microRNA information: hsa-miR-214-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-214-3p | miRbase |
| Accession: | MIMAT0000271 | miRbase |
| Precursor name: | hsa-mir-214 | miRbase |
| Precursor accession: | MI0000290 | miRbase |
| Symbol: | MIR214 | HGNC |
| RefSeq ID: | NR_029627 | GenBank |
| Sequence: | ACAGCAGGCACAGACAGGCAGU |
Reported expression in cancers: hsa-miR-214-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-214-3p | bladder cancer | downregulation | "MicroRNA-214 miR-214 has been reported to be dysre ......" | 25706919 | |
| hsa-miR-214-3p | breast cancer | upregulation | "An increasing number of studies has confirmed that ......" | 25738546 | |
| hsa-miR-214-3p | breast cancer | downregulation | "miR-214 is involved in numerous physiological and ......" | 27422604 | |
| hsa-miR-214-3p | cervical and endocervical cancer | downregulation | "We determined the expression level of miR-214 and ......" | 19859982 | |
| hsa-miR-214-3p | colon cancer | upregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
| hsa-miR-214-3p | colon cancer | downregulation | "miR-214 has been reported to be associated with se ......" | 25621032 | |
| hsa-miR-214-3p | colorectal cancer | downregulation | "Identification of microRNA 214 as a negative regul ......" | 24616020 | Microarray; Reverse transcription PCR |
| hsa-miR-214-3p | esophageal cancer | upregulation | "Prediction value of miR 483 and miR 214 in prognos ......" | 23721345 | qPCR |
| hsa-miR-214-3p | gastric cancer | deregulation | "353 gastric samples from two independent subsets o ......" | 20022810 | Microarray |
| hsa-miR-214-3p | gastric cancer | deregulation | "miRNA expression signature was first analyzed by r ......" | 21628394 | qPCR |
| hsa-miR-214-3p | gastric cancer | upregulation | "The miRNAs differentially expressed in gastric can ......" | 24473397 | qPCR; Microarray |
| hsa-miR-214-3p | gastric cancer | downregulation | "Clinicopathological significance of microRNA 214 i ......" | 24614175 | qPCR |
| hsa-miR-214-3p | liver cancer | downregulation | "In this study we showed that miR-214 as well as mi ......" | 22359598 | |
| hsa-miR-214-3p | liver cancer | downregulation | "The down-regulation of miR-214 has previously been ......" | 22962603 | qPCR |
| hsa-miR-214-3p | liver cancer | downregulation | "MiR 214 inhibits cell growth in hepatocellular car ......" | 23068095 | |
| hsa-miR-214-3p | liver cancer | downregulation | "miR-214 is one of the most significantly downregul ......" | 23962428 | |
| hsa-miR-214-3p | melanoma | upregulation | "Using a melanoma progression model we identified a ......" | 21468029 | |
| hsa-miR-214-3p | ovarian cancer | deregulation | "We found that in ovarian CAFs miR-31 and miR-214 w ......" | 23171795 | |
| hsa-miR-214-3p | pancreatic cancer | deregulation | "Dysregulation of miR 15a and miR 214 in human panc ......" | 21106054 | qPCR |
| hsa-miR-214-3p | prostate cancer | downregulation | "MicroRNA profiling in prostate cancer the diagnost ......" | 24167554 | qPCR |
| hsa-miR-214-3p | sarcoma | upregulation | "Previous studies have shown that miR-214 functions ......" | 24802407 |
Reported cancer pathway affected by hsa-miR-214-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-214-3p | bladder cancer | Apoptosis pathway | "MicroRNA 214 suppresses oncogenesis and exerts imp ......" | 25706919 | Luciferase |
| hsa-miR-214-3p | breast cancer | Apoptosis pathway | "MiR 214 increases the sensitivity of breast cancer ......" | 26666173 | Western blot; Luciferase |
| hsa-miR-214-3p | breast cancer | Wnt signaling pathway; Apoptosis pathway; Notch signaling pathway | "The miRNAs and their clusters such as the miR-200 ......" | 26712794 | |
| hsa-miR-214-3p | breast cancer | PI3K/Akt signaling pathway | "MicroRNA 214 acts as a potential oncogene in breas ......" | 26951965 | Luciferase |
| hsa-miR-214-3p | breast cancer | cell cycle pathway; Apoptosis pathway | "Tumor suppressing roles of miR 214 and miR 218 in ......" | 27109339 | |
| hsa-miR-214-3p | breast cancer | Apoptosis pathway | "miR 214 promotes apoptosis and sensitizes breast c ......" | 27422604 | |
| hsa-miR-214-3p | cervical and endocervical cancer | Apoptosis pathway | "MiR 214 reduces cell survival and enhances cisplat ......" | 23337879 | |
| hsa-miR-214-3p | cervical and endocervical cancer | cell cycle pathway | "The inhibitory role of miR 214 in cervical cancer ......" | 25556274 | Colony formation |
| hsa-miR-214-3p | colon cancer | Apoptosis pathway | "microRNA 214 functions as a tumor suppressor in hu ......" | 25621032 | Colony formation; Western blot; Luciferase |
| hsa-miR-214-3p | gastric cancer | Apoptosis pathway | "Clinicopathological significance of microRNA 214 i ......" | 24614175 | |
| hsa-miR-214-3p | liver cancer | Apoptosis pathway | "In this study we showed that miR-214 as well as mi ......" | 22359598 | Western blot; Luciferase |
| hsa-miR-214-3p | lung cancer | Wnt signaling pathway | "Targeting the Wnt Regulatory Protein CTNNBIP1 by m ......" | 26299367 | |
| hsa-miR-214-3p | lung cancer | Epithelial mesenchymal transition pathway | "microRNA 214 promotes epithelial mesenchymal trans ......" | 26462018 | |
| hsa-miR-214-3p | ovarian cancer | Apoptosis pathway | "MiR 214 suppressed ovarian cancer and negatively r ......" | 26718213 | Luciferase |
| hsa-miR-214-3p | sarcoma | Apoptosis pathway | "MiR 214 and N ras regulatory loop suppresses rhabd ......" | 24811402 | Colony formation |
| hsa-miR-214-3p | sarcoma | Apoptosis pathway | "MicroRNA 214 Promotes Apoptosis in Canine Hemangio ......" | 26335793 |
Reported cancer prognosis affected by hsa-miR-214-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-214-3p | bladder cancer | malignant trasformation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | |
| hsa-miR-214-3p | bladder cancer | staging; recurrence; progression | "Cell Free microRNA 214 From Urine as a Biomarker f ......" | 24255763 | |
| hsa-miR-214-3p | bladder cancer | worse prognosis; staging; poor survival; recurrence | "MicroRNA 214 suppresses oncogenesis and exerts imp ......" | 25706919 | Luciferase |
| hsa-miR-214-3p | bladder cancer | staging; poor survival; recurrence | "Downregulation of urinary cell free microRNA 214 a ......" | 25975233 | |
| hsa-miR-214-3p | breast cancer | tumorigenesis | "Decreased microRNA 214 levels in breast cancer cel ......" | 21828058 | Luciferase |
| hsa-miR-214-3p | breast cancer | malignant trasformation | "Diagnostic potential of PTEN targeting miR 214 in ......" | 22350790 | |
| hsa-miR-214-3p | breast cancer | poor survival | "High expression of miR 214 is associated with a wo ......" | 25705321 | |
| hsa-miR-214-3p | breast cancer | progression | "microRNA 214 enhances the invasion ability of brea ......" | 25738546 | Luciferase |
| hsa-miR-214-3p | breast cancer | drug resistance | "MiR 214 increases the sensitivity of breast cancer ......" | 26666173 | Western blot; Luciferase |
| hsa-miR-214-3p | breast cancer | tumorigenesis | "miR 214 promotes apoptosis and sensitizes breast c ......" | 27422604 | |
| hsa-miR-214-3p | cervical and endocervical cancer | metastasis | "Plexin B1 is a target of miR 214 in cervical cance ......" | 21216304 | Western blot |
| hsa-miR-214-3p | cervical and endocervical cancer | poor survival | "MiR 214 reduces cell survival and enhances cisplat ......" | 23337879 | |
| hsa-miR-214-3p | cervical and endocervical cancer | progression | "The inhibitory role of miR 214 in cervical cancer ......" | 25556274 | Colony formation |
| hsa-miR-214-3p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
| hsa-miR-214-3p | colorectal cancer | metastasis; worse prognosis; poor survival | "Identification of microRNA 214 as a negative regul ......" | 24616020 | |
| hsa-miR-214-3p | colorectal cancer | progression | "MicroRNA 214 suppresses growth migration and invas ......" | 27537384 | Luciferase |
| hsa-miR-214-3p | esophageal cancer | staging; metastasis | "MicroRNA 98 and microRNA 214 post transcriptionall ......" | 22867052 | Western blot |
| hsa-miR-214-3p | esophageal cancer | worse prognosis; drug resistance; poor survival | "Prediction value of miR 483 and miR 214 in prognos ......" | 23721345 | |
| hsa-miR-214-3p | gastric cancer | staging; metastasis; poor survival | "353 gastric samples from two independent subsets o ......" | 20022810 | |
| hsa-miR-214-3p | gastric cancer | progression; worse prognosis | "MiR 214 regulate gastric cancer cell proliferation ......" | 23834902 | Western blot; Luciferase |
| hsa-miR-214-3p | gastric cancer | progression; tumorigenesis; worse prognosis; metastasis; cell migration | "Clinicopathological significance of microRNA 214 i ......" | 24614175 | |
| hsa-miR-214-3p | gastric cancer | metastasis | "Hemolysis free plasma miR 214 as novel biomarker o ......" | 25973319 | |
| hsa-miR-214-3p | gastric cancer | metastasis; progression | "MicroRNA 214 promotes peritoneal metastasis throug ......" | 27339596 | Western blot |
| hsa-miR-214-3p | liver cancer | tumorigenesis; poor survival; progression | "In this study we showed that miR-214 as well as mi ......" | 22359598 | Western blot; Luciferase |
| hsa-miR-214-3p | liver cancer | recurrence; metastasis | "MiR 214 targets β catenin pathway to suppress inv ......" | 22962603 | Luciferase |
| hsa-miR-214-3p | liver cancer | tumorigenesis | "MiR 214 inhibits cell growth in hepatocellular car ......" | 23068095 | |
| hsa-miR-214-3p | liver cancer | metastasis; progression; recurrence | "Downregulation of microRNA 214 and overexpression ......" | 23962428 | Western blot; Luciferase |
| hsa-miR-214-3p | lung cancer | metastasis; progression; staging | "microRNA 214 promotes epithelial mesenchymal trans ......" | 26462018 | |
| hsa-miR-214-3p | lung cancer | metastasis; progression | "microRNA 214 Governs Lung Cancer Growth and Metast ......" | 27494742 | |
| hsa-miR-214-3p | melanoma | progression; metastasis; poor survival | "microRNA 214 contributes to melanoma tumour progre ......" | 21468029 | |
| hsa-miR-214-3p | melanoma | progression; metastasis | "miR 214 coordinates melanoma progression by upregu ......" | 23667173 | |
| hsa-miR-214-3p | melanoma | progression | "Small RNA deep sequencing discriminates subsets of ......" | 26176991 | |
| hsa-miR-214-3p | melanoma | metastasis | "miR 214 and miR 148b Targeting Inhibits Disseminat ......" | 27328731 | |
| hsa-miR-214-3p | ovarian cancer | poor survival; drug resistance | "MicroRNA expression profiling in human ovarian can ......" | 18199536 | |
| hsa-miR-214-3p | ovarian cancer | staging | "Levels of 8 microRNAs miR-21 miR-141 miR-200a miR- ......" | 18589210 | |
| hsa-miR-214-3p | ovarian cancer | drug resistance | "Furthermore we discuss several other microRNAs tha ......" | 20083225 | |
| hsa-miR-214-3p | ovarian cancer | poor survival | "The Cox proportional hazards model and the log-ran ......" | 21345725 | |
| hsa-miR-214-3p | ovarian cancer | metastasis; drug resistance | "MicroRNA miR 214 regulates ovarian cancer cell ste ......" | 22927443 | |
| hsa-miR-214-3p | ovarian cancer | staging | "Moreover miRNAs also have possible implications fo ......" | 23237306 | |
| hsa-miR-214-3p | ovarian cancer | poor survival | "Nucleoside analog inhibits microRNA 214 through ta ......" | 24033540 | |
| hsa-miR-214-3p | ovarian cancer | metastasis; drug resistance | "For example deficiencies of enzymes including Dice ......" | 24822185 | |
| hsa-miR-214-3p | ovarian cancer | drug resistance | "miR 214 mediated downregulation of RNF8 induces ch ......" | 25483088 | |
| hsa-miR-214-3p | ovarian cancer | malignant trasformation; progression | "MiR 214 suppressed ovarian cancer and negatively r ......" | 26718213 | Luciferase |
| hsa-miR-214-3p | pancreatic cancer | drug resistance | "Dysregulation of miR 15a and miR 214 in human panc ......" | 21106054 | |
| hsa-miR-214-3p | pancreatic cancer | poor survival | "Quantitative real-time PCR qRT-PCR was subsequentl ......" | 26819679 | |
| hsa-miR-214-3p | sarcoma | progression; worse prognosis; metastasis; tumor size; drug resistance; poor survival | "Upregulated expression of microRNA 214 is linked t ......" | 24038809 | |
| hsa-miR-214-3p | sarcoma | tumorigenesis; differentiation | "MiR 214 and N ras regulatory loop suppresses rhabd ......" | 24811402 | Colony formation |
| hsa-miR-214-3p | sarcoma | poor survival | "MicroRNA 214 regulates osteosarcoma survival and g ......" | 25310480 | |
| hsa-miR-214-3p | sarcoma | poor survival | "Using a qPCR-based platform that analyzes more tha ......" | 25784290 | |
| hsa-miR-214-3p | sarcoma | tumorigenesis | "MicroRNA 214 Promotes Apoptosis in Canine Hemangio ......" | 26335793 |
Reported gene related to hsa-miR-214-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-214-3p | breast cancer | PTEN | "MicroRNA 214 acts as a potential oncogene in breas ......" | 26951965 |
| hsa-miR-214-3p | breast cancer | PTEN | "Diagnostic potential of PTEN targeting miR 214 in ......" | 22350790 |
| hsa-miR-214-3p | gastric cancer | PTEN | "MicroRNA 214 promotes peritoneal metastasis throug ......" | 27339596 |
