microRNA information: hsa-miR-20b-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-20b-3p | miRbase |
| Accession: | MIMAT0004752 | miRbase |
| Precursor name: | hsa-mir-20b | miRbase |
| Precursor accession: | MI0001519 | miRbase |
| Symbol: | MIR20B | HGNC |
| RefSeq ID: | NR_029950 | GenBank |
| Sequence: | ACUGUAGUAUGGGCACUUCCAG |
Reported expression in cancers: hsa-miR-20b-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-20b-3p | cervical and endocervical cancer | upregulation | "Vote-counting analysis showed that up-regulation w ......" | 25920605 | |
| hsa-miR-20b-3p | cervical and endocervical cancer | upregulation | "Kaplan-Meier and log-rank analyses were used and i ......" | 26427662 | |
| hsa-miR-20b-3p | gastric cancer | upregulation | "Quantitative reverse transcriptase-polymerase chai ......" | 19148490 | qPCR |
| hsa-miR-20b-3p | gastric cancer | upregulation | "The most highly expressed miRNAs in gastric cancer ......" | 19175831 | |
| hsa-miR-20b-3p | gastric cancer | upregulation | "miR 20b overexpression is predictive of poor progn ......" | 26244024 | |
| hsa-miR-20b-3p | lung cancer | upregulation | "Taken together our data suggest that increased exp ......" | 26560875 | |
| hsa-miR-20b-3p | thyroid cancer | downregulation | "MiR 20b Displays Tumor Suppressor Functions in Pap ......" | 27717302 | qPCR |
Reported cancer pathway affected by hsa-miR-20b-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-20b-3p | esophageal cancer | Apoptosis pathway | "Follow-up experimental verification of 7 miRNAs in ......" | 27462775 | |
| hsa-miR-20b-3p | esophageal cancer | Apoptosis pathway | "MicroRNA 20b miR 20b Promotes the Proliferation Mi ......" | 27701465 | Luciferase |
| hsa-miR-20b-3p | kidney renal cell cancer | Apoptosis pathway | "MicroRNA 20b 5p functions as a tumor suppressor in ......" | 26708577 | Flow cytometry |
Reported cancer prognosis affected by hsa-miR-20b-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-20b-3p | B cell lymphoma | poor survival | "Multivariate Cox analysis showed that higher miR-2 ......" | 25634356 | |
| hsa-miR-20b-3p | breast cancer | drug resistance; tumorigenesis | "Crucial role for early growth response 1 in the tr ......" | 23945289 | Luciferase; RNA pull-down |
| hsa-miR-20b-3p | breast cancer | recurrence | "Using microarray-based technology we have performe ......" | 24632820 | |
| hsa-miR-20b-3p | breast cancer | progression; tumorigenesis | "MicroRNA 20b promotes cell growth of breast cancer ......" | 25364498 | Luciferase; Colony formation |
| hsa-miR-20b-3p | breast cancer | metastasis | "miR 20b is up regulated in brain metastases from p ......" | 25893380 | Colony formation |
| hsa-miR-20b-3p | cervical and endocervical cancer | poor survival | "Kaplan-Meier and log-rank analyses were used and i ......" | 26427662 | |
| hsa-miR-20b-3p | colorectal cancer | staging | "MiR 20b 21 and 130b inhibit PTEN expression result ......" | 24468585 | Luciferase |
| hsa-miR-20b-3p | colorectal cancer | tumorigenesis | "Underexpression of miR 126 and miR 20b in heredita ......" | 24994098 | |
| hsa-miR-20b-3p | esophageal cancer | tumorigenesis | "MicroRNA 20b miR 20b Promotes the Proliferation Mi ......" | 27701465 | Luciferase |
| hsa-miR-20b-3p | gastric cancer | poor survival | "Quantitative reverse transcriptase-polymerase chai ......" | 19148490 | |
| hsa-miR-20b-3p | gastric cancer | worse prognosis; poor survival; staging; metastasis | "miR 20b overexpression is predictive of poor progn ......" | 26244024 | |
| hsa-miR-20b-3p | gastric cancer | drug resistance; progression | "Role of miR 27a miR 181a and miR 20b in gastric ca ......" | 26793992 | |
