microRNA information: hsa-miR-221-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-221-3p | miRbase |
| Accession: | MIMAT0000278 | miRbase |
| Precursor name: | hsa-mir-221 | miRbase |
| Precursor accession: | MI0000298 | miRbase |
| Symbol: | MIR221 | HGNC |
| RefSeq ID: | NR_029635 | GenBank |
| Sequence: | AGCUACAUUGUCUGCUGGGUUUC |
Reported expression in cancers: hsa-miR-221-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-221-3p | bladder cancer | upregulation | "Accumulating evidence indicates that EMT can be re ......" | 25928257 | |
| hsa-miR-221-3p | breast cancer | upregulation | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | qPCR |
| hsa-miR-221-3p | breast cancer | upregulation | "MiR-221 displayed an upregulation in breast cancer ......" | 23801152 | |
| hsa-miR-221-3p | breast cancer | upregulation | "In this study we found the level of microRNA221 mi ......" | 25686829 | |
| hsa-miR-221-3p | breast cancer | upregulation | "In this study the expression of miR-221 in breast ......" | 26503209 | |
| hsa-miR-221-3p | breast cancer | upregulation | "We found that miR-221 was upregulated in BCSCs com ......" | 26556862 | |
| hsa-miR-221-3p | colon cancer | upregulation | "Prognostic value of miR 221 3p miR 342 3p and miR ......" | 25075256 | |
| hsa-miR-221-3p | colon cancer | upregulation | "Expression of miR 221 in colon cancer correlates w ......" | 25932237 | qPCR |
| hsa-miR-221-3p | colorectal cancer | upregulation | "MicroRNA 221 inhibits CDKN1C/p57 expression in hum ......" | 21278784 | qPCR |
| hsa-miR-221-3p | colorectal cancer | upregulation | "MicroRNA 221 controls CDKN1C/P57 expression in hum ......" | 21538272 | qPCR |
| hsa-miR-221-3p | colorectal cancer | upregulation | "The increased expression of miR-200c miR-221 and m ......" | 21873159 | |
| hsa-miR-221-3p | colorectal cancer | upregulation | "We provide insight into the behavior of miR-221 in ......" | 24269686 | |
| hsa-miR-221-3p | colorectal cancer | upregulation | "microRNA 221 and microRNA 18a identification in st ......" | 25233396 | |
| hsa-miR-221-3p | endometrial cancer | deregulation | "In endometrial cancer cells expression levels of m ......" | 26535032 | |
| hsa-miR-221-3p | gastric cancer | upregulation | "Increased Expression of MicroRNA 221 in gastric ca ......" | 22613407 | Reverse transcription PCR; qPCR |
| hsa-miR-221-3p | gastric cancer | upregulation | "The expression levels of miR-20a miR-21 miR-25 miR ......" | 22996433 | qPCR |
| hsa-miR-221-3p | gastric cancer | upregulation | "The miRNAs differentially expressed in gastric can ......" | 24473397 | qPCR; Microarray |
| hsa-miR-221-3p | gastric cancer | upregulation | "Expression Analysis of mir 21 and mir 221 in Cance ......" | 26209976 | qPCR |
| hsa-miR-221-3p | gastric cancer | upregulation | "From the set of the 29 microRNAs of interest we fo ......" | 27081844 | |
| hsa-miR-221-3p | glioblastoma | upregulation | "These include two sites for microRNA 221 and 222 w ......" | 17721077 | |
| hsa-miR-221-3p | glioblastoma | upregulation | "MicroRNA miR-221 and miR-222 are frequently upregu ......" | 20428775 | |
| hsa-miR-221-3p | glioblastoma | upregulation | "MiR-221 and miR-222 miR-221/222 are frequently up- ......" | 20813046 | |
| hsa-miR-221-3p | glioblastoma | upregulation | "Overexpression of miR-221 led to cell survival and ......" | 24780067 | |
| hsa-miR-221-3p | liver cancer | upregulation | "For example up-regulation of mir-221 and mir-21 co ......" | 19120703 | |
| hsa-miR-221-3p | liver cancer | upregulation | "Expression of serum miR 221 in human hepatocellula ......" | 21295551 | qPCR |
| hsa-miR-221-3p | liver cancer | upregulation | "Deregulated expression of microRNA 221 with the po ......" | 21458843 | |
| hsa-miR-221-3p | liver cancer | upregulation | "Increased miR 221 expression in hepatocellular car ......" | 23320393 | qPCR |
| hsa-miR-221-3p | liver cancer | upregulation | "p53/mdm2 feedback loop sustains miR 221 expression ......" | 24324033 | |
| hsa-miR-221-3p | liver cancer | upregulation | "Inhibiting the oncogenic mir 221 by microRNA spong ......" | 25436097 | |
| hsa-miR-221-3p | lung squamous cell cancer | upregulation | "In conclusion we show that high expression levels ......" | 18246122 | |
| hsa-miR-221-3p | ovarian cancer | downregulation | "Using microRNA microarrays we identify several miR ......" | 18560586 | Microarray |
| hsa-miR-221-3p | ovarian cancer | upregulation | "Prognostic significance of serum microRNA 221 expr ......" | 23569131 | Reverse transcription PCR; qPCR |
| hsa-miR-221-3p | pancreatic cancer | upregulation | "Profiling of 95 microRNAs in pancreatic cancer cel ......" | 19030927 | qPCR |
| hsa-miR-221-3p | pancreatic cancer | deregulation | "miR-122 let-7 family and miR-101 are down-regulate ......" | 22303361 | |
| hsa-miR-221-3p | pancreatic cancer | deregulation | "In the present study we found that the expression ......" | 24224124 | |
| hsa-miR-221-3p | pancreatic cancer | downregulation | "Moreover we showed that the down-regulation of miR ......" | 25955843 | |
| hsa-miR-221-3p | prostate cancer | downregulation | "Expression of microRNA 221 is progressively reduce ......" | 19585579 | Microarray |
| hsa-miR-221-3p | prostate cancer | downregulation | "miR 221 Is down regulated in TMPRSS2:ERG fusion po ......" | 21378318 | Microarray |
| hsa-miR-221-3p | prostate cancer | downregulation | "Downregulation of miR 221 30d and 15a contributes ......" | 25761682 | qPCR |
| hsa-miR-221-3p | prostate cancer | downregulation | "Our present study of the microRNA miRNA expression ......" | 26325107 | |
| hsa-miR-221-3p | thyroid cancer | upregulation | "A set of five miRNAs including the three most up-r ......" | 16365291 | |
| hsa-miR-221-3p | thyroid cancer | upregulation | "We studied the expression levels of miR-221 using ......" | 22855362 | Northern blot |
| hsa-miR-221-3p | thyroid cancer | upregulation | "Using laser microdissection followed by quantitati ......" | 23563786 | qPCR |
| hsa-miR-221-3p | thyroid cancer | upregulation | "MiR-221 is frequently upregulated in papillary thy ......" | 27077469 |
Reported cancer pathway affected by hsa-miR-221-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-221-3p | bladder cancer | Apoptosis pathway | "MicroRNA 221 silencing predisposed human bladder c ......" | 19767219 | Flow cytometry; Western blot |
| hsa-miR-221-3p | bladder cancer | Epithelial mesenchymal transition pathway | "miR 221 facilitates the TGFbeta1 induced epithelia ......" | 25928257 | Western blot; Luciferase |
| hsa-miR-221-3p | breast cancer | Apoptosis pathway | "Of the elevated miRNAs in ERalpha-negative cells m ......" | 18790736 | |
| hsa-miR-221-3p | breast cancer | cell cycle pathway; Apoptosis pathway | "miR 221 promotes tumorigenesis in human triple neg ......" | 23637992 | |
| hsa-miR-221-3p | breast cancer | Apoptosis pathway | "MiR 221 promotes trastuzumab resistance and metast ......" | 24286315 | |
| hsa-miR-221-3p | breast cancer | cell cycle pathway | "miRNA inhibitors specially targeting miR-221 or mi ......" | 24886939 | |
| hsa-miR-221-3p | breast cancer | Epithelial mesenchymal transition pathway | "Trail resistance induces epithelial mesenchymal tr ......" | 24905916 | |
| hsa-miR-221-3p | breast cancer | Epithelial mesenchymal transition pathway | "In this study we found the level of microRNA221 mi ......" | 25686829 | |
| hsa-miR-221-3p | breast cancer | Apoptosis pathway | "Knockdown of miR 221 promotes the cisplatin induci ......" | 26503209 | MTT assay |
| hsa-miR-221-3p | cervical and endocervical cancer | PI3K/Akt signaling pathway | "MicroRNA 221 targets PTEN to reduce the sensitivit ......" | 26482612 | |
| hsa-miR-221-3p | colorectal cancer | Apoptosis pathway | "MicroRNA 221 inhibits CDKN1C/p57 expression in hum ......" | 21278784 | Western blot; Flow cytometry; MTT assay; Luciferase |
| hsa-miR-221-3p | colorectal cancer | Apoptosis pathway | "Effect of miR 221 specific inhibitor on the prolif ......" | 21515467 | Flow cytometry; MTT assay |
| hsa-miR-221-3p | colorectal cancer | Apoptosis pathway | "MicroRNA 221 controls CDKN1C/P57 expression in hum ......" | 21538272 | Western blot; Flow cytometry; MTT assay |
| hsa-miR-221-3p | gastric cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 221 and microRNA 222 regulate gastric car ......" | 20618998 | Western blot; Luciferase |
| hsa-miR-221-3p | gastric cancer | Apoptosis pathway | "Propofol suppresses proliferation and invasion of ......" | 26214494 | MTT assay |
| hsa-miR-221-3p | glioblastoma | cell cycle pathway | "Northern blot analysis was conducted to detect the ......" | 19953484 | Flow cytometry; Western blot |
| hsa-miR-221-3p | glioblastoma | PI3K/Akt signaling pathway; Apoptosis pathway | "MicroRNA 221 targeting PI3 K/Akt signaling axis in ......" | 24780067 | |
| hsa-miR-221-3p | liver cancer | cell cycle pathway | "MiR 221 controls CDKN1C/p57 and CDKN1B/p27 express ......" | 18521080 | |
| hsa-miR-221-3p | liver cancer | cell cycle pathway | "For example up-regulation of mir-221 and mir-21 co ......" | 19120703 | |
| hsa-miR-221-3p | liver cancer | Apoptosis pathway | "MicroRNA 221 targets Bmf in hepatocellular carcino ......" | 19671867 | Luciferase |
| hsa-miR-221-3p | liver cancer | cell cycle pathway | "Clinical significance of miR 221 and its inverse c ......" | 20146005 | Western blot |
| hsa-miR-221-3p | liver cancer | Apoptosis pathway | "Effect of miR 221 on the viability and apoptosis o ......" | 22152314 | Flow cytometry |
| hsa-miR-221-3p | liver cancer | Apoptosis pathway; cell cycle pathway | "Increased miR 221 expression in hepatocellular car ......" | 23320393 | Flow cytometry |
| hsa-miR-221-3p | liver cancer | cell cycle pathway | "p53/mdm2 feedback loop sustains miR 221 expression ......" | 24324033 | |
| hsa-miR-221-3p | liver cancer | cell cycle pathway; Apoptosis pathway | "miRNAs are small non-coding RNAs which target comp ......" | 24496037 | |
| hsa-miR-221-3p | liver cancer | Apoptosis pathway | "Bioinformatics analysis identifies miR 221 as a co ......" | 24993451 | |
| hsa-miR-221-3p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "Growth inhibitory effects of miR 221 and miR 222 i ......" | 25641933 | |
| hsa-miR-221-3p | ovarian cancer | cell cycle pathway | "MiR 221 and MiR 222 alterations in sporadic ovaria ......" | 20461750 | |
| hsa-miR-221-3p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "The contribution of overexpressed microRNA-21 and ......" | 19730150 | |
| hsa-miR-221-3p | pancreatic cancer | Epithelial mesenchymal transition pathway | "MicroRNA 221 mediates the effects of PDGF BB on mi ......" | 23967190 | |
| hsa-miR-221-3p | pancreatic cancer | Epithelial mesenchymal transition pathway | "But the detailed molecular mechanism about miR-221 ......" | 27726102 | |
| hsa-miR-221-3p | prostate cancer | cell cycle pathway | "miR 221 and miR 222 expression affects the prolife ......" | 17569667 | Colony formation |
| hsa-miR-221-3p | prostate cancer | cell cycle pathway | "The inhibition of the highly expressed miR 221 and ......" | 19107213 | |
| hsa-miR-221-3p | prostate cancer | Apoptosis pathway | "Overexpression of ARHI inhibited cell proliferatio ......" | 21071579 | Colony formation; Luciferase |
| hsa-miR-221-3p | prostate cancer | cell cycle pathway | "MiR 221 promotes the development of androgen indep ......" | 23770851 | |
| hsa-miR-221-3p | prostate cancer | Apoptosis pathway; Jak-STAT signaling pathway | "Survival in patients with high risk prostate cance ......" | 24607843 | |
| hsa-miR-221-3p | prostate cancer | cell cycle pathway; Apoptosis pathway | "Down regulation of mir 221 and mir 222 restrain pr ......" | 24892674 | |
| hsa-miR-221-3p | sarcoma | Apoptosis pathway; cell cycle pathway | "MicroRNA 221 induces cell survival and cisplatin r ......" | 23372675 | Western blot; Luciferase |
| hsa-miR-221-3p | thyroid cancer | Apoptosis pathway | "MiR 221 Exacerbate Cell Proliferation and Invasion ......" | 27077469 |
Reported cancer prognosis affected by hsa-miR-221-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-221-3p | acute myeloid leukemia | differentiation | "We studied miRNA expression of leukemic blasts of ......" | 20425795 | |
| hsa-miR-221-3p | acute myeloid leukemia | differentiation | "The integrated information gathered from the two m ......" | 25612891 | |
| hsa-miR-221-3p | bladder cancer | immune evasion | "MiR 221 induced PUMA silencing mediates immune eva ......" | 25585941 | |
| hsa-miR-221-3p | bladder cancer | metastasis; progression; malignant trasformation | "miR 221 facilitates the TGFbeta1 induced epithelia ......" | 25928257 | Western blot; Luciferase |
| hsa-miR-221-3p | breast cancer | drug resistance | "The drug resistance of MCF-7/ADR cells was evaluat ......" | 18971180 | Flow cytometry; MTT assay |
| hsa-miR-221-3p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
| hsa-miR-221-3p | breast cancer | cell migration | "We identified the microRNAs miRNAs miR-221 and miR ......" | 21673316 | |
| hsa-miR-221-3p | breast cancer | drug resistance | "Plasma miR 221 as a predictive biomarker for chemo ......" | 22156446 | |
| hsa-miR-221-3p | breast cancer | cell migration | "Correlation between Slug transcription factor and ......" | 23031797 | Western blot; Wound Healing Assay |
| hsa-miR-221-3p | breast cancer | progression | "MiR-221 expression was significantly increased in ......" | 23226290 | |
| hsa-miR-221-3p | breast cancer | progression; drug resistance | "Here we find that nucleolin NCL a major nucleolar ......" | 23610125 | |
| hsa-miR-221-3p | breast cancer | tumorigenesis; progression; cell migration | "miR 221 promotes tumorigenesis in human triple neg ......" | 23637992 | |
| hsa-miR-221-3p | breast cancer | staging | "MiR-221/-222 expressions were analysed in 86 breas ......" | 24129242 | |
| hsa-miR-221-3p | breast cancer | metastasis; drug resistance; malignant trasformation; progression; worse prognosis | "MiR 221 promotes trastuzumab resistance and metast ......" | 24286315 | |
| hsa-miR-221-3p | breast cancer | drug resistance | "Trail resistance induces epithelial mesenchymal tr ......" | 24905916 | |
| hsa-miR-221-3p | breast cancer | malignant trasformation | "In this study we found the level of microRNA221 mi ......" | 25686829 | |
| hsa-miR-221-3p | breast cancer | staging; poor survival | "Prognostic and biological significance of microRNA ......" | 26253160 | |
| hsa-miR-221-3p | breast cancer | progression | "Slug upregulated miR 221 promotes breast cancer pr ......" | 27174021 | |
| hsa-miR-221-3p | breast cancer | staging | "We report for the first time an extremely high pre ......" | 27404381 | |
| hsa-miR-221-3p | colon cancer | poor survival; staging | "Prognostic value of miR 221 3p miR 342 3p and miR ......" | 25075256 | |
| hsa-miR-221-3p | colon cancer | worse prognosis; staging; poor survival | "Expression of miR 221 in colon cancer correlates w ......" | 25932237 | |
| hsa-miR-221-3p | colorectal cancer | poor survival; worse prognosis | "Circulating miR 221 directly amplified from plasma ......" | 20880178 | |
| hsa-miR-221-3p | colorectal cancer | staging; progression | "MicroRNA 221 inhibits CDKN1C/p57 expression in hum ......" | 21278784 | Western blot; Flow cytometry; MTT assay; Luciferase |
| hsa-miR-221-3p | colorectal cancer | progression | "MicroRNA 221 controls CDKN1C/P57 expression in hum ......" | 21538272 | Western blot; Flow cytometry; MTT assay |
| hsa-miR-221-3p | colorectal cancer | metastasis | "Decreased levels of miR 224 and the passenger stra ......" | 23770133 | |
| hsa-miR-221-3p | colorectal cancer | metastasis; cell migration | "MicroRNA 221 promotes colorectal cancer cell invas ......" | 24269686 | |
| hsa-miR-221-3p | colorectal cancer | staging; drug resistance | "To explore the potential molecular biomarkers pred ......" | 24460313 | |
| hsa-miR-221-3p | colorectal cancer | staging | "microRNA 221 and microRNA 18a identification in st ......" | 25233396 | |
| hsa-miR-221-3p | endometrial cancer | metastasis; tumorigenesis | "In endometrial cancer cells expression levels of m ......" | 26535032 | |
| hsa-miR-221-3p | gastric cancer | drug resistance; progression; malignant trasformation | "MicroRNA 221 and microRNA 222 regulate gastric car ......" | 20618998 | Western blot; Luciferase |
| hsa-miR-221-3p | gastric cancer | differentiation | "Differential miRNAs were identified in serum pools ......" | 22432036 | |
| hsa-miR-221-3p | gastric cancer | malignant trasformation; progression; staging; metastasis; poor survival | "Increased Expression of MicroRNA 221 in gastric ca ......" | 22613407 | |
| hsa-miR-221-3p | gastric cancer | metastasis; poor survival | "The expression levels of miR-20a miR-21 miR-25 miR ......" | 22996433 | |
| hsa-miR-221-3p | glioblastoma | malignant trasformation | "In our study we examined by microarray the global ......" | 16039986 | |
| hsa-miR-221-3p | glioblastoma | poor survival | "MiR 221 and miR 222 target PUMA to induce cell sur ......" | 20813046 | |
| hsa-miR-221-3p | glioblastoma | tumorigenesis | "Among different miRs we focused our attention on m ......" | 21743492 | Western blot |
| hsa-miR-221-3p | glioblastoma | differentiation | "Using this in vitro system a microarray-based high ......" | 24155920 | |
| hsa-miR-221-3p | glioblastoma | drug resistance | "In our study we found that radiation induced c-jun ......" | 24295494 | RNAi |
| hsa-miR-221-3p | glioblastoma | drug resistance; poor survival | "MicroRNA 221 targeting PI3 K/Akt signaling axis in ......" | 24780067 | |
| hsa-miR-221-3p | kidney renal cell cancer | poor survival; metastasis; staging | "Higher circulating expression levels of miR 221 as ......" | 24379138 | |
| hsa-miR-221-3p | kidney renal cell cancer | poor survival | "Impact of miR 21 miR 126 and miR 221 as prognostic ......" | 25279769 | |
| hsa-miR-221-3p | kidney renal cell cancer | progression | "In this study we investigated the role of miR-221 ......" | 26191221 | Luciferase |
| hsa-miR-221-3p | kidney renal cell cancer | poor survival | "We validated the negative correlation between miR- ......" | 26201448 | |
| hsa-miR-221-3p | kidney renal cell cancer | worse prognosis | "We found that elevated expression of miR-21 miR-12 ......" | 26416448 | |
| hsa-miR-221-3p | liver cancer | worse prognosis; drug resistance; tumorigenesis | "MiR 221 controls CDKN1C/p57 and CDKN1B/p27 express ......" | 18521080 | |
| hsa-miR-221-3p | liver cancer | progression | "For example up-regulation of mir-221 and mir-21 co ......" | 19120703 | |
| hsa-miR-221-3p | liver cancer | tumorigenesis; recurrence | "MicroRNA 221 targets Bmf in hepatocellular carcino ......" | 19671867 | Luciferase |
| hsa-miR-221-3p | liver cancer | staging; metastasis; tumor size; tumorigenesis | "Clinical significance of miR 221 and its inverse c ......" | 20146005 | Western blot |
| hsa-miR-221-3p | liver cancer | worse prognosis; staging; tumor size; poor survival | "Expression of serum miR 221 in human hepatocellula ......" | 21295551 | |
| hsa-miR-221-3p | liver cancer | recurrence; metastasis; tumorigenesis | "Deregulated expression of microRNA 221 with the po ......" | 21458843 | |
| hsa-miR-221-3p | liver cancer | progression | "The miRNA levels were examined using microarray te ......" | 21876625 | |
| hsa-miR-221-3p | liver cancer | poor survival | "miR 221 silencing blocks hepatocellular carcinoma ......" | 22009537 | |