| hsa-miR-214-3p | gastric cancer | PTEN | "MiR 214 regulate gastric cancer cell proliferation ......" | 23834902 |
| hsa-miR-214-3p | ovarian cancer | PTEN | "MicroRNA expression profiling in human ovarian can ......" | 18199536 |
| hsa-miR-214-3p | breast cancer | TP53 | "microRNA 214 enhances the invasion ability of brea ......" | 25738546 |
| hsa-miR-214-3p | breast cancer | TP53 | "miR 214 promotes apoptosis and sensitizes breast c ......" | 27422604 |
| hsa-miR-214-3p | ovarian cancer | TP53 | "Enforcing expression of miR-214 increases whereas ......" | 22927443 |
| hsa-miR-214-3p | sarcoma | TP53 | "MicroRNA 214 Promotes Apoptosis in Canine Hemangio ......" | 26335793 |
| hsa-miR-214-3p | breast cancer | EZH2 | "Decreased microRNA 214 levels in breast cancer cel ......" | 21828058 |
| hsa-miR-214-3p | esophageal cancer | EZH2 | "In Eca109 cells overexpression of miR-98 and miR-2 ......" | 22867052 |
| hsa-miR-214-3p | liver cancer | EZH2 | "The enhancer of zeste homologue 2 EZH2 and β-cate ......" | 22962603 |
| hsa-miR-214-3p | melanoma | ALCAM | "miR 214 coordinates melanoma progression by upregu ......" | 23667173 |
| hsa-miR-214-3p | melanoma | ALCAM | "Notably transendothelial migration in vitro and ex ......" | 27328731 |
| hsa-miR-214-3p | ovarian cancer | CCL5 | "The most highly upregulated chemokine CCL5 C-C mot ......" | 23171795 |
| hsa-miR-214-3p | ovarian cancer | CCL5 | "They identified CCL5 a protumorigenic chemokine th ......" | 23230184 |
| hsa-miR-214-3p | colorectal cancer | FGFR1 | "Further studies indicated that fibroblast growth f ......" | 24616020 |
| hsa-miR-214-3p | liver cancer | FGFR1 | "Downregulation of microRNA 214 and overexpression ......" | 23962428 |
| hsa-miR-214-3p | bladder cancer | FRTS1 | "Moreover miR-214 could serve as an independent fac ......" | 25706919 |
| hsa-miR-214-3p | bladder cancer | FRTS1 | "Additionally miR-214 in urine supernatant could se ......" | 25975233 |
| hsa-miR-214-3p | lung cancer | NANOG | "Strikingly downregulation of miR-214 expression in ......" | 26299367 |
| hsa-miR-214-3p | ovarian cancer | NANOG | "Enforcing expression of miR-214 increases whereas ......" | 22927443 |
| hsa-miR-214-3p | breast cancer | SUFU | "Crosstalk between the vitamin D receptor VDR and m ......" | 27693451 |
| hsa-miR-214-3p | lung cancer | SUFU | "microRNA 214 promotes epithelial mesenchymal trans ......" | 26462018 |
| hsa-miR-214-3p | esophageal cancer | AKR1B1 | "Downregulation of miR-483 and miR-214 could confer ......" | 23721345 |
| hsa-miR-214-3p | colon cancer | ARL2 | "ADP-ribosylation factor-like protein 2 ARL2 is pre ......" | 25621032 |
| hsa-miR-214-3p | cervical and endocervical cancer | BCL2L2 | "MiR 214 reduces cell survival and enhances cisplat ......" | 23337879 |
| hsa-miR-214-3p | esophageal cancer | CDC37 | "MicroRNA 98 and microRNA 214 post transcriptionall ......" | 22867052 |
| hsa-miR-214-3p | lung cancer | CPD | "microRNA 214 Governs Lung Cancer Growth and Metast ......" | 27494742 |
| hsa-miR-214-3p | gastric cancer | CSF1 | "Colony stimulating factor 1 CSF1 was identified as ......" | 24614175 |
| hsa-miR-214-3p | gastric cancer | CSF2 | "Colony stimulating factor 1 CSF1 was identified as ......" | 24614175 |
| hsa-miR-214-3p | liver cancer | CTNNB1 | "The enhancer of zeste homologue 2 EZH2 and β-cate ......" | 22962603 |
| hsa-miR-214-3p | lung cancer | CTNNBIP1 | "Targeting the Wnt Regulatory Protein CTNNBIP1 by m ......" | 26299367 |
| hsa-miR-214-3p | cervical and endocervical cancer | GALNT7 | "MicroRNA 214 suppresses growth and invasiveness of ......" | 22399294 |
| hsa-miR-214-3p | pancreatic cancer | GEM | "In vitro experiments showed that overexpression of ......" | 21106054 |
| hsa-miR-214-3p | colorectal cancer | HMGA1 | "HMGA1 and miR-214 expression levels were estimated ......" | 27537384 |
| hsa-miR-214-3p | ovarian cancer | HSF1 | "Moreover by targeting HSF1 Ly101-4B inhibits the b ......" | 24033540 |
| hsa-miR-214-3p | melanoma | ITGA5 | "Notably transendothelial migration in vitro and ex ......" | 27328731 |
| hsa-miR-214-3p | bladder cancer | LCN2 | "Using the DIANA-mirPath v.2 software miRNAs able t ......" | 27602581 |
| hsa-miR-214-3p | lung cancer | LCT | "We demonstrate that miR-214 overexpression enhance ......" | 26299367 |
| hsa-miR-214-3p | sarcoma | LZTS1 | "miR 214 promotes the proliferation and invasion of ......" | 24802407 |
| hsa-miR-214-3p | cervical and endocervical cancer | MAP2K3 | "HeLa cells that stably overexpress miR-214 downreg ......" | 19859982 |
| hsa-miR-214-3p | cervical and endocervical cancer | MAPK8 | "HeLa cells that stably overexpress miR-214 downreg ......" | 19859982 |
| hsa-miR-214-3p | bladder cancer | MMP9 | "Using the DIANA-mirPath v.2 software miRNAs able t ......" | 27602581 |
| hsa-miR-214-3p | esophageal cancer | MPP2 | "MicroRNA 98 and microRNA 214 post transcriptionall ......" | 22867052 |
| hsa-miR-214-3p | gastric cancer | MTHFR | "In this study we explored the effect of a function ......" | 25998065 |
| hsa-miR-214-3p | bladder cancer | NMI | "Thus urinary cell-free microRNA-214 might be a use ......" | 24255763 |
| hsa-miR-214-3p | sarcoma | NRAS | "MiR 214 and N ras regulatory loop suppresses rhabd ......" | 24811402 |
| hsa-miR-214-3p | bladder cancer | PDRG1 | "MicroRNA 214 suppresses oncogenesis and exerts imp ......" | 25706919 |
| hsa-miR-214-3p | cervical and endocervical cancer | PLXNB1 | "Plexin B1 is a target of miR 214 in cervical cance ......" | 21216304 |
| hsa-miR-214-3p | pancreatic cancer | PSC | "Taken together this study reveals miR-199a-3p and ......" | 26918939 |
| hsa-miR-214-3p | liver cancer | RAB15 | "The editing event caused a decrease of the RNA tra ......" | 24386085 |
| hsa-miR-214-3p | breast cancer | RFWD2 | "miR 214 promotes apoptosis and sensitizes breast c ......" | 27422604 |
| hsa-miR-214-3p | ovarian cancer | RNF8 | "miR 214 mediated downregulation of RNF8 induces ch ......" | 25483088 |
| hsa-miR-214-3p | ovarian cancer | SEMA4D | "MiR 214 suppressed ovarian cancer and negatively r ......" | 26718213 |
| hsa-miR-214-3p | ovarian cancer | SEMA6A | "MiR-214 and semaphorin 4D sema 4D were found to be ......" | 26718213 |
| hsa-miR-214-3p | breast cancer | TAM | "MiR-214 increased the sensitivity of breast cancer ......" | 26666173 |
| hsa-miR-214-3p | cervical and endocervical cancer | TFAM | "The inhibitory role of miR 214 in cervical cancer ......" | 25556274 |
| hsa-miR-214-3p | melanoma | TFAP2A | "miR 214 coordinates melanoma progression by upregu ......" | 23667173 |
| hsa-miR-214-3p | melanoma | TFAP2C | "microRNA 214 contributes to melanoma tumour progre ......" | 21468029 |
| hsa-miR-214-3p | breast cancer | UCP2 | "The expression of miR-214 and uncoupling protein 2 ......" | 26666173 |
| hsa-miR-214-3p | breast cancer | VDR | "Crosstalk between the vitamin D receptor VDR and m ......" | 27693451 |
| hsa-miR-214-3p | colon cancer | WDTC1 | "microRNA 214 functions as a tumor suppressor in hu ......" | 25621032 |
| hsa-miR-214-3p | liver cancer | XBP1 | "To further explore the role of miR-214 in hepatoca ......" | 22359598 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-214-3p | P4HTM | 9 cancers: BLCA; BRCA; CESC; ESCA; OV; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.181; TCGA BRCA -0.144; TCGA CESC -0.079; TCGA ESCA -0.263; TCGA OV -0.112; TCGA PAAD -0.329; TCGA PRAD -0.096; TCGA SARC -0.051; TCGA THCA -0.103 |
hsa-miR-214-3p | RASEF | 10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.279; TCGA BRCA -0.293; TCGA COAD -0.165; TCGA ESCA -0.319; TCGA LUAD -0.175; TCGA LUSC -0.194; TCGA OV -0.199; TCGA PRAD -0.449; TCGA STAD -0.219; TCGA UCEC -0.157 |
hsa-miR-214-3p | USP19 | 10 cancers: BLCA; BRCA; CESC; ESCA; LUSC; OV; PAAD; PRAD; SARC; UCEC | MirTarget | TCGA BLCA -0.086; TCGA BRCA -0.056; TCGA CESC -0.061; TCGA ESCA -0.117; TCGA LUSC -0.053; TCGA OV -0.064; TCGA PAAD -0.091; TCGA PRAD -0.101; TCGA SARC -0.077; TCGA UCEC -0.073 |
hsa-miR-214-3p | PAN2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.185; TCGA BRCA -0.065; TCGA COAD -0.076; TCGA ESCA -0.109; TCGA HNSC -0.05; TCGA LUAD -0.126; TCGA LUSC -0.067; TCGA OV -0.138; TCGA PAAD -0.125; TCGA PRAD -0.122; TCGA STAD -0.12 |
hsa-miR-214-3p | FAM20B | 9 cancers: BLCA; BRCA; COAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.088; TCGA BRCA -0.096; TCGA COAD -0.057; TCGA LUSC -0.153; TCGA PAAD -0.106; TCGA PRAD -0.062; TCGA SARC -0.085; TCGA STAD -0.111; TCGA UCEC -0.057 |
hsa-miR-214-3p | RNF111 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.077; TCGA BRCA -0.052; TCGA COAD -0.116; TCGA ESCA -0.08; TCGA HNSC -0.052; TCGA LUAD -0.073; TCGA LUSC -0.079; TCGA PRAD -0.152; TCGA STAD -0.086 |
hsa-miR-214-3p | ZNF710 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA | MirTarget; miRNATAP | TCGA BLCA -0.083; TCGA BRCA -0.126; TCGA COAD -0.074; TCGA ESCA -0.151; TCGA HNSC -0.102; TCGA LUAD -0.15; TCGA LUSC -0.065; TCGA PRAD -0.171; TCGA SARC -0.099; TCGA THCA -0.078 |
hsa-miR-214-3p | NOS1AP | 10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.107; TCGA BRCA -0.124; TCGA COAD -0.097; TCGA HNSC -0.115; TCGA LUAD -0.137; TCGA LUSC -0.316; TCGA PRAD -0.213; TCGA SARC -0.291; TCGA THCA -0.076; TCGA UCEC -0.169 |
hsa-miR-214-3p | TOR1AIP2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.069; TCGA BRCA -0.106; TCGA COAD -0.174; TCGA ESCA -0.122; TCGA HNSC -0.063; TCGA LUAD -0.083; TCGA LUSC -0.139; TCGA OV -0.069; TCGA PRAD -0.173; TCGA STAD -0.121; TCGA UCEC -0.115 |
hsa-miR-214-3p | NUFIP2 | 9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.074; TCGA BRCA -0.061; TCGA COAD -0.058; TCGA ESCA -0.073; TCGA LUAD -0.054; TCGA LUSC -0.086; TCGA PRAD -0.105; TCGA STAD -0.077; TCGA UCEC -0.055 |
hsa-miR-214-3p | TMEM161B | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.125; TCGA BRCA -0.08; TCGA COAD -0.067; TCGA ESCA -0.149; TCGA HNSC -0.081; TCGA LUAD -0.119; TCGA LUSC -0.095; TCGA OV -0.055; TCGA PRAD -0.157; TCGA SARC -0.101; TCGA STAD -0.159; TCGA UCEC -0.12 |
hsa-miR-214-3p | DDR1 | 9 cancers: BLCA; BRCA; HNSC; LUAD; OV; PRAD; SARC; THCA; UCEC | mirMAP | TCGA BLCA -0.119; TCGA BRCA -0.239; TCGA HNSC -0.064; TCGA LUAD -0.059; TCGA OV -0.075; TCGA PRAD -0.175; TCGA SARC -0.236; TCGA THCA -0.072; TCGA UCEC -0.125 |
hsa-miR-214-3p | ZBTB39 | 9 cancers: BLCA; BRCA; COAD; LUAD; LUSC; OV; PAAD; PRAD; UCEC | miRNATAP | TCGA BLCA -0.084; TCGA BRCA -0.065; TCGA COAD -0.084; TCGA LUAD -0.063; TCGA LUSC -0.099; TCGA OV -0.055; TCGA PAAD -0.095; TCGA PRAD -0.143; TCGA UCEC -0.064 |
hsa-miR-214-3p | TXLNG | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.079; TCGA BRCA -0.147; TCGA COAD -0.148; TCGA ESCA -0.158; TCGA HNSC -0.067; TCGA LUAD -0.11; TCGA LUSC -0.131; TCGA PRAD -0.214; TCGA SARC -0.2; TCGA STAD -0.083; TCGA UCEC -0.128 |
hsa-miR-214-3p | PPIP5K1 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.182; TCGA BRCA -0.12; TCGA COAD -0.063; TCGA ESCA -0.215; TCGA HNSC -0.114; TCGA LUAD -0.142; TCGA PAAD -0.151; TCGA PRAD -0.177; TCGA SARC -0.153; TCGA THCA -0.06; TCGA STAD -0.102; TCGA UCEC -0.06 |
hsa-miR-214-3p | TGFBRAP1 | 9 cancers: BRCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.135; TCGA COAD -0.106; TCGA ESCA -0.119; TCGA LUAD -0.063; TCGA LUSC -0.108; TCGA PRAD -0.323; TCGA SARC -0.142; TCGA STAD -0.072; TCGA UCEC -0.149 |
hsa-miR-214-3p | UHMK1 | 9 cancers: BRCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.217; TCGA COAD -0.261; TCGA ESCA -0.164; TCGA LUAD -0.239; TCGA LUSC -0.209; TCGA PRAD -0.418; TCGA SARC -0.21; TCGA STAD -0.126; TCGA UCEC -0.223 |
hsa-miR-214-3p | ABCB10 | 10 cancers: BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.085; TCGA COAD -0.111; TCGA HNSC -0.074; TCGA LUAD -0.103; TCGA LUSC -0.084; TCGA PAAD -0.098; TCGA PRAD -0.144; TCGA SARC -0.172; TCGA STAD -0.141; TCGA UCEC -0.051 |
hsa-miR-214-3p | MTM1 | 9 cancers: BRCA; COAD; HNSC; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.052; TCGA COAD -0.066; TCGA HNSC -0.052; TCGA LUSC -0.11; TCGA PRAD -0.118; TCGA SARC -0.123; TCGA THCA -0.056; TCGA STAD -0.098; TCGA UCEC -0.13 |
hsa-miR-214-3p | SSX2IP | 9 cancers: BRCA; COAD; HNSC; LUAD; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.159; TCGA COAD -0.078; TCGA HNSC -0.09; TCGA LUAD -0.1; TCGA OV -0.106; TCGA PAAD -0.209; TCGA SARC -0.078; TCGA STAD -0.084; TCGA UCEC -0.061 |
hsa-miR-214-3p | TMPPE | 9 cancers: BRCA; ESCA; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.069; TCGA ESCA -0.179; TCGA LUAD -0.097; TCGA LUSC -0.106; TCGA OV -0.058; TCGA PRAD -0.161; TCGA SARC -0.143; TCGA STAD -0.126; TCGA UCEC -0.125 |
hsa-miR-214-3p | TTC39A | 11 cancers: BRCA; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.158; TCGA ESCA -0.358; TCGA HNSC -0.3; TCGA LUAD -0.122; TCGA LUSC -0.188; TCGA OV -0.244; TCGA PAAD -0.23; TCGA PRAD -0.085; TCGA THCA -0.182; TCGA STAD -0.184; TCGA UCEC -0.102 |
hsa-miR-214-3p | KCNJ11 | 9 cancers: BRCA; ESCA; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC | mirMAP | TCGA BRCA -0.173; TCGA ESCA -0.305; TCGA LUAD -0.185; TCGA LUSC -0.24; TCGA OV -0.153; TCGA PAAD -0.573; TCGA PRAD -0.135; TCGA THCA -0.223; TCGA UCEC -0.107 |
Enriched cancer pathways of putative targets