| hsa-miR-20b-3p | kidney renal cell cancer | cell migration | "MicroRNA 20b 5p functions as a tumor suppressor in ......" | 26708577 | Flow cytometry |
| hsa-miR-20b-3p | liver cancer | poor survival | "Clinicopathological Significance of MicroRNA 20b E ......" | 26612965 | |
| hsa-miR-20b-3p | lung squamous cell cancer | poor survival | "Five selected miRNAs let-7f miR-20b miR-30e-3p miR ......" | 20595154 | |
| hsa-miR-20b-3p | lymphoma | poor survival | "The expression of 12 selected miRNAs was studied b ......" | 20485376 | |
| hsa-miR-20b-3p | thyroid cancer | staging; metastasis; progression | "MiR 20b Displays Tumor Suppressor Functions in Pap ......" | 27717302 |
Reported gene related to hsa-miR-20b-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-20b-3p | breast cancer | PTEN | "In vitro RNA-pull down assays indicated that miR-2 ......" | 23945289 |
| hsa-miR-20b-3p | breast cancer | PTEN | "MicroRNA 20b promotes cell growth of breast cancer ......" | 25364498 |
| hsa-miR-20b-3p | colorectal cancer | PTEN | "Finally the impact of these up-regulated miRNAs on ......" | 24468585 |
| hsa-miR-20b-3p | esophageal cancer | PTEN | "Additionally the 3'-untranslated region 3'-UTR of ......" | 27701465 |
| hsa-miR-20b-3p | breast cancer | VEGFA | "Correlation analysis showed that the key miRNAs mi ......" | 22901144 |
| hsa-miR-20b-3p | breast cancer | VEGFA | "We investigated whether and how miR-20b can regula ......" | 20232316 |
| hsa-miR-20b-3p | liver cancer | VEGFA | "Clinicopathological Significance of MicroRNA 20b E ......" | 26612965 |
| hsa-miR-20b-3p | breast cancer | TNS1 | "MicroRNA 20b promotes cell growth of breast cancer ......" | 25364498 |
| hsa-miR-20b-3p | esophageal cancer | TNS1 | "MicroRNA 20b miR 20b Promotes the Proliferation Mi ......" | 27701465 |
| hsa-miR-20b-3p | breast cancer | BRCA1 | "In vitro RNA-pull down assays indicated that miR-2 ......" | 23945289 |
| hsa-miR-20b-3p | colorectal cancer | CD274 | "These findings suggest that miR-20b -21 and -130b ......" | 24468585 |
| hsa-miR-20b-3p | bladder cancer | CDK2 | "The transfection of miR-20b into EJ cells induced ......" | 26166554 |
| hsa-miR-20b-3p | bladder cancer | CDK6 | "The transfection of miR-20b into EJ cells induced ......" | 26166554 |
| hsa-miR-20b-3p | breast cancer | EGR1 | "We identified several GC-rich consensus binding mo ......" | 23945289 |
| hsa-miR-20b-3p | melanoma | ERVK-10 | "miR 20b regulates expression of proteinase activat ......" | 24405508 |
| hsa-miR-20b-3p | melanoma | F2R | "miR 20b regulates expression of proteinase activat ......" | 24405508 |
| hsa-miR-20b-3p | colorectal cancer | FAP | "We analyzed the expressions of miR-126 and miR-20b ......" | 24994098 |
| hsa-miR-20b-3p | breast cancer | HIF1A | "Correlation analysis showed that the key miRNAs mi ......" | 22901144 |
| hsa-miR-20b-3p | breast cancer | INSR | "miR-20b was upregulated by IR and its upregulation ......" | 23945289 |
| hsa-miR-20b-3p | thyroid cancer | KRT1 | "MiR-20b was over-expressed in PTC cell lines K1 an ......" | 27717302 |
| hsa-miR-20b-3p | thyroid cancer | MAPK1 | "By targeting SOS1 and ERK2 miR-20b inhibits the ac ......" | 27717302 |
| hsa-miR-20b-3p | bladder cancer | MMP2 | "MicroRNA 20b inhibits the proliferation migration ......" | 26166554 |
| hsa-miR-20b-3p | lung squamous cell cancer | SCLC1 | "Among them five downregulated miRNAs let-7 miR-20 ......" | 23117485 |
| hsa-miR-20b-3p | liver cancer | SLU7 | "Interestingly altered splicing of miR-17-92 and do ......" | 26804174 |
| hsa-miR-20b-3p | thyroid cancer | SOS1 | "By targeting SOS1 and ERK2 miR-20b inhibits the ac ......" | 27717302 |
Expression profile in cancer corhorts:
