA ESCA -0.084; TCGA HNSC -0.054; TCGA LUAD -0.147; TCGA LUSC -0.072; TCGA PRAD -0.223; TCGA SARC -0.061; TCGA THCA -0.057; TCGA STAD -0.086; TCGA UCEC -0.075 |
hsa-miR-199a-5p | IMP3 | 10 cancers: BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUSC; OV; PAAD; STAD | miRNATAP | TCGA BRCA -0.097; TCGA CESC -0.064; TCGA COAD -0.075; TCGA ESCA -0.192; TCGA KIRC -0.116; TCGA LIHC -0.057; TCGA LUSC -0.08; TCGA OV -0.073; TCGA PAAD -0.099; TCGA STAD -0.072 |
hsa-miR-199a-5p | NCSTN | 10 cancers: BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.078; TCGA COAD -0.066; TCGA ESCA -0.089; TCGA LUAD -0.079; TCGA LUSC -0.063; TCGA PAAD -0.075; TCGA PRAD -0.153; TCGA THCA -0.061; TCGA STAD -0.061; TCGA UCEC -0.067 |
hsa-miR-199a-5p | UBQLN4 | 9 cancers: BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; STAD; UCEC | miRNATAP | TCGA BRCA -0.118; TCGA COAD -0.062; TCGA ESCA -0.107; TCGA LGG -0.116; TCGA LIHC -0.114; TCGA LUAD -0.091; TCGA LUSC -0.157; TCGA STAD -0.148; TCGA UCEC -0.105 |
hsa-miR-199a-5p | GTF3C4 | 9 cancers: CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; STAD | miRanda | TCGA CESC -0.087; TCGA COAD -0.134; TCGA HNSC -0.143; TCGA LGG -0.06; TCGA LUAD -0.176; TCGA LUSC -0.128; TCGA OV -0.053; TCGA PRAD -0.23; TCGA STAD -0.144 |
hsa-miR-199a-5p | TFRC | 10 cancers: CESC; COAD; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRanda | TCGA CESC -0.146; TCGA COAD -0.203; TCGA HNSC -0.124; TCGA LIHC -0.072; TCGA LUAD -0.223; TCGA LUSC -0.228; TCGA PRAD -0.092; TCGA SARC -0.131; TCGA STAD -0.227; TCGA UCEC -0.123 |
hsa-miR-199a-5p | HIBADH | 10 cancers: CESC; ESCA; KIRP; LGG; LIHC; LUSC; OV; PAAD; PRAD; THCA | miRanda | TCGA CESC -0.061; TCGA ESCA -0.163; TCGA KIRP -0.064; TCGA LGG -0.077; TCGA LIHC -0.057; TCGA LUSC -0.087; TCGA OV -0.073; TCGA PAAD -0.113; TCGA PRAD -0.064; TCGA THCA -0.088 |
hsa-miR-199a-5p | SMARCD1 | 11 cancers: COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD | MirTarget; miRanda; miRNATAP | TCGA COAD -0.071; TCGA HNSC -0.086; TCGA KIRP -0.065; TCGA LGG -0.09; TCGA LIHC -0.056; TCGA LUAD -0.102; TCGA LUSC -0.1; TCGA OV -0.051; TCGA PAAD -0.107; TCGA PRAD -0.06; TCGA STAD -0.059 |
hsa-miR-199a-5p | BSPRY | 9 cancers: COAD; ESCA; HNSC; LUSC; PAAD; SARC; THCA; STAD; UCEC | miRanda | TCGA COAD -0.095; TCGA ESCA -0.556; TCGA HNSC -0.305; TCGA LUSC -0.309; TCGA PAAD -0.231; TCGA SARC -0.604; TCGA THCA -0.107; TCGA STAD -0.401; TCGA UCEC -0.239 |
hsa-miR-199a-5p | TMEM38B | 9 cancers: COAD; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD | miRanda | TCGA COAD -0.19; TCGA LIHC -0.1; TCGA LUAD -0.264; TCGA LUSC -0.211; TCGA PAAD -0.283; TCGA PRAD -0.261; TCGA SARC -0.104; TCGA THCA -0.179; TCGA STAD -0.209 |
hsa-miR-199a-5p | SUCLG1 | 9 cancers: COAD; ESCA; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | miRanda | TCGA COAD -0.115; TCGA ESCA -0.175; TCGA LUAD -0.128; TCGA LUSC -0.102; TCGA OV -0.065; TCGA PAAD -0.153; TCGA THCA -0.066; TCGA STAD -0.183; TCGA UCEC -0.098 |
hsa-miR-199a-5p | ELP4 | 9 cancers: COAD; HNSC; KIRC; LGG; LIHC; LUAD; OV; PAAD; PRAD | miRanda | TCGA COAD -0.095; TCGA HNSC -0.068; TCGA KIRC -0.051; TCGA LGG -0.098; TCGA LIHC -0.052; TCGA LUAD -0.103; TCGA OV -0.051; TCGA PAAD -0.096; TCGA PRAD -0.089 |
hsa-miR-199a-5p | EXOSC8 | 10 cancers: ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD | miRanda | TCGA ESCA -0.117; TCGA HNSC -0.051; TCGA KIRC -0.091; TCGA KIRP -0.05; TCGA LGG -0.094; TCGA LIHC -0.084; TCGA LUAD -0.086; TCGA LUSC -0.101; TCGA OV -0.107; TCGA PAAD -0.164 |
hsa-miR-199a-5p | TTC39A | 11 cancers: ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA ESCA -0.67; TCGA HNSC -0.184; TCGA KIRC -0.265; TCGA KIRP -0.068; TCGA LUSC -0.205; TCGA OV -0.257; TCGA PAAD -0.223; TCGA PRAD -0.087; TCGA THCA -0.158; TCGA STAD -0.437; TCGA UCEC -0.145 |
Enriched cancer pathways of putative targets