| hsa-miR-221-3p | liver cancer | staging | "Effect of miR 221 on the viability and apoptosis o ......" | 22152314 | Flow cytometry |
| hsa-miR-221-3p | liver cancer | staging; worse prognosis | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | |
| hsa-miR-221-3p | liver cancer | staging; worse prognosis | "Increased miR 221 expression in hepatocellular car ......" | 23320393 | Flow cytometry |
| hsa-miR-221-3p | liver cancer | drug resistance; progression | "p53/mdm2 feedback loop sustains miR 221 expression ......" | 24324033 | |
| hsa-miR-221-3p | liver cancer | cell migration; worse prognosis | "miRNAs are small non-coding RNAs which target comp ......" | 24496037 | |
| hsa-miR-221-3p | liver cancer | tumorigenesis; malignant trasformation | "Bioinformatics analysis identifies miR 221 as a co ......" | 24993451 | |
| hsa-miR-221-3p | liver cancer | staging; metastasis; recurrence | "Inhibiting the oncogenic mir 221 by microRNA spong ......" | 25436097 | |
| hsa-miR-221-3p | liver cancer | malignant trasformation; progression; tumorigenesis | "MicroRNA 221 governs tumor suppressor HDAC6 to pot ......" | 25817558 | |
| hsa-miR-221-3p | lung squamous cell cancer | drug resistance | "We show that in TRAIL-resistant NSCLC cells levels ......" | 18246122 | |
| hsa-miR-221-3p | lung squamous cell cancer | staging; recurrence | "In an exploratory study we determined whether expr ......" | 20975375 | |
| hsa-miR-221-3p | lung squamous cell cancer | worse prognosis | "High-throughput microarray was used to measure miR ......" | 22618509 | |
| hsa-miR-221-3p | lung squamous cell cancer | tumorigenesis; drug resistance | "It has been recently reported that epidermal growt ......" | 24286402 | |
| hsa-miR-221-3p | lung squamous cell cancer | staging | "In order to find novel noninvasive biomarkers with ......" | 25421010 | |
| hsa-miR-221-3p | lung squamous cell cancer | worse prognosis; poor survival; progression | "Overexpression of MicroRNA 221 is associated with ......" | 26831656 | |
| hsa-miR-221-3p | lymphoma | poor survival; drug resistance | "Diagnostic and prognostic value of circulating miR ......" | 21206010 | |
| hsa-miR-221-3p | melanoma | progression; differentiation | "We have identified the promyelocytic leukemia zinc ......" | 18417445 | |
| hsa-miR-221-3p | melanoma | progression | "MicroRNA 221 and 222 pathway controls melanoma pro ......" | 18983236 | |
| hsa-miR-221-3p | melanoma | malignant trasformation; staging; recurrence; progression | "The circulating microRNA 221 level in patients wit ......" | 21273047 | |
| hsa-miR-221-3p | melanoma | malignant trasformation | "Construction of circular miRNA sponges targeting m ......" | 24035906 | |
| hsa-miR-221-3p | melanoma | malignant trasformation; worse prognosis | "Circulating miR 221 expression level and prognosis ......" | 25430553 | |
| hsa-miR-221-3p | ovarian cancer | poor survival | "MiR 221 and MiR 222 alterations in sporadic ovaria ......" | 20461750 | |
| hsa-miR-221-3p | ovarian cancer | worse prognosis; staging; poor survival | "Prognostic significance of serum microRNA 221 expr ......" | 23569131 | |
| hsa-miR-221-3p | pancreatic cancer | malignant trasformation | "The contribution of overexpressed microRNA-21 and ......" | 19730150 | |
| hsa-miR-221-3p | pancreatic cancer | tumorigenesis | "miR-122 let-7 family and miR-101 are down-regulate ......" | 22303361 | |
| hsa-miR-221-3p | pancreatic cancer | metastasis; malignant trasformation | "Clinical impact of circulating miR 221 in plasma o ......" | 23329235 | |
| hsa-miR-221-3p | pancreatic cancer | poor survival | "Down regulation of miR 221 inhibits proliferation ......" | 24224124 | |
| hsa-miR-221-3p | pancreatic cancer | metastasis; tumorigenesis; drug resistance; progression | "Antisense inhibition of microRNA 21 and microRNA 2 ......" | 25639539 | Flow cytometry |
| hsa-miR-221-3p | pancreatic cancer | progression | "Serum samples were collected for the measurement o ......" | 26998056 | |
| hsa-miR-221-3p | pancreatic cancer | drug resistance | "In particular modulations of let-7 miR-29a miR-17- ......" | 27539232 | |
| hsa-miR-221-3p | pancreatic cancer | drug resistance | "But the detailed molecular mechanism about miR-221 ......" | 27726102 | |
| hsa-miR-221-3p | prostate cancer | drug resistance | "The role of microRNA 221 and microRNA 222 in andro ......" | 19351832 | |
| hsa-miR-221-3p | prostate cancer | metastasis; progression; recurrence | "Expression of microRNA 221 is progressively reduce ......" | 19585579 | |
| hsa-miR-221-3p | prostate cancer | differentiation; staging | "MiR 221 expression affects invasion potential of h ......" | 21487968 | Cell proliferation assay; Cell Proliferation Assay; Western blot |
| hsa-miR-221-3p | prostate cancer | progression | "The expression and clinical significance of GTP bi ......" | 22117988 | |
| hsa-miR-221-3p | prostate cancer | recurrence | "miR 21 miR 221 and miR 222 expression and prostate ......" | 23353719 | |
| hsa-miR-221-3p | prostate cancer | metastasis | "MiR 221 promotes the development of androgen indep ......" | 23770851 | |
| hsa-miR-221-3p | prostate cancer | poor survival | "Survival in patients with high risk prostate cance ......" | 24607843 | |
| hsa-miR-221-3p | prostate cancer | recurrence | "Investigation of miR 21 miR 141 and miR 221 expres ......" | 25252191 | |
| hsa-miR-221-3p | prostate cancer | cell migration | "Our present study of the microRNA miRNA expression ......" | 26325107 | |
| hsa-miR-221-3p | sarcoma | poor survival; drug resistance; malignant trasformation | "MicroRNA 221 induces cell survival and cisplatin r ......" | 23372675 | Western blot; Luciferase |
| hsa-miR-221-3p | sarcoma | progression; tumorigenesis | "MiR 221 increases osteosarcoma cell proliferation ......" | 26397386 | Cell migration assay; Wound Healing Assay; Western blot |
| hsa-miR-221-3p | thyroid cancer | tumorigenesis | "A set of five miRNAs including the three most up-r ......" | 16365291 | |
| hsa-miR-221-3p | thyroid cancer | tumorigenesis | "MicroRNA miRNA microarray analysis has consistentl ......" | 18587330 | |
| hsa-miR-221-3p | thyroid cancer | malignant trasformation | "Quantitative polymerase chain reaction on a panel ......" | 21275764 | |
| hsa-miR-221-3p | thyroid cancer | metastasis; recurrence | "In this study we evaluated miRNA expression as a m ......" | 21537871 | |
| hsa-miR-221-3p | thyroid cancer | malignant trasformation | "A limited set of miRNA have been assessed as part ......" | 22771635 | |
| hsa-miR-221-3p | thyroid cancer | staging; metastasis; tumor size | "Overexpression of miR 221 is associated with aggre ......" | 22855362 | |
| hsa-miR-221-3p | thyroid cancer | motility | "HMGB1 induces the overexpression of miR 222 and mi ......" | 23023232 | |
| hsa-miR-221-3p | thyroid cancer | tumorigenesis | "Upregulation of miRNAs such as miR-146b miR-221 an ......" | 25202329 |
Reported gene related to hsa-miR-221-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-221-3p | breast cancer | CDKN1B | "miR-221 knockdown not only blocked cell cycle prog ......" | 23637992 |
| hsa-miR-221-3p | breast cancer | CDKN1B | "A Slug/miR-221 network has been suggested linking ......" | 23939688 |
| hsa-miR-221-3p | breast cancer | CDKN1B | "Peptide nucleic acids targeting miR 221 modulate p ......" | 22992757 |
| hsa-miR-221-3p | glioblastoma | CDKN1B | "Based on bioinformatic analysis we found that the ......" | 19953484 |
| hsa-miR-221-3p | glioblastoma | CDKN1B | "Antagonism of either microRNA 221 or 222 in gliobl ......" | 17721077 |
| hsa-miR-221-3p | liver cancer | CDKN1B | "Matched HCC and adjacent non-cancerous samples wer ......" | 20146005 |
| hsa-miR-221-3p | melanoma | CDKN1B | "Moreover a series of functional assays demonstrate ......" | 19126397 |
| hsa-miR-221-3p | ovarian cancer | CDKN1B | "MiR 221 and MiR 222 alterations in sporadic ovaria ......" | 20461750 |
| hsa-miR-221-3p | pancreatic cancer | CDKN1B | "Additionally the PDGF-dependent increase in cell p ......" | 23967190 |
| hsa-miR-221-3p | prostate cancer | CDKN1B | "miR 221 and miR 222 expression affects the prolife ......" | 17569667 |
| hsa-miR-221-3p | breast cancer | PTEN | "MiR 221 promotes trastuzumab resistance and metast ......" | 24286315 |
| hsa-miR-221-3p | breast cancer | PTEN | "Trail resistance induces epithelial mesenchymal tr ......" | 24905916 |
| hsa-miR-221-3p | cervical and endocervical cancer | PTEN | "MicroRNA 221 targets PTEN to reduce the sensitivit ......" | 26482612 |
| hsa-miR-221-3p | colorectal cancer | PTEN | "The X-ray radiation dose had a significant effect ......" | 24409057 |
| hsa-miR-221-3p | colorectal cancer | PTEN | "Anti microRNA 221 enhances radiosensitivity of col ......" | 23688995 |
| hsa-miR-221-3p | gastric cancer | PTEN | "MicroRNA 221 and microRNA 222 regulate gastric car ......" | 20618998 |
| hsa-miR-221-3p | glioblastoma | PTEN | "Further investigation revealed that miR-221 down-r ......" | 24780067 |
| hsa-miR-221-3p | pancreatic cancer | PTEN | "Protein levels of tumor suppressor targets of the ......" | 19730150 |
| hsa-miR-221-3p | sarcoma | PTEN | "Moreover luciferase reporter assay and western blo ......" | 23372675 |
| hsa-miR-221-3p | sarcoma | PTEN | "MiR 221 increases osteosarcoma cell proliferation ......" | 26397386 |
| hsa-miR-221-3p | breast cancer | DIRAS3 | "Effects of ARHI on breast cancer cell biological b ......" | 23801152 |
| hsa-miR-221-3p | prostate cancer | DIRAS3 | "Further studies on a new mechanism of ARHI downreg ......" | 21071579 |
| hsa-miR-221-3p | prostate cancer | DIRAS3 | "MicroRNA 221 and 222 have been shown to regulate A ......" | 22117988 |
| hsa-miR-221-3p | colorectal cancer | RECK | "MicroRNA 221 promotes colorectal cancer cell invas ......" | 24269686 |
| hsa-miR-221-3p | gastric cancer | RECK | "miR 221 and miR 222 Simultaneously Target RECK and ......" | 26364844 |
| hsa-miR-221-3p | pancreatic cancer | RECK | "Protein levels of tumor suppressor targets of the ......" | 19730150 |
| hsa-miR-221-3p | breast cancer | SNAI2 | "Slug upregulated miR 221 promotes breast cancer pr ......" | 27174021 |
| hsa-miR-221-3p | breast cancer | SNAI2 | "A Slug/miR-221 network has been suggested linking ......" | 23939688 |
| hsa-miR-221-3p | breast cancer | SNAI2 | "Correlation between Slug transcription factor and ......" | 23031797 |
| hsa-miR-221-3p | prostate cancer | AR | "Overexpressing of miR-221 in LNCaP reduced the tra ......" | 23770851 |
| hsa-miR-221-3p | prostate cancer | AR | "Unexpectedly it was found that treatment with the ......" | 25846647 |
| hsa-miR-221-3p | bladder cancer | BBC3 | "MiR 221 induced PUMA silencing mediates immune eva ......" | 25585941 |
| hsa-miR-221-3p | glioblastoma | BBC3 | "MiR 221 and miR 222 target PUMA to induce cell sur ......" | 20813046 |
| hsa-miR-221-3p | breast cancer | NR4A1 | "We demonstrated that ERalpha negatively modulates ......" | 20388878 |
| hsa-miR-221-3p | breast cancer | NR4A1 | "The expression level of miR-221 was significantly ......" | 22156446 |
| hsa-miR-221-3p | colorectal cancer | TP53 | "Circulating miR 221 directly amplified from plasma ......" | 20880178 |
| hsa-miR-221-3p | liver cancer | TP53 | "Interestingly miR-221 can activate the p53/mdm2 ax ......" | 24324033 |
| hsa-miR-221-3p | breast cancer | TRPS1 | "In breast cancer the microRNAs miRNAs miR-221 and ......" | 23776679 |
| hsa-miR-221-3p | pancreatic cancer | TRPS1 | "Down-regulation of TRPS1 by miR-221 is critical fo ......" | 23967190 |
| hsa-miR-221-3p | liver cancer | ANG | "We unraveled a linear pathway in which SND1-induce ......" | 22396537 |
| hsa-miR-221-3p | liver cancer | ANXA5 | "More cell apoptosis and necrosis were significantl ......" | 22152314 |
| hsa-miR-221-3p | cervical and endocervical cancer | ARID1A | "MiR 221 and miR 222 simultaneously target ARID1A a ......" | 27160122 |
| hsa-miR-221-3p | breast cancer | ATXN1 | "The EMT related gene ATXN1 was found to be a miR-2 ......" | 25686829 |
| hsa-miR-221-3p | cervical and endocervical cancer | BCL2 | "Upregulation of miR-221 expression in cervical can ......" | 26482612 |
| hsa-miR-221-3p | breast cancer | BCL2L11 | "Knockdown of miR 221 promotes the cisplatin induci ......" | 26503209 |
| hsa-miR-221-3p | liver cancer | BMF | "MicroRNA 221 targets Bmf in hepatocellular carcino ......" | 19671867 |
| hsa-miR-221-3p | thyroid cancer | BRAF | "Overexpression of miR 221 is associated with aggre ......" | 22855362 |
| hsa-miR-221-3p | breast cancer | CDH1 | "Slug upregulated miR 221 promotes breast cancer pr ......" | 27174021 |
| hsa-miR-221-3p | ovarian cancer | CDKN1C | "miR-221 and miR-222 negatively regulate expression ......" | 20461750 |
| hsa-miR-221-3p | liver cancer | CDKN3 | "Here we proved that the cyclin-dependent kinase in ......" | 18521080 |
| hsa-miR-221-3p | melanoma | CMM | "The aim of this study was to investigate the feasi ......" | 25430553 |
| hsa-miR-221-3p | liver cancer | CXCL16 | "We unraveled a linear pathway in which SND1-induce ......" | 22396537 |
| hsa-miR-221-3p | breast cancer | DNMT3B | "MiR 221 promotes stemness of breast cancer cells b ......" | 26556862 |
| hsa-miR-221-3p | prostate cancer | DVL2 | "MiR 221 expression affects invasion potential of h ......" | 21487968 |
| hsa-miR-221-3p | prostate cancer | ENO2 | "Overexpression of miR-221 in LNCaP cells significa ......" | 21487968 |
| hsa-miR-221-3p | breast cancer | ERBB2 | "MiR 221 promotes trastuzumab resistance and metast ......" | 24286315 |
| hsa-miR-221-3p | liver cancer | ESR1 | "HBx protein induced upregulation of microRNA 221 p ......" | 25483016 |
| hsa-miR-221-3p | melanoma | ETS1 | "To close the loop we demonstrate ETS-1 as a direct ......" | 21711453 |
| hsa-miR-221-3p | thyroid cancer | FLNA | "In addition the oPD thyroid carcinomas demonstrate ......" | 24443580 |
| hsa-miR-221-3p | melanoma | FRTS1 | "Patients with high serum miR-221 levels had a sign ......" | 25430553 |
| hsa-miR-221-3p | liver cancer | HDAC6 | "MicroRNA 221 governs tumor suppressor HDAC6 to pot ......" | 25817558 |
| hsa-miR-221-3p | prostate cancer | HECTD2 | "MiR 221 promotes the development of androgen indep ......" | 23770851 |
| hsa-miR-221-3p | thyroid cancer | HMGB1 | "HMGB1 induces the overexpression of miR 222 and mi ......" | 23023232 |
| hsa-miR-221-3p | thyroid cancer | HOXB5 | "Of several genes downregulated more than 2-fold by ......" | 18794255 |
| hsa-miR-221-3p | pancreatic cancer | HRAS | "Similarly the effect of ASO-miR-221 transfection i ......" | 26046003 |
| hsa-miR-221-3p | melanoma | IFNB1 | "Inhibition of hPNPaseold-35 by shRNA or stable ove ......" | 20547861 |
| hsa-miR-221-3p | prostate cancer | IRF2 | "Survival in patients with high risk prostate cance ......" | 24607843 |
| hsa-miR-221-3p | kidney renal cell cancer | KDR | "We validated the negative correlation between miR- ......" | 26201448 |
| hsa-miR-221-3p | kidney renal cell cancer | LARP6 | "Gain of function experiments showed that miR-221 a ......" | 26201448 |
| hsa-miR-221-3p | colorectal cancer | MBD2 | "Decreased levels of miR 224 and the passenger stra ......" | 23770133 |
| hsa-miR-221-3p | liver cancer | MDM2 | "Interestingly miR-221 can activate the p53/mdm2 ax ......" | 24324033 |
| hsa-miR-221-3p | pancreatic cancer | MIA | "Significant upregulation of serum miRNAs at earlie ......" | 26998056 |
| hsa-miR-221-3p | breast cancer | PAK1 | "The investigation of miR 221 3p and PAK1 gene expr ......" | 25447917 |
| hsa-miR-221-3p | prostate cancer | PDZD2 | "MiR-221 was significantly increased compared AIPC ......" | 21487968 |
| hsa-miR-221-3p | glioblastoma | PI3 | "MicroRNA 221 targeting PI3 K/Akt signaling axis in ......" | 24780067 |
| hsa-miR-221-3p | cervical and endocervical cancer | PIK3CD | "Importantly gefitinib sensitivity was decreased by ......" | 26482612 |
| hsa-miR-221-3p | melanoma | PML | "We have identified the promyelocytic leukemia zinc ......" | 18417445 |
| hsa-miR-221-3p | melanoma | PNPT1 | "Human polynucleotide phosphorylase selectively and ......" | 20547861 |
| hsa-miR-221-3p | breast cancer | QRSL1 | "In breast cancer the microRNAs miRNAs miR-221 and ......" | 23776679 |
| hsa-miR-221-3p | prostate cancer | RAB1A | "MiR 221 promotes the development of androgen indep ......" | 23770851 |
| hsa-miR-221-3p | colorectal cancer | RELA | "Human CRC tissues had higher levels of miR-221 and ......" | 24931456 |
| hsa-miR-221-3p | acute myeloid leukemia | RUNX1 | "The integrated information gathered from the two m ......" | 25612891 |
| hsa-miR-221-3p | colorectal cancer | SERPINB5 | "Decreased levels of miR 224 and the passenger stra ......" | 23770133 |
| hsa-miR-221-3p | prostate cancer | SIRT1 | "Down regulation of mir 221 and mir 222 restrain pr ......" | 24892674 |
| hsa-miR-221-3p | breast cancer | SNAI1 | "Moreover miR-221 was specifically upregulated by S ......" | 27174021 |
| hsa-miR-221-3p | liver cancer | SND1 | "Because SND1 regulates NF-κB and miR-221 two impo ......" | 22396537 |
| hsa-miR-221-3p | prostate cancer | SOCS3 | "Survival in patients with high risk prostate cance ......" | 24607843 |
| hsa-miR-221-3p | pancreatic cancer | SPNS1 | "Significant upregulation of serum miRNAs at earlie ......" | 26998056 |
| hsa-miR-221-3p | colorectal cancer | STAT3 | "A microRNA 221 and 222 mediated feedback loop main ......" | 24931456 |
| hsa-miR-221-3p | bladder cancer | STMN1 | "miR 221 facilitates the TGFbeta1 induced epithelia ......" | 25928257 |
| hsa-miR-221-3p | kidney renal cell cancer | TIMP2 | "Moreover at the molecular level our results sugges ......" | 26191221 |
| hsa-miR-221-3p | thyroid cancer | TIMP3 | "MiR 221 Exacerbate Cell Proliferation and Invasion ......" | 27077469 |
| hsa-miR-221-3p | breast cancer | WIPF2 | "In addition we showed that in Slug-silenced cells ......" | 23031797 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-221-3p | AMOT | 9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; SARC; UCEC | miRNAWalker2 validate | TCGA BLCA -0.577; TCGA CESC -0.852; TCGA COAD -0.297; TCGA HNSC -0.736; TCGA KIRC -0.244; TCGA KIRP -0.157; TCGA LIHC -0.322; TCGA SARC -0.341; TCGA UCEC -0.167 |
hsa-miR-221-3p | ASXL3 | 13 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.505; TCGA CESC -0.775; TCGA ESCA -0.961; TCGA KIRC -0.621; TCGA KIRP -0.77; TCGA LGG -0.16; TCGA LIHC -0.946; TCGA LUAD -0.228; TCGA LUSC -0.627; TCGA OV -0.292; TCGA PAAD -0.299; TCGA THCA -0.873; TCGA STAD -0.848 |
hsa-miR-221-3p | BMF | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; PRAD; SARC | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.286; TCGA BRCA -0.095; TCGA CESC -0.416; TCGA COAD -0.217; TCGA HNSC -0.237; TCGA LGG -0.264; TCGA LUAD -0.109; TCGA LUSC -0.411; TCGA OV -0.326; TCGA PRAD -0.152; TCGA SARC -0.221 |
hsa-miR-221-3p | BRD1 | 10 cancers: BLCA; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.12; TCGA HNSC -0.065; TCGA KIRP -0.077; TCGA LGG -0.093; TCGA LUAD -0.089; TCGA PAAD -0.086; TCGA PRAD -0.086; TCGA SARC -0.057; TCGA STAD -0.062; TCGA UCEC -0.086 |
hsa-miR-221-3p | CDKN1B | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUSC; OV; SARC; STAD | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.108; TCGA BRCA -0.093; TCGA CESC -0.201; TCGA HNSC -0.151; TCGA KIRC -0.169; TCGA LGG -0.111; TCGA LIHC -0.153; TCGA LUSC -0.157; TCGA OV -0.187; TCGA SARC -0.205; TCGA STAD -0.131 |
hsa-miR-221-3p | CDKN1C | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; OV; SARC; STAD | miRNAWalker2 validate; miRTarBase; miRNATAP | TCGA BLCA -0.249; TCGA CESC -0.24; TCGA ESCA -0.323; TCGA HNSC -0.283; TCGA KIRC -0.169; TCGA KIRP -0.319; TCGA OV -0.242; TCGA SARC -0.341; TCGA STAD -0.414 |
hsa-miR-221-3p | DDAH1 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; PRAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.362; TCGA BRCA -0.24; TCGA CESC -0.744; TCGA HNSC -0.471; TCGA KIRC -0.488; TCGA KIRP -0.185; TCGA LIHC -0.232; TCGA PRAD -0.145; TCGA UCEC -0.169 |
hsa-miR-221-3p | DVL2 | 11 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; OV; PAAD; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.072; TCGA CESC -0.094; TCGA COAD -0.107; TCGA HNSC -0.067; TCGA KIRP -0.113; TCGA LGG -0.163; TCGA LUAD -0.151; TCGA OV -0.112; TCGA PAAD -0.065; TCGA SARC -0.068; TCGA STAD -0.09 |
hsa-miR-221-3p | GATAD2B | 11 cancers: BLCA; BRCA; CESC; COAD; LGG; LUAD; LUSC; OV; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.065; TCGA BRCA -0.083; TCGA CESC -0.06; TCGA COAD -0.068; TCGA LGG -0.105; TCGA LUAD -0.088; TCGA LUSC -0.129; TCGA OV -0.067; TCGA SARC -0.142; TCGA STAD -0.11; TCGA UCEC -0.084 |
hsa-miR-221-3p | KIT | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; THCA; STAD | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BLCA -0.405; TCGA CESC -0.468; TCGA COAD -0.667; TCGA ESCA -0.604; TCGA HNSC -0.478; TCGA LUAD -0.885; TCGA LUSC -0.374; TCGA OV -0.284; TCGA PAAD -0.329; TCGA THCA -0.852; TCGA STAD -0.783 |
hsa-miR-221-3p | KLHL8 | 9 cancers: BLCA; BRCA; CESC; KIRC; LIHC; LUAD; PRAD; SARC; THCA | miRNAWalker2 validate | TCGA BLCA -0.128; TCGA BRCA -0.15; TCGA CESC -0.141; TCGA KIRC -0.125; TCGA LIHC -0.332; TCGA LUAD -0.09; TCGA PRAD -0.137; TCGA SARC -0.149; TCGA THCA -0.257 |
hsa-miR-221-3p | LRP6 | 14 cancers: BLCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.095; TCGA CESC -0.338; TCGA COAD -0.085; TCGA HNSC -0.253; TCGA KIRC -0.192; TCGA LGG -0.131; TCGA LIHC -0.101; TCGA LUAD -0.113; TCGA LUSC -0.101; TCGA OV -0.12; TCGA PAAD -0.109; TCGA SARC -0.275; TCGA THCA -0.142; TCGA STAD -0.099 |
hsa-miR-221-3p | LYSMD1 | 15 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.119; TCGA BRCA -0.1; TCGA CESC -0.092; TCGA HNSC -0.111; TCGA KIRC -0.123; TCGA KIRP -0.06; TCGA LGG -0.111; TCGA LUAD -0.341; TCGA LUSC -0.156; TCGA OV -0.189; TCGA PRAD -0.066; TCGA SARC -0.196; TCGA THCA -0.065; TCGA STAD -0.119; TCGA UCEC -0.069 |
hsa-miR-221-3p | PEX1 | 12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.13; TCGA BRCA -0.212; TCGA CESC -0.101; TCGA KIRC -0.156; TCGA KIRP -0.238; TCGA LIHC -0.142; TCGA LUAD -0.079; TCGA OV -0.067; TCGA PRAD -0.133; TCGA SARC -0.086; TCGA THCA -0.094; TCGA UCEC -0.167 |
hsa-miR-221-3p | PHF12 | 9 cancers: BLCA; BRCA; CESC; KIRP; LGG; LUSC; PRAD; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.133; TCGA BRCA -0.155; TCGA CESC -0.119; TCGA KIRP -0.082; TCGA LGG -0.071; TCGA LUSC -0.058; TCGA PRAD -0.235; TCGA SARC -0.103; TCGA STAD -0.083 |
hsa-miR-221-3p | POGZ | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; STAD | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA BLCA -0.18; TCGA BRCA -0.123; TCGA CESC -0.166; TCGA ESCA -0.084; TCGA HNSC -0.071; TCGA KIRC -0.054; TCGA LGG -0.111; TCGA LUAD -0.173; TCGA LUSC -0.115; TCGA OV -0.107; TCGA PRAD -0.114; TCGA SARC -0.174; TCGA STAD -0.089 |
hsa-miR-221-3p | PPP1R15B | 9 cancers: BLCA; BRCA; CESC; KIRC; LIHC; LUAD; OV; SARC; THCA | miRNAWalker2 validate; miRNATAP | TCGA BLCA -0.065; TCGA BRCA -0.117; TCGA CESC -0.059; TCGA KIRC -0.201; TCGA LIHC -0.087; TCGA LUAD -0.103; TCGA OV -0.089; TCGA SARC -0.106; TCGA THCA -0.116 |
hsa-miR-221-3p | RUNDC3B | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; OV; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.208; TCGA BRCA -0.195; TCGA CESC -0.232; TCGA COAD -0.307; TCGA ESCA -0.342; TCGA HNSC -0.292; TCGA KIRC -0.556; TCGA KIRP -0.606; TCGA LIHC -0.645; TCGA OV -0.184; TCGA PAAD -0.475; TCGA STAD -0.416; TCGA UCEC -0.225 |
hsa-miR-221-3p | SELE | 9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.295; TCGA COAD -0.591; TCGA ESCA -0.494; TCGA HNSC -0.623; TCGA KIRC -0.209; TCGA LIHC -0.529; TCGA PAAD -0.51; TCGA THCA -0.149; TCGA STAD -0.369 |
hsa-miR-221-3p | TMEM168 | 11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; OV; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA BLCA -0.173; TCGA BRCA -0.058; TCGA COAD -0.099; TCGA HNSC -0.163; TCGA KIRC -0.068; TCGA LUAD -0.087; TCGA OV -0.057; TCGA PRAD -0.196; TCGA SARC -0.114; TCGA THCA -0.084; TCGA UCEC -0.115 |
hsa-miR-221-3p | TOB2 | 9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.057; TCGA BRCA -0.052; TCGA CESC -0.062; TCGA ESCA -0.123; TCGA KIRC -0.179; TCGA KIRP -0.149; TCGA LGG -0.117; TCGA SARC -0.063; TCGA STAD -0.138 |
hsa-miR-221-3p | UNC13B | 14 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.148; TCGA BRCA -0.079; TCGA CESC -0.197; TCGA COAD -0.167; TCGA KIRC -0.213; TCGA KIRP -0.202; TCGA LUAD -0.367; TCGA OV -0.082; TCGA PAAD -0.252; TCGA PRAD -0.261; TCGA SARC -0.109; TCGA THCA -0.054; TCGA STAD -0.077; TCGA UCEC -0.138 |
hsa-miR-221-3p | ZNF275 | 11 cancers: BLCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate; MirTarget | TCGA BLCA -0.11; TCGA CESC -0.178; TCGA HNSC -0.118; TCGA LGG -0.198; TCGA LIHC -0.086; TCGA LUAD -0.11; TCGA LUSC -0.081; TCGA PAAD -0.147; TCGA PRAD -0.059; TCGA THCA -0.145; TCGA STAD -0.076 |
hsa-miR-221-3p | ZNF571 | 11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; OV; PAAD; PRAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.258; TCGA BRCA -0.122; TCGA CESC -0.203; TCGA ESCA -0.258; TCGA KIRC -0.069; TCGA OV -0.118; TCGA PAAD -0.1; TCGA PRAD -0.089; TCGA SARC -0.122; TCGA THCA -0.059; TCGA STAD -0.21 |
hsa-miR-221-3p | ZNF652 | 15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.254; TCGA BRCA -0.278; TCGA CESC -0.227; TCGA ESCA -0.18; TCGA HNSC -0.119; TCGA KIRP -0.107; TCGA LGG -0.087; TCGA LIHC -0.074; TCGA LUAD -0.125; TCGA PAAD -0.111; TCGA PRAD -0.105; TCGA SARC -0.117; TCGA THCA -0.189; TCGA STAD -0.134; TCGA UCEC -0.111 |
hsa-miR-221-3p | ZNF74 | 10 cancers: BLCA; CESC; HNSC; LGG; LUAD; OV; PAAD; PRAD; SARC; UCEC | MirTarget | TCGA BLCA -0.182; TCGA CESC -0.106; TCGA HNSC -0.197; TCGA LGG -0.212; TCGA LUAD -0.185; TCGA OV -0.086; TCGA PAAD -0.141; TCGA PRAD -0.217; TCGA SARC -0.099; TCGA UCEC -0.067 |
hsa-miR-221-3p | MYLIP | 16 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.51; TCGA BRCA -0.235; TCGA CESC -0.208; TCGA COAD -0.168; TCGA HNSC -0.162; TCGA KIRC -0.258; TCGA KIRP -0.153; TCGA LGG -0.054; TCGA LUAD -0.177; TCGA OV -0.1; TCGA PAAD -0.177; TCGA PRAD -0.082; TCGA SARC -0.155; TCGA THCA -0.069; TCGA STAD -0.234; TCGA UCEC -0.167 |
hsa-miR-221-3p | RSBN1L | 11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.069; TCGA BRCA -0.157; TCGA COAD -0.129; TCGA KIRC -0.095; TCGA KIRP -0.109; TCGA LGG -0.069; TCGA LIHC -0.058; TCGA SARC -0.097; TCGA THCA -0.072; TCGA STAD -0.083; TCGA UCEC -0.084 |
hsa-miR-221-3p | ZFP30 | 10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; OV; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.217; TCGA BRCA -0.192; TCGA CESC -0.262; TCGA ESCA -0.325; TCGA KIRC -0.108; TCGA OV -0.142; TCGA PRAD -0.129; TCGA SARC -0.11; TCGA THCA -0.067; TCGA STAD -0.198 |
hsa-miR-221-3p | SCN11A | 9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; OV; PAAD; STAD | MirTarget | TCGA BLCA -0.377; TCGA COAD -0.699; TCGA ESCA -0.618; TCGA KIRC -0.198; TCGA KIRP -0.534; TCGA LGG -0.07; TCGA OV -0.287; TCGA PAAD -0.507; TCGA STAD -0.749 |
hsa-miR-221-3p | PIK3R1 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; OV; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.108; TCGA BRCA -0.087; TCGA COAD -0.197; TCGA ESCA -0.313; TCGA HNSC -0.153; TCGA KIRC -0.163; TCGA KIRP -0.228; TCGA LGG -0.125; TCGA LIHC -0.218; TCGA OV -0.207; TCGA SARC -0.185; TCGA STAD -0.287; TCGA UCEC -0.456 |
hsa-miR-221-3p | CLGN | 10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.273; TCGA BRCA -0.867; TCGA CESC -0.821; TCGA HNSC -0.64; TCGA LGG -0.369; TCGA LUAD -0.485; TCGA PAAD -0.573; TCGA PRAD -0.198; TCGA STAD -0.805; TCGA UCEC -0.213 |
hsa-miR-221-3p | INA | 10 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUSC; OV; PAAD; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.913; TCGA COAD -0.744; TCGA ESCA -0.479; TCGA HNSC -0.51; TCGA LGG -0.143; TCGA LUSC -0.718; TCGA OV -0.442; TCGA PAAD -0.782; TCGA SARC -0.259; TCGA STAD -1.011 |
hsa-miR-221-3p | PCMTD1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.224; TCGA BRCA -0.119; TCGA CESC -0.136; TCGA COAD -0.129; TCGA ESCA -0.148; TCGA HNSC -0.069; TCGA KIRC -0.065; TCGA LGG -0.051; TCGA LUAD -0.078; TCGA SARC -0.18; TCGA THCA -0.163; TCGA STAD -0.245 |
hsa-miR-221-3p | LUZP2 | 9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.438; TCGA BRCA -0.301; TCGA COAD -0.835; TCGA HNSC -0.636; TCGA KIRC -0.41; TCGA LGG -0.369; TCGA PRAD -0.414; TCGA STAD -0.493; TCGA UCEC -0.23 |
hsa-miR-221-3p | PAIP2 | 13 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.064; TCGA BRCA -0.097; TCGA CESC -0.088; TCGA KIRC -0.122; TCGA KIRP -0.066; TCGA LUAD -0.067; TCGA LUSC -0.094; TCGA OV -0.096; TCGA PAAD -0.148; TCGA PRAD -0.075; TCGA SARC -0.096; TCGA THCA -0.155; TCGA STAD -0.219 |
hsa-miR-221-3p | KIAA0586 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.09; TCGA BRCA -0.167; TCGA COAD -0.186; TCGA ESCA -0.149; TCGA KIRC -0.082; TCGA LGG -0.063; TCGA SARC -0.076; TCGA STAD -0.107; TCGA UCEC -0.11 |
hsa-miR-221-3p | KIAA0430 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; SARC; STAD | MirTarget; miRNATAP | TCGA BLCA -0.121; TCGA BRCA -0.136; TCGA CESC -0.071; TCGA COAD -0.153; TCGA ESCA -0.134; TCGA KIRC -0.132; TCGA LIHC -0.115; TCGA SARC -0.079; TCGA STAD -0.193 |
hsa-miR-221-3p | ZNF181 | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.193; TCGA BRCA -0.156; TCGA CESC -0.087; TCGA ESCA -0.175; TCGA HNSC -0.142; TCGA KIRC -0.095; TCGA LIHC -0.053; TCGA PAAD -0.255; TCGA PRAD -0.157; TCGA SARC -0.117; TCGA THCA -0.111; TCGA STAD -0.234 |
hsa-miR-221-3p | NLK | 9 cancers: BLCA; BRCA; CESC; LUAD; LUSC; OV; PAAD; PRAD; THCA | MirTarget; miRNATAP | TCGA BLCA -0.191; TCGA BRCA -0.16; TCGA CESC -0.154; TCGA LUAD -0.116; TCGA LUSC -0.082; TCGA OV -0.112; TCGA PAAD -0.09; TCGA PRAD -0.115; TCGA THCA -0.08 |
hsa-miR-221-3p | SYBU | 11 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.206; TCGA BRCA -0.439; TCGA CESC -0.569; TCGA HNSC -0.301; TCGA LIHC -0.533; TCGA LUAD -0.181; TCGA PAAD -0.407; TCGA PRAD -0.174; TCGA SARC -0.311; TCGA THCA -0.311; TCGA STAD -0.261 |
hsa-miR-221-3p | TMEM25 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; SARC; STAD | MirTarget | TCGA BLCA -0.281; TCGA BRCA -0.304; TCGA COAD -0.243; TCGA ESCA -0.269; TCGA HNSC -0.193; TCGA LIHC -0.655; TCGA PAAD -0.165; TCGA SARC -0.387; TCGA STAD -0.549 |
hsa-miR-221-3p | ZNF91 | 10 cancers: BLCA; BRCA; CESC; KIRC; LGG; PAAD; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.358; TCGA BRCA -0.378; TCGA CESC -0.265; TCGA KIRC -0.067; TCGA LGG -0.09; TCGA PAAD -0.106; TCGA PRAD -0.114; TCGA SARC -0.168; TCGA THCA -0.122; TCGA UCEC -0.103 |
hsa-miR-221-3p | CDK19 | 9 cancers: BLCA; CESC; COAD; KIRC; KIRP; LUSC; OV; PRAD; SARC | MirTarget; miRNATAP | TCGA BLCA -0.133; TCGA CESC -0.075; TCGA COAD -0.1; TCGA KIRC -0.207; TCGA KIRP -0.103; TCGA LUSC -0.1; TCGA OV -0.103; TCGA PRAD -0.348; TCGA SARC -0.111 |
hsa-miR-221-3p | ZC3H13 | 10 cancers: BLCA; BRCA; CESC; COAD; KIRC; LIHC; LUSC; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.085; TCGA BRCA -0.124; TCGA CESC -0.092; TCGA COAD -0.114; TCGA KIRC -0.115; TCGA LIHC -0.142; TCGA LUSC -0.065; TCGA SARC -0.149; TCGA THCA -0.05; TCGA STAD -0.169 |
hsa-miR-221-3p | PHF2 | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.073; TCGA BRCA -0.102; TCGA COAD -0.12; TCGA ESCA -0.118; TCGA KIRC -0.065; TCGA LGG -0.129; TCGA PRAD -0.064; TCGA SARC -0.106; TCGA STAD -0.19; TCGA UCEC -0.063 |
hsa-miR-221-3p | GUCY1A2 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; THCA; STAD | MirTarget | TCGA BLCA -0.164; TCGA BRCA -0.286; TCGA CESC -0.311; TCGA COAD -0.399; TCGA ESCA -0.366; TCGA HNSC -0.253; TCGA LIHC -0.213; TCGA THCA -0.072; TCGA STAD -0.197 |
hsa-miR-221-3p | JMY | 10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LIHC; LUAD; PAAD; SARC; STAD | MirTarget | TCGA BLCA -0.217; TCGA BRCA -0.088; TCGA COAD -0.2; TCGA ESCA -0.318; TCGA LGG -0.072; TCGA LIHC -0.09; TCGA LUAD -0.072; TCGA PAAD -0.134; TCGA SARC -0.151; TCGA STAD -0.373 |
hsa-miR-221-3p | ZBTB41 | 9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; PRAD; SARC; UCEC | MirTarget | TCGA BLCA -0.06; TCGA BRCA -0.29; TCGA CESC -0.114; TCGA COAD -0.115; TCGA KIRC -0.107; TCGA LUAD -0.117; TCGA PRAD -0.108; TCGA SARC -0.129; TCGA UCEC -0.084 |
hsa-miR-221-3p | MEX3A | 12 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | MirTarget | TCGA BLCA -0.394; TCGA CESC -0.54; TCGA COAD -0.269; TCGA HNSC -0.405; TCGA KIRP -0.438; TCGA LGG -0.408; TCGA LUAD -0.559; TCGA LUSC -0.466; TCGA OV -0.397; TCGA PRAD -0.543; TCGA SARC -0.322; TCGA UCEC -0.128 |
hsa-miR-221-3p | SNX4 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PRAD; THCA | MirTarget | TCGA BLCA -0.136; TCGA BRCA -0.104; TCGA CESC -0.127; TCGA HNSC -0.078; TCGA KIRC -0.209; TCGA KIRP -0.188; TCGA LIHC -0.15; TCGA LUAD -0.096; TCGA OV -0.098; TCGA PRAD -0.168; TCGA THCA -0.207 |
hsa-miR-221-3p | CCDC126 | 9 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; PAAD; PRAD; THCA; UCEC | MirTarget | TCGA BLCA -0.121; TCGA BRCA -0.222; TCGA HNSC -0.113; TCGA LIHC -0.087; TCGA LUAD -0.059; TCGA PAAD -0.141; TCGA PRAD -0.107; TCGA THCA -0.176; TCGA UCEC -0.067 |
hsa-miR-221-3p | WDR35 | 14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; SARC; STAD | MirTarget | TCGA BLCA -0.085; TCGA BRCA -0.145; TCGA CESC -0.25; TCGA ESCA -0.167; TCGA HNSC -0.18; TCGA KIRC -0.214; TCGA KIRP -0.136; TCGA LGG -0.052; TCGA LUAD -0.096; TCGA LUSC -0.132; TCGA OV -0.221; TCGA PAAD -0.156; TCGA SARC -0.099; TCGA STAD -0.333 |
hsa-miR-221-3p | NAP1L5 | 10 cancers: BLCA; COAD; ESCA; HNSC; LIHC; OV; PAAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.16; TCGA COAD -0.168; TCGA ESCA -0.274; TCGA HNSC -0.234; TCGA LIHC -0.346; TCGA OV -0.128; TCGA PAAD -0.421; TCGA SARC -0.336; TCGA THCA -0.128; TCGA STAD -0.671 |
hsa-miR-221-3p | NBPF3 | 10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.179; TCGA BRCA -0.187; TCGA CESC -0.253; TCGA COAD -0.218; TCGA HNSC -0.152; TCGA KIRC -0.231; TCGA KIRP -0.222; TCGA THCA -0.116; TCGA STAD -0.126; TCGA UCEC -0.222 |
hsa-miR-221-3p | ADAM22 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; OV; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.418; TCGA BRCA -0.267; TCGA CESC -0.664; TCGA COAD -0.432; TCGA ESCA -0.386; TCGA HNSC -0.606; TCGA KIRC -0.23; TCGA LGG -0.098; TCGA LUSC -0.602; TCGA OV -0.36; TCGA SARC -0.505; TCGA THCA -0.677; TCGA STAD -0.331 |
hsa-miR-221-3p | ZFYVE16 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; OV; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.143; TCGA BRCA -0.232; TCGA CESC -0.144; TCGA COAD -0.11; TCGA ESCA -0.114; TCGA KIRC -0.12; TCGA LGG -0.086; TCGA OV -0.077; TCGA PRAD -0.136; TCGA SARC -0.155; TCGA THCA -0.052; TCGA STAD -0.087 |
hsa-miR-221-3p | DPY19L3 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.244; TCGA BRCA -0.305; TCGA CESC -0.375; TCGA COAD -0.173; TCGA ESCA -0.21; TCGA KIRC -0.159; TCGA LUAD -0.156; TCGA LUSC -0.123; TCGA OV -0.118; TCGA PRAD -0.1; TCGA SARC -0.129; TCGA THCA -0.161; TCGA STAD -0.092 |
hsa-miR-221-3p | MIA3 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.074; TCGA BRCA -0.201; TCGA CESC -0.156; TCGA COAD -0.194; TCGA ESCA -0.117; TCGA KIRC -0.088; TCGA LUAD -0.157; TCGA PRAD -0.247; TCGA SARC -0.063; TCGA THCA -0.136; TCGA STAD -0.062; TCGA UCEC -0.119 |
hsa-miR-221-3p | MIER3 | 9 cancers: BLCA; BRCA; CESC; KIRC; LGG; LIHC; LUAD; SARC; THCA | MirTarget; miRNATAP | TCGA BLCA -0.111; TCGA BRCA -0.211; TCGA CESC -0.173; TCGA KIRC -0.086; TCGA LGG -0.096; TCGA LIHC -0.11; TCGA LUAD -0.06; TCGA SARC -0.15; TCGA THCA -0.052 |
hsa-miR-221-3p | ASPA | 11 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.337; TCGA CESC -0.239; TCGA COAD -0.606; TCGA ESCA -0.728; TCGA KIRC -0.797; TCGA KIRP -0.521; TCGA LIHC -0.664; TCGA PAAD -0.602; TCGA SARC -0.226; TCGA THCA -0.389; TCGA STAD -0.768 |
hsa-miR-221-3p | GDF9 | 11 cancers: BLCA; BRCA; CESC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.308; TCGA BRCA -0.266; TCGA CESC -0.11; TCGA KIRP -0.202; TCGA LGG -0.142; TCGA LUAD -0.138; TCGA PAAD -0.178; TCGA PRAD -0.228; TCGA SARC -0.177; TCGA THCA -0.241; TCGA UCEC -0.087 |
hsa-miR-221-3p | MGAT4A | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD | MirTarget | TCGA BLCA -0.326; TCGA BRCA -0.241; TCGA CESC -0.342; TCGA HNSC -0.192; TCGA KIRC -0.264; TCGA KIRP -0.119; TCGA LUAD -0.119; TCGA LUSC -0.245; TCGA PAAD -0.228; TCGA PRAD -0.134 |
hsa-miR-221-3p | SEMA5A | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; PAAD; SARC | mirMAP | TCGA BLCA -0.734; TCGA BRCA -0.137; TCGA COAD -0.295; TCGA HNSC -0.226; TCGA KIRC -0.305; TCGA KIRP -0.489; TCGA LGG -0.083; TCGA LIHC -0.457; TCGA PAAD -0.185; TCGA SARC -0.307 |
hsa-miR-221-3p | SEMA6D | 9 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; PAAD; SARC; THCA; STAD | mirMAP; miRNATAP | TCGA BLCA -0.259; TCGA BRCA -0.108; TCGA ESCA -0.612; TCGA HNSC -0.674; TCGA LIHC -0.308; TCGA PAAD -0.469; TCGA SARC -0.453; TCGA THCA -0.357; TCGA STAD -0.565 |
hsa-miR-221-3p | FNBP1L | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; OV; PRAD; SARC; UCEC | mirMAP | TCGA BLCA -0.257; TCGA BRCA -0.169; TCGA CESC -0.296; TCGA HNSC -0.121; TCGA KIRC -0.188; TCGA KIRP -0.149; TCGA LUAD -0.121; TCGA OV -0.118; TCGA PRAD -0.207; TCGA SARC -0.165; TCGA UCEC -0.098 |
hsa-miR-221-3p | TMEM56 | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; OV; PAAD; PRAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.482; TCGA BRCA -0.092; TCGA CESC -0.576; TCGA COAD -0.279; TCGA HNSC -0.588; TCGA LIHC -0.48; TCGA LUAD -0.145; TCGA OV -0.178; TCGA PAAD -0.248; TCGA PRAD -0.139; TCGA SARC -0.311; TCGA STAD -0.215; TCGA UCEC -0.226 |
hsa-miR-221-3p | PPM1L | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; OV; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.513; TCGA CESC -0.302; TCGA COAD -0.289; TCGA ESCA -0.248; TCGA HNSC -0.403; TCGA KIRC -0.138; TCGA LIHC -0.348; TCGA OV -0.143; TCGA SARC -0.278; TCGA THCA -0.452; TCGA STAD -0.373; TCGA UCEC -0.269 |
hsa-miR-221-3p | PTCHD1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; OV; PAAD; SARC; STAD | mirMAP | TCGA BLCA -1.206; TCGA CESC -0.429; TCGA COAD -1.181; TCGA ESCA -0.796; TCGA HNSC -0.87; TCGA OV -0.263; TCGA PAAD -0.322; TCGA SARC -0.543; TCGA STAD -1.331 |
hsa-miR-221-3p | JAM3 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.163; TCGA CESC -0.184; TCGA COAD -0.566; TCGA ESCA -0.505; TCGA HNSC -0.41; TCGA KIRC -0.172; TCGA LUAD -0.13; TCGA LUSC -0.288; TCGA PAAD -0.16; TCGA SARC -0.183; TCGA THCA -0.11; TCGA STAD -0.749 |
hsa-miR-221-3p | PRTG | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; OV; THCA; STAD | mirMAP | TCGA BLCA -0.183; TCGA BRCA -0.218; TCGA CESC -0.618; TCGA COAD -0.745; TCGA HNSC -0.386; TCGA LGG -0.286; TCGA LUAD -0.151; TCGA LUSC -0.32; TCGA OV -0.248; TCGA THCA -0.421; TCGA STAD -0.664 |
hsa-miR-221-3p | ZNF677 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.282; TCGA CESC -0.211; TCGA COAD -0.613; TCGA ESCA -0.647; TCGA HNSC -0.461; TCGA KIRC -0.116; TCGA LGG -0.1; TCGA PAAD -0.28; TCGA PRAD -0.139; TCGA SARC -0.193; TCGA THCA -0.072; TCGA STAD -0.68 |
hsa-miR-221-3p | SAMD5 | 9 cancers: BLCA; CESC; HNSC; KIRC; LIHC; LUAD; PAAD; PRAD; THCA | mirMAP | TCGA BLCA -0.179; TCGA CESC -0.199; TCGA HNSC -0.491; TCGA KIRC -0.235; TCGA LIHC -0.719; TCGA LUAD -0.166; TCGA PAAD -0.32; TCGA PRAD -0.55; TCGA THCA -0.464 |
hsa-miR-221-3p | ZNF704 | 12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUSC; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.358; TCGA BRCA -0.273; TCGA CESC -0.434; TCGA COAD -0.413; TCGA HNSC -0.216; TCGA KIRC -0.521; TCGA LGG -0.145; TCGA LUSC -0.234; TCGA SARC -0.394; TCGA THCA -0.171; TCGA STAD -0.446; TCGA UCEC -0.321 |
hsa-miR-221-3p | NOVA1 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; OV; PAAD; SARC; STAD | miRNATAP | TCGA BLCA -0.349; TCGA BRCA -0.376; TCGA CESC -0.357; TCGA COAD -0.787; TCGA ESCA -0.867; TCGA HNSC -0.817; TCGA LGG -0.159; TCGA OV -0.407; TCGA PAAD -0.641; TCGA SARC -0.223; TCGA STAD -1.074 |
hsa-miR-221-3p | CACNB4 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; OV; PAAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.358; TCGA BRCA -0.134; TCGA CESC -0.382; TCGA COAD -0.499; TCGA ESCA -0.39; TCGA HNSC -0.571; TCGA OV -0.218; TCGA PAAD -0.341; TCGA SARC -0.214; TCGA THCA -0.438; TCGA STAD -0.475 |
hsa-miR-221-3p | DGKE | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LIHC; PAAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.225; TCGA BRCA -0.079; TCGA CESC -0.139; TCGA HNSC -0.125; TCGA KIRC -0.173; TCGA LIHC -0.357; TCGA PAAD -0.173; TCGA SARC -0.098; TCGA STAD -0.218; TCGA UCEC -0.133 |
hsa-miR-221-3p | TNRC6B | 10 cancers: BLCA; CESC; COAD; ESCA; KIRP; LGG; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.053; TCGA CESC -0.091; TCGA COAD -0.092; TCGA ESCA -0.12; TCGA KIRP -0.152; TCGA LGG -0.083; TCGA PRAD -0.055; TCGA SARC -0.069; TCGA THCA -0.076; TCGA STAD -0.178 |
hsa-miR-221-3p | UBN2 | 10 cancers: BLCA; BRCA; CESC; KIRP; LGG; LUAD; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA BLCA -0.185; TCGA BRCA -0.163; TCGA CESC -0.144; TCGA KIRP -0.201; TCGA LGG -0.118; TCGA LUAD -0.126; TCGA PRAD -0.115; TCGA SARC -0.106; TCGA THCA -0.121; TCGA UCEC -0.087 |
hsa-miR-221-3p | WNK3 | 11 cancers: BLCA; ESCA; HNSC; LGG; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.177; TCGA ESCA -0.474; TCGA HNSC -0.305; TCGA LGG -0.133; TCGA LIHC -0.359; TCGA LUAD -0.249; TCGA PAAD -0.415; TCGA PRAD -0.194; TCGA SARC -0.281; TCGA THCA -0.165; TCGA STAD -0.654 |
hsa-miR-221-3p | ZFHX3 | 9 cancers: BLCA; BRCA; CESC; COAD; LUAD; OV; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.353; TCGA BRCA -0.2; TCGA CESC -0.29; TCGA COAD -0.253; TCGA LUAD -0.153; TCGA OV -0.097; TCGA SARC -0.19; TCGA STAD -0.334; TCGA UCEC -0.263 |
hsa-miR-221-3p | MAPK10 | 11 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LIHC; OV; PAAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.397; TCGA COAD -0.857; TCGA ESCA -0.481; TCGA KIRC -0.257; TCGA KIRP -0.242; TCGA LIHC -0.346; TCGA OV -0.394; TCGA PAAD -0.465; TCGA SARC -0.721; TCGA THCA -0.166; TCGA STAD -0.94 |
hsa-miR-221-3p | C3orf70 | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.477; TCGA COAD -0.516; TCGA ESCA -0.463; TCGA HNSC -0.285; TCGA KIRC -0.208; TCGA LUAD -0.236; TCGA LUSC -0.439; TCGA PAAD -0.332; TCGA SARC -0.411; TCGA THCA -0.098; TCGA STAD -0.934 |
hsa-miR-221-3p | CASZ1 | 10 cancers: BLCA; BRCA; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.229; TCGA BRCA -0.297; TCGA KIRP -0.208; TCGA LGG -0.135; TCGA LUAD -0.106; TCGA PRAD -0.116; TCGA SARC -0.342; TCGA THCA -0.207; TCGA STAD -0.24; TCGA UCEC -0.241 |
hsa-miR-221-3p | ERBB4 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; PAAD; SARC; THCA; STAD | miRNATAP | TCGA BLCA -0.902; TCGA BRCA -1.137; TCGA CESC -1.322; TCGA ESCA -0.61; TCGA HNSC -0.993; TCGA PAAD -0.598; TCGA SARC -0.412; TCGA THCA -0.199; TCGA STAD -0.561 |
hsa-miR-221-3p | ATAD2B | 9 cancers: BLCA; BRCA; KIRC; LGG; LUAD; OV; PRAD; SARC; UCEC | miRNATAP | TCGA BLCA -0.139; TCGA BRCA -0.076; TCGA KIRC -0.06; TCGA LGG -0.14; TCGA LUAD -0.166; TCGA OV -0.067; TCGA PRAD -0.153; TCGA SARC -0.103; TCGA UCEC -0.087 |
hsa-miR-221-3p | AXIN2 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; SARC; THCA | miRNATAP | TCGA BLCA -0.245; TCGA BRCA -0.187; TCGA CESC -0.518; TCGA HNSC -0.378; TCGA KIRP -0.219; TCGA LUAD -0.192; TCGA LUSC -0.28; TCGA SARC -0.243; TCGA THCA -0.222 |
hsa-miR-221-3p | RALGAPA1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.143; TCGA BRCA -0.287; TCGA CESC -0.128; TCGA COAD -0.162; TCGA ESCA -0.192; TCGA KIRC -0.132; TCGA LGG -0.069; TCGA LUAD -0.202; TCGA PAAD -0.118; TCGA PRAD -0.162; TCGA SARC -0.2; TCGA THCA -0.105; TCGA STAD -0.155; TCGA UCEC -0.152 |
hsa-miR-221-3p | SBK1 | 13 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA BLCA -0.726; TCGA BRCA -0.288; TCGA CESC -0.701; TCGA HNSC -0.584; TCGA KIRP -0.495; TCGA LGG -0.22; TCGA LUAD -0.509; TCGA LUSC -0.352; TCGA OV -0.343; TCGA PRAD -0.422; TCGA SARC -0.395; TCGA THCA -0.095; TCGA UCEC -0.151 |
hsa-miR-221-3p | NTF3 | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; OV; SARC; STAD | miRNATAP | TCGA BLCA -0.465; TCGA COAD -0.61; TCGA ESCA -0.345; TCGA HNSC -0.452; TCGA KIRC -0.192; TCGA LIHC -0.487; TCGA LUSC -0.307; TCGA OV -0.31; TCGA SARC -0.53; TCGA STAD -0.473 |
hsa-miR-221-3p | RND2 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; OV; PAAD; THCA; STAD | miRNATAP | TCGA BLCA -0.2; TCGA CESC -0.216; TCGA COAD -0.44; TCGA ESCA -0.497; TCGA HNSC -0.685; TCGA KIRP -0.287; TCGA LGG -0.297; TCGA LUAD -0.179; TCGA OV -0.441; TCGA PAAD -0.498; TCGA THCA -0.065; TCGA STAD -0.824 |
hsa-miR-221-3p | FAM13A | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.197; TCGA CESC -0.364; TCGA ESCA -0.293; TCGA HNSC -0.266; TCGA KIRC -0.181; TCGA KIRP -0.134; TCGA LIHC -0.574; TCGA SARC -0.152; TCGA THCA -0.172; TCGA STAD -0.274; TCGA UCEC -0.109 |
hsa-miR-221-3p | SHANK2 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; UCEC | miRNATAP | TCGA BLCA -0.191; TCGA BRCA -0.265; TCGA CESC -0.725; TCGA HNSC -0.391; TCGA KIRC -0.309; TCGA KIRP -0.187; TCGA LGG -0.133; TCGA PRAD -0.133; TCGA SARC -0.48; TCGA THCA -0.441; TCGA UCEC -0.269 |
hsa-miR-221-3p | BNIP3L | 9 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LIHC; OV; STAD; UCEC | miRNAWalker2 validate; miRTarBase; RAID | TCGA BRCA -0.105; TCGA COAD -0.187; TCGA ESCA -0.14; TCGA KIRC -0.213; TCGA KIRP -0.1; TCGA LIHC -0.123; TCGA OV -0.077; TCGA STAD -0.127; TCGA UCEC -0.085 |
hsa-miR-221-3p | CSTF2T | 11 cancers: BRCA; CESC; COAD; KIRC; LGG; LIHC; LUSC; PAAD; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.147; TCGA CESC -0.078; TCGA COAD -0.082; TCGA KIRC -0.096; TCGA LGG -0.102; TCGA LIHC -0.085; TCGA LUSC -0.113; TCGA PAAD -0.074; TCGA SARC -0.063; TCGA THCA -0.054; TCGA STAD -0.104 |
hsa-miR-221-3p | ERC1 | 11 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; OV; SARC; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.058; TCGA COAD -0.164; TCGA ESCA -0.16; TCGA KIRC -0.107; TCGA KIRP -0.107; TCGA LGG -0.057; TCGA LIHC -0.062; TCGA OV -0.098; TCGA SARC -0.095; TCGA THCA -0.085; TCGA STAD -0.272 |
hsa-miR-221-3p | HECTD2 | 9 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; PAAD; SARC; STAD | miRNAWalker2 validate; miRNATAP | TCGA BRCA -0.221; TCGA CESC -0.152; TCGA COAD -0.339; TCGA ESCA -0.272; TCGA KIRC -0.078; TCGA LUAD -0.108; TCGA PAAD -0.221; TCGA SARC -0.179; TCGA STAD -0.452 |
hsa-miR-221-3p | NDUFS1 | 10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; PRAD; THCA; UCEC | miRNAWalker2 validate | TCGA BRCA -0.114; TCGA CESC -0.108; TCGA ESCA -0.107; TCGA HNSC -0.112; TCGA KIRC -0.138; TCGA LIHC -0.205; TCGA LUAD -0.129; TCGA PRAD -0.073; TCGA THCA -0.071; TCGA UCEC -0.078 |
hsa-miR-221-3p | TIMP3 | 10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; THCA; STAD | miRNAWalker2 validate; miRTarBase; MirTarget; miRNATAP | TCGA BRCA -0.111; TCGA COAD -0.493; TCGA ESCA -0.701; TCGA HNSC -0.2; TCGA KIRC -0.369; TCGA LGG -0.139; TCGA LIHC -0.145; TCGA LUSC -0.243; TCGA THCA -0.212; TCGA STAD -0.548 |
hsa-miR-221-3p | TRPS1 | 9 cancers: BRCA; CESC; COAD; LGG; LUSC; SARC; THCA; STAD; UCEC | miRTarBase; MirTarget; miRNATAP | TCGA BRCA -0.225; TCGA CESC -0.276; TCGA COAD -0.63; TCGA LGG -0.052; TCGA LUSC -0.26; TCGA SARC -0.276; TCGA THCA -0.077; TCGA STAD -0.477; TCGA UCEC -0.36 |
hsa-miR-221-3p | PCDHA2 | 9 cancers: BRCA; CESC; ESCA; LGG; LUAD; OV; PAAD; PRAD; SARC | MirTarget | TCGA BRCA -0.287; TCGA CESC -0.643; TCGA ESCA -0.714; TCGA LGG -0.124; TCGA LUAD -0.189; TCGA OV -0.262; TCGA PAAD -0.426; TCGA PRAD -0.223; TCGA SARC -0.518 |
hsa-miR-221-3p | GAB1 | 10 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; OV; SARC; STAD | MirTarget; miRNATAP | TCGA BRCA -0.176; TCGA COAD -0.141; TCGA ESCA -0.303; TCGA KIRC -0.218; TCGA KIRP -0.139; TCGA LGG -0.117; TCGA LIHC -0.141; TCGA OV -0.093; TCGA SARC -0.227; TCGA STAD -0.387 |
hsa-miR-221-3p | RBM24 | 10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LUSC; PAAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BRCA -0.244; TCGA CESC -0.384; TCGA ESCA -0.703; TCGA HNSC -0.688; TCGA KIRC -0.299; TCGA LUSC -0.373; TCGA PAAD -0.297; TCGA SARC -0.586; TCGA THCA -0.428; TCGA STAD -1.078 |
hsa-miR-221-3p | ZADH2 | 9 cancers: BRCA; ESCA; KIRC; LIHC; OV; PAAD; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.145; TCGA ESCA -0.168; TCGA KIRC -0.129; TCGA LIHC -0.204; TCGA OV -0.08; TCGA PAAD -0.176; TCGA SARC -0.104; TCGA THCA -0.124; TCGA STAD -0.096 |
hsa-miR-221-3p | DCAF12 | 11 cancers: BRCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; THCA; UCEC | MirTarget | TCGA BRCA -0.069; TCGA COAD -0.073; TCGA KIRC -0.064; TCGA KIRP -0.052; TCGA LGG -0.146; TCGA LUAD -0.057; TCGA LUSC -0.123; TCGA OV -0.08; TCGA PRAD -0.159; TCGA THCA -0.095; TCGA UCEC -0.058 |
hsa-miR-221-3p | FNDC3A | 11 cancers: BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; STAD | MirTarget; miRNATAP | TCGA BRCA -0.082; TCGA CESC -0.26; TCGA COAD -0.139; TCGA KIRC -0.127; TCGA KIRP -0.157; TCGA LIHC -0.143; TCGA LUAD -0.101; TCGA LUSC -0.097; TCGA OV -0.116; TCGA PAAD -0.151; TCGA STAD -0.081 |
hsa-miR-221-3p | WDR47 | 9 cancers: BRCA; COAD; ESCA; KIRC; LIHC; OV; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BRCA -0.11; TCGA COAD -0.13; TCGA ESCA -0.178; TCGA KIRC -0.173; TCGA LIHC -0.088; TCGA OV -0.064; TCGA SARC -0.073; TCGA THCA -0.078; TCGA STAD -0.222 |
hsa-miR-221-3p | HOOK1 | 9 cancers: BRCA; CESC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC | MirTarget | TCGA BRCA -0.308; TCGA CESC -0.156; TCGA KIRC -0.395; TCGA KIRP -0.146; TCGA LIHC -0.209; TCGA LUAD -0.304; TCGA PAAD -0.132; TCGA PRAD -0.219; TCGA SARC -0.402 |
hsa-miR-221-3p | SNRNP48 | 9 cancers: BRCA; CESC; KIRC; KIRP; LGG; LUAD; OV; PRAD; THCA | MirTarget; mirMAP | TCGA BRCA -0.112; TCGA CESC -0.124; TCGA KIRC -0.15; TCGA KIRP -0.096; TCGA LGG -0.108; TCGA LUAD -0.148; TCGA OV -0.069; TCGA PRAD -0.071; TCGA THCA -0.099 |
hsa-miR-221-3p | HIPK1 | 10 cancers: BRCA; CESC; COAD; ESCA; KIRC; LIHC; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.138; TCGA CESC -0.168; TCGA COAD -0.133; TCGA ESCA -0.183; TCGA KIRC -0.121; TCGA LIHC -0.115; TCGA SARC -0.078; TCGA THCA -0.088; TCGA STAD -0.122; TCGA UCEC -0.125 |
hsa-miR-221-3p | FAM35A | 12 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; UCEC | MirTarget | TCGA BRCA -0.176; TCGA CESC -0.159; TCGA HNSC -0.062; TCGA KIRC -0.231; TCGA KIRP -0.219; TCGA LGG -0.168; TCGA LUAD -0.077; TCGA LUSC -0.103; TCGA PRAD -0.118; TCGA SARC -0.106; TCGA THCA -0.164; TCGA UCEC -0.104 |
hsa-miR-221-3p | ATF2 | 11 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; OV; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.165; TCGA CESC -0.166; TCGA COAD -0.145; TCGA ESCA -0.09; TCGA KIRC -0.204; TCGA LUAD -0.095; TCGA LUSC -0.095; TCGA OV -0.068; TCGA SARC -0.114; TCGA THCA -0.15; TCGA STAD -0.054 |
hsa-miR-221-3p | CHD8 | 9 cancers: BRCA; COAD; ESCA; LGG; LUAD; PRAD; SARC; THCA; STAD | MirTarget; miRNATAP | TCGA BRCA -0.148; TCGA COAD -0.092; TCGA ESCA -0.11; TCGA LGG -0.102; TCGA LUAD -0.059; TCGA PRAD -0.056; TCGA SARC -0.069; TCGA THCA -0.067; TCGA STAD -0.052 |
hsa-miR-221-3p | HIPK3 | 9 cancers: BRCA; CESC; COAD; ESCA; KIRC; LIHC; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.26; TCGA CESC -0.204; TCGA COAD -0.362; TCGA ESCA -0.303; TCGA KIRC -0.242; TCGA LIHC -0.302; TCGA SARC -0.232; TCGA THCA -0.121; TCGA STAD -0.345 |
hsa-miR-221-3p | HMBOX1 | 12 cancers: BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUAD; OV; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.167; TCGA COAD -0.136; TCGA ESCA -0.115; TCGA KIRC -0.093; TCGA LGG -0.066; TCGA LIHC -0.142; TCGA LUAD -0.155; TCGA OV -0.109; TCGA SARC -0.069; TCGA THCA -0.156; TCGA STAD -0.166; TCGA UCEC -0.228 |
hsa-miR-221-3p | FAM168A | 10 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUSC; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.148; TCGA CESC -0.127; TCGA COAD -0.313; TCGA ESCA -0.187; TCGA KIRC -0.15; TCGA LUSC -0.117; TCGA SARC -0.116; TCGA THCA -0.07; TCGA STAD -0.257; TCGA UCEC -0.102 |
hsa-miR-221-3p | GTF3C4 | 9 cancers: BRCA; COAD; KIRC; KIRP; LGG; LUSC; OV; SARC; THCA | mirMAP | TCGA BRCA -0.167; TCGA COAD -0.147; TCGA KIRC -0.139; TCGA KIRP -0.123; TCGA LGG -0.08; TCGA LUSC -0.118; TCGA OV -0.1; TCGA SARC -0.067; TCGA THCA -0.136 |
hsa-miR-221-3p | TBC1D24 | 10 cancers: BRCA; CESC; HNSC; LUAD; OV; PAAD; PRAD; SARC; THCA; UCEC | mirMAP | TCGA BRCA -0.094; TCGA CESC -0.159; TCGA HNSC -0.082; TCGA LUAD -0.101; TCGA OV -0.218; TCGA PAAD -0.179; TCGA PRAD -0.077; TCGA SARC -0.053; TCGA THCA -0.169; TCGA UCEC -0.106 |
hsa-miR-221-3p | IPO9 | 9 cancers: BRCA; KIRC; LGG; LUAD; LUSC; OV; PRAD; SARC; UCEC | mirMAP | TCGA BRCA -0.102; TCGA KIRC -0.072; TCGA LGG -0.051; TCGA LUAD -0.118; TCGA LUSC -0.123; TCGA OV -0.136; TCGA PRAD -0.069; TCGA SARC -0.1; TCGA UCEC -0.065 |
hsa-miR-221-3p | TAOK1 | 9 cancers: BRCA; CESC; COAD; KIRC; LIHC; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.295; TCGA CESC -0.156; TCGA COAD -0.264; TCGA KIRC -0.244; TCGA LIHC -0.158; TCGA SARC -0.153; TCGA THCA -0.136; TCGA STAD -0.097; TCGA UCEC -0.107 |
hsa-miR-221-3p | HIPK2 | 10 cancers: BRCA; CESC; COAD; KIRC; KIRP; LGG; LIHC; LUAD; PAAD; PRAD | miRNATAP | TCGA BRCA -0.156; TCGA CESC -0.231; TCGA COAD -0.178; TCGA KIRC -0.385; TCGA KIRP -0.213; TCGA LGG -0.116; TCGA LIHC -0.207; TCGA LUAD -0.098; TCGA PAAD -0.256; TCGA PRAD -0.246 |
hsa-miR-221-3p | ZFPM2 | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; THCA; STAD | miRNATAP | TCGA BRCA -0.092; TCGA CESC -0.292; TCGA COAD -0.702; TCGA ESCA -0.713; TCGA HNSC -0.617; TCGA LIHC -0.468; TCGA LUSC -0.34; TCGA THCA -0.333; TCGA STAD -0.789 |
hsa-miR-221-3p | SEPHS1 | 12 cancers: CESC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA CESC -0.113; TCGA KIRC -0.088; TCGA KIRP -0.159; TCGA LGG -0.156; TCGA LUAD -0.118; TCGA LUSC -0.078; TCGA OV -0.207; TCGA PAAD -0.085; TCGA PRAD -0.092; TCGA SARC -0.082; TCGA THCA -0.099; TCGA UCEC -0.074 |
hsa-miR-221-3p | DIRAS3 | 9 cancers: CESC; ESCA; HNSC; KIRP; LIHC; OV; PAAD; SARC; STAD | miRTarBase | TCGA CESC -0.268; TCGA ESCA -0.291; TCGA HNSC -0.451; TCGA KIRP -0.397; TCGA LIHC -0.985; TCGA OV -0.181; TCGA PAAD -0.443; TCGA SARC -0.258; TCGA STAD -0.771 |
hsa-miR-221-3p | FERMT2 | 9 cancers: CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; SARC; STAD | MirTarget; miRNATAP | TCGA CESC -0.518; TCGA COAD -0.835; TCGA ESCA -0.726; TCGA HNSC -0.483; TCGA KIRC -0.104; TCGA LIHC -0.153; TCGA LUSC -0.221; TCGA SARC -0.139; TCGA STAD -0.855 |
hsa-miR-221-3p | KCNK2 | 10 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; THCA; STAD | MirTarget | TCGA CESC -0.312; TCGA COAD -0.905; TCGA ESCA -1.04; TCGA HNSC -0.698; TCGA KIRC -0.331; TCGA KIRP -0.476; TCGA LIHC -0.341; TCGA PAAD -0.44; TCGA THCA -0.627; TCGA STAD -0.99 |
hsa-miR-221-3p | DTNA | 9 cancers: CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; PAAD; STAD | mirMAP | TCGA CESC -0.41; TCGA COAD -1.118; TCGA ESCA -1.002; TCGA HNSC -0.873; TCGA KIRP -0.175; TCGA LUSC -0.234; TCGA OV -0.463; TCGA PAAD -0.654; TCGA STAD -1.162 |
hsa-miR-221-3p | LIFR | 11 cancers: CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; PAAD; THCA; STAD | miRNATAP | TCGA CESC -0.315; TCGA COAD -0.846; TCGA ESCA -0.538; TCGA HNSC -0.333; TCGA KIRC -0.314; TCGA LGG -0.092; TCGA LIHC -0.543; TCGA LUAD -0.126; TCGA PAAD -0.323; TCGA THCA -0.535; TCGA STAD -0.561 |
hsa-miR-221-3p | PDZRN4 | 9 cancers: CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; SARC; STAD | miRNATAP | TCGA CESC -0.236; TCGA COAD -1.29; TCGA ESCA -1.387; TCGA HNSC -0.824; TCGA LGG -0.074; TCGA LUSC -0.379; TCGA PAAD -0.445; TCGA SARC -0.582; TCGA STAD -1.689 |
hsa-miR-221-3p | SUSD5 | 11 cancers: CESC; COAD; ESCA; HNSC; LGG; LUSC; OV; PAAD; SARC; THCA; STAD | miRNATAP | TCGA CESC -0.407; TCGA COAD -0.957; TCGA ESCA -0.483; TCGA HNSC -0.39; TCGA LGG -0.281; TCGA LUSC -0.393; TCGA OV -0.147; TCGA PAAD -0.208; TCGA SARC -0.263; TCGA THCA -0.332; TCGA STAD -0.672 |
hsa-miR-221-3p | PPARGC1A | 9 cancers: CESC; HNSC; KIRC; LIHC; LUAD; PAAD; SARC; THCA; STAD | miRNATAP | TCGA CESC -0.653; TCGA HNSC -0.846; TCGA KIRC -0.208; TCGA LIHC -0.866; TCGA LUAD -0.672; TCGA PAAD -0.412; TCGA SARC -0.465; TCGA THCA -0.745; TCGA STAD -0.374 |
hsa-miR-221-3p | REV3L | 13 cancers: CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; OV; PAAD; SARC; THCA; STAD; UCEC | miRNATAP | TCGA CESC -0.253; TCGA COAD -0.248; TCGA ESCA -0.162; TCGA KIRC -0.205; TCGA KIRP -0.151; TCGA LGG -0.1; TCGA LIHC -0.141; TCGA OV -0.109; TCGA PAAD -0.269; TCGA SARC -0.214; TCGA THCA -0.06; TCGA STAD -0.271; TCGA UCEC -0.154 |
hsa-miR-221-3p | TUB | 12 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; SARC; THCA; STAD | miRNAWalker2 validate; MirTarget | TCGA COAD -0.686; TCGA ESCA -0.76; TCGA HNSC -0.718; TCGA KIRC -0.386; TCGA KIRP -0.303; TCGA LGG -0.156; TCGA LUSC -0.229; TCGA OV -0.174; TCGA PAAD -0.224; TCGA SARC -0.581; TCGA THCA -0.324; TCGA STAD -0.884 |
hsa-miR-221-3p | ZEB2 | 9 cancers: COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; THCA; STAD | miRNAWalker2 validate; MirTarget; miRNATAP | TCGA COAD -0.556; TCGA ESCA -0.355; TCGA HNSC -0.222; TCGA KIRC -0.094; TCGA LGG -0.059; TCGA LIHC -0.183; TCGA LUSC -0.185; TCGA THCA -0.066; TCGA STAD -0.365 |
hsa-miR-221-3p | CXCL12 | 9 cancers: COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; THCA; STAD | MirTarget | TCGA COAD -0.614; TCGA ESCA -0.686; TCGA HNSC -0.597; TCGA KIRC -0.31; TCGA LIHC -0.313; TCGA LUSC -0.442; TCGA PAAD -0.63; TCGA THCA -0.156; TCGA STAD -0.651 |
hsa-miR-221-3p | TCF4 | 10 cancers: COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; SARC; THCA; STAD | miRNATAP | TCGA COAD -0.638; TCGA ESCA -0.328; TCGA HNSC -0.283; TCGA KIRC -0.178; TCGA LGG -0.125; TCGA LIHC -0.091; TCGA LUSC -0.194; TCGA SARC -0.188; TCGA THCA -0.141; TCGA STAD -0.374 |
hsa-miR-221-3p | GPM6A | 9 cancers: COAD; ESCA; KIRC; LGG; LIHC; PAAD; SARC; THCA; STAD | miRNATAP | TCGA COAD -1.705; TCGA ESCA -1.158; TCGA KIRC -0.39; TCGA LGG -0.075; TCGA LIHC -0.873; TCGA PAAD -0.689; TCGA SARC -0.384; TCGA THCA -0.651; TCGA STAD -1.326 |
hsa-miR-221-3p | BNIP3 | 9 cancers: KIRC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA KIRC -0.216; TCGA KIRP -0.113; TCGA LIHC -0.192; TCGA LUAD -0.289; TCGA OV -0.156; TCGA PAAD -0.261; TCGA PRAD -0.182; TCGA STAD -0.391; TCGA UCEC -0.154 |
Enriched cancer pathways of putative